8-Week Kaempferia parviflora Extract Administration Improves Submaximal Exercise Capacity in Mice by Enhancing Skeletal Muscle Antioxidant Gene Expression and Plasma Antioxidant Capacity
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Preparation of Kaempferia parviflora Extract (KPE)
2.3. Submaximal Endurance Exercise Capacity Testing Protocol
2.4. Voluntary Wheel-Running and KPE Administration
2.5. Measurement of Plasma Biochemical Parameters and Biomarker of Oxidative Stress Level and Antioxidant Capacity
2.6. Real-Time Quantitative Polymerase Chain Reaction (PCR)
2.7. Statistical Analysis
3. Results
3.1. Standardized Crude Extract of KPE
3.2. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Mice Submaximal Endurance Exercise Capacity and Total Daily Voluntary Wheel-Running Distance
3.3. Effect of Long-Term KPE Administration on Mice Plasma Oxidative Stress and Anti-Oxidative Stress Capacity
3.4. Correlation between Submaximal Endurance Exercise Capacity, Total Daily Voluntary Wheel-Running Distance, and Plasma Antioxidant Capacity
3.5. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Metabolism Regulation in Plasma
3.6. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Oxidative Stress Response Regulators Gene Expression in Soleus Muscle
3.7. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Superoxide Dismutase’s Gene Expression in Soleus Muscle
3.8. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Glutathione Metabolism and Antioxidant Defense-Related Gene Expression in Soleus Muscle
3.9. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Antioxidant-Related Gene Expression in Soleus Muscle
3.10. Effect of Long-Term KPE Administration and Voluntary Wheel-Running Training on Antioxidant-Related Gene Expression in Gastrocnemius Muscle
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sies, H. Oxidative stress: From basic research to clinical application. Am. J. Med. 1991, 91, 31S–38S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [Scilit]
- Sies, H. Oxidative stress: Oxidants and antioxidants. Exp. Physiol. 1997, 82, 291–295. [Google Scholar] [CrossRef] [Scilit]
- Meng, Q.; Su, C.H. The Impact of Physical Exercise on Oxidative and Nitrosative Stress: Balancing the Benefits and Risks. Antioxidants 2024, 13, 573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finkel, T.; Holbrook, N.J. Oxidants, oxidative stress and the biology of ageing. Nature 2000, 408, 239–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mason, S.A.; Trewin, A.J.; Parker, L.; Wadley, G.D. Antioxidant supplements and endurance exercise: Current evidence and mechanistic insights. Redox Biol. 2020, 35, 101471. [Google Scholar] [CrossRef] [Scilit]
- Davies, K.J. Oxidative stress, antioxidant defenses, and damage removal, repair, and replacement systems. IUBMB Life 2000, 50, 279–289. [Google Scholar] [CrossRef] [Scilit]
- Pisoschi, A.M.; Pop, A. The role of antioxidants in the chemistry of oxidative stress: A review. Eur. J. Med. Chem. 2015, 97, 55–74. [Google Scholar] [CrossRef] [Scilit]
- Munteanu, C.; Turnea, M.A.; Rotariu, M. Hydrogen Sulfide: An Emerging Regulator of Oxidative Stress and Cellular Homeostasis—A Comprehensive One-Year Review. Antioxidants 2023, 12, 1737. [Google Scholar] [CrossRef] [Scilit]
- Corsello, T.; Komaravelli, N.; Casola, A. Role of Hydrogen Sulfide in NRF2- and Sirtuin-Dependent Maintenance of Cellular Redox Balance. Antioxidants 2018, 7, 129. [Google Scholar] [CrossRef] [Scilit]
- Ye, Y.; Lin, H.; Wan, M.; Qiu, P.; Xia, R.; He, J.; Tao, J.; Chen, L.; Zheng, G. The Effects of Aerobic Exercise on Oxidative Stress in Older Adults: A Systematic Review and Meta-Analysis. Front. Physiol. 2021, 12, 701151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyata, M.; Kasai, H.; Kawai, K.; Yamada, N.; Tokudome, M.; Ichikawa, H.; Goto, C.; Tokudome, Y.; Kuriki, K.; Hoshino, H.; et al. Changes of urinary 8-hydroxydeoxyguanosine levels during a two-day ultramarathon race period in Japanese non-professional runners. Int. J. Sports Med. 2008, 29, 27–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shamsnia, E.; Matinhomaee, H.; Azarbayjani, M.A.; Peeri, M. The Effect of Aerobic Exercise on Oxidative Stress in Skeletal Muscle Tissue: A Narrative Review. Gene Cell Tissue 2023, 10. [Google Scholar] [CrossRef] [Scilit]
- Radak, Z.; Zhao, Z.; Koltai, E.; Ohno, H.; Atalay, M. Oxygen consumption and usage during physical exercise: The balance between oxidative stress and ROS-dependent adaptive signaling. Antioxid. Redox Signal 2013, 18, 1208–1246. [Google Scholar] [CrossRef] [Scilit]
- Powers, S.K.; Jackson, M.J. Exercise-induced oxidative stress: Cellular mechanisms and impact on muscle force production. Physiol. Rev. 2008, 88, 1243–1276. [Google Scholar] [CrossRef] [Scilit]
- Casazza, G.A.; Tovar, A.P.; Richardson, C.E.; Cortez, A.N.; Davis, B.A. Energy Availability, Macronutrient Intake, and Nutritional Supplementation for Improving Exercise Performance in Endurance Athletes. Curr. Sports Med. Rep. 2018, 17, 215–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spanier, G.; Xu, H.; Xia, N.; Tobias, S.; Deng, S.; Wojnowski, L.; Forstermann, U.; Li, H. Resveratrol reduces endothelial oxidative stress by modulating the gene expression of superoxide dismutase 1 (SOD1), glutathione peroxidase 1 (GPx1) and NADPH oxidase subunit (Nox4). J. Physiol. Pharmacol. 2009, 60 (Suppl. 4), 111–116. [Google Scholar]
- Kawanishi, N.; Kato, K.; Takahashi, M.; Mizokami, T.; Otsuka, Y.; Imaizumi, A.; Shiva, D.; Yano, H.; Suzuki, K. Curcumin attenuates oxidative stress following downhill running-induced muscle damage. Biochem. Biophys. Res. Commun. 2013, 441, 573–578. [Google Scholar] [CrossRef] [Scilit]
- Wafi, A.M.; Hong, J.; Rudebush, T.L.; Yu, L.; Hackfort, B.; Wang, H.; Schultz, H.D.; Zucker, I.H.; Gao, L. Curcumin improves exercise performance of mice with coronary artery ligation-induced HFrEF: Nrf2 and antioxidant mechanisms in skeletal muscle. J. Appl. Physiol. (1985) 2019, 126, 477–486. [Google Scholar] [CrossRef] [Scilit]
- Bowtell, J.; Kelly, V. Fruit-Derived Polyphenol Supplementation for Athlete Recovery and Performance. Sports Med. 2019, 49, 3–23. [Google Scholar] [CrossRef] [Scilit]
- d’Unienville, N.M.A.; Blake, H.T.; Coates, A.M.; Hill, A.M.; Nelson, M.J.; Buckley, J.D. Effect of food sources of nitrate, polyphenols, L-arginine and L-citrulline on endurance exercise performance: A systematic review and meta-analysis of randomised controlled trials. J. Int. Soc. Sports Nutr. 2021, 18, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, J.; Tagawa, T.; Ma, S.; Suzuki, K. Black Ginger (Kaempferia parviflora) Extract Enhances Endurance Capacity by Improving Energy Metabolism and Substrate Utilization in Mice. Nutrients 2022, 14, 3845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saokaew, S.; Wilairat, P.; Raktanyakan, P.; Dilokthornsakul, P.; Dhippayom, T.; Kongkaew, C.; Sruamsiri, R.; Chuthaputti, A.; Chaiyakunapruk, N. Clinical Effects of Krachaidum (Kaempferia parviflora): A Systematic Review. J. Evid. Based Complement. Altern. Med. 2017, 22, 413–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Li, H.; Li, W.; Feng, S.; Deng, D. Kaempferia parviflora and Its Methoxyflavones: Chemistry and Biological Activities. Evid. Based Complement. Alternat Med. 2018, 2018, 4057456. [Google Scholar] [CrossRef] [Scilit]
- Klinngam, W.; Rungkamoltip, P.; Wongwanakul, R.; Joothamongkhon, J.; Du, A.M.S.; Khongkow, M.; Asawapirom, U.; Iempridee, T.; Ruktanonchai, U. Skin Rejuvenation Efficacy and Safety Evaluation of Kaempferia parviflora Standardized Extract (BG100) in Human 3D Skin Models and Clinical Trial. Biomolecules 2024, 14, 776. [Google Scholar] [CrossRef] [Scilit]
- Lee, M.H.; Han, A.R.; Jang, M.; Choi, H.K.; Lee, S.Y.; Kim, K.T.; Lim, T.G. Antiskin Inflammatory Activity of Black Ginger (Kaempferia parviflora) through Antioxidative Activity. Oxid. Med. Cell Longev. 2018, 2018, 5967150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malakul, W.; Thirawarapan, S.; Ingkaninan, K.; Sawasdee, P. Effects of Kaempferia parviflora Wall. Ex Baker on endothelial dysfunction in streptozotocin-induced diabetic rats. J. Ethnopharmacol. 2011, 133, 371–377. [Google Scholar] [CrossRef] [Scilit]
- Wattanathorn, J.; Muchimapura, S.; Tong-Un, T.; Saenghong, N.; Thukhum-Mee, W.; Sripanidkulchai, B. Positive Modulation Effect of 8-Week Consumption of Kaempferia parviflora on Health-Related Physical Fitness and Oxidative Status in Healthy Elderly Volunteers. Evid. Based Complement. Alternat Med. 2012, 2012, 732816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.; Jang, T.; Kim, K.H.; Kang, K.S. Improvement of Damage in Human Dermal Fibroblasts by 3,5,7-Trimethoxyflavone from Black Ginger (Kaempferia parviflora). Antioxidants 2022, 11, 425. [Google Scholar] [CrossRef] [Scilit]
- Berger, R.G.; Lunkenbein, S.; Strohle, A.; Hahn, A. Antioxidants in food: Mere myth or magic medicine? Crit. Rev. Food Sci. Nutr. 2012, 52, 162–171. [Google Scholar] [CrossRef] [Scilit]
- Ma, S.; Yang, J.; Tominaga, T.; Liu, C.; Suzuki, K. A Low-Carbohydrate Ketogenic Diet and Treadmill Training Enhanced Fatty Acid Oxidation Capacity but Did Not Enhance Maximal Exercise Capacity in Mice. Nutrients 2021, 13, 611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zachwieja, N.J.; O’Connell, G.C.; Stricker, J.C.; Allen, J.; Vona-Davis, L.; Bryner, R.; Mandler, W.; Olfert, I.M. Loss of Adipocyte VEGF Impairs Endurance Exercise Capacity in Mice. Med. Sci. Sports Exerc. 2015, 47, 2329–2339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jansen, E.H.; Ruskovska, T. Comparative Analysis of Serum (Anti)oxidative Status Parsmall a, Cyrillicmeters in Healthy Persons. Int. J. Mol. Sci. 2013, 14, 6106–6115. [Google Scholar] [CrossRef] [Scilit]
- Manzanares, G.; Brito-da-Silva, G.; Gandra, P.G. Voluntary wheel running: Patterns and physiological effects in mice. Braz. J. Med. Biol. Res. 2018, 52, e7830. [Google Scholar] [CrossRef] [Scilit]
- De Bono, J.P.; Adlam, D.; Paterson, D.J.; Channon, K.M. Novel quantitative phenotypes of exercise training in mouse models. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 290, R926–R934. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, K.; Machida, K. Effectiveness of lower-level voluntary exercise in disease prevention of mature rats. I. Cardiovascular risk factor modification. Eur. J. Appl. Physiol. Occup. Physiol. 1995, 71, 240–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pellegrino, M.A.; Brocca, L.; Dioguardi, F.S.; Bottinelli, R.; D’Antona, G. Effects of voluntary wheel running and amino acid supplementation on skeletal muscle of mice. Eur. J. Appl. Physiol. 2005, 93, 655–664. [Google Scholar] [CrossRef] [Scilit]
- Call, J.A.; Voelker, K.A.; Wolff, A.V.; McMillan, R.P.; Evans, N.P.; Hulver, M.W.; Talmadge, R.J.; Grange, R.W. Endurance capacity in maturing mdx mice is markedly enhanced by combined voluntary wheel running and green tea extract. J. Appl. Physiol. (1985) 2008, 105, 923–932. [Google Scholar] [CrossRef] [Scilit]
- Meek, T.H.; Lonquich, B.P.; Hannon, R.M.; Garland, T., Jr. Endurance capacity of mice selectively bred for high voluntary wheel running. J. Exp. Biol. 2009, 212, 2908–2917. [Google Scholar] [CrossRef] [Scilit]
- Takeshita, H.; Horiuchi, M.; Izumo, K.; Kawaguchi, H.; Arimura, E.; Aoyama, K.; Takeuchi, T. Long-term voluntary exercise, representing habitual exercise, lowers visceral fat and alters plasma amino acid levels in mice. Environ. Health Prev. Med. 2012, 17, 275–284. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, K.; Tominaga, T.; Ruhee, R.T.; Ma, S. Characterization and Modulation of Systemic Inflammatory Response to Exhaustive Exercise in Relation to Oxidative Stress. Antioxidants 2020, 9, 401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serafini, M.M.; Catanzaro, M.; Fagiani, F.; Simoni, E.; Caporaso, R.; Dacrema, M.; Romanoni, I.; Govoni, S.; Racchi, M.; Daglia, M.; et al. Modulation of Keap1/Nrf2/ARE Signaling Pathway by Curcuma- and Garlic-Derived Hybrids. Front. Pharmacol. 2019, 10, 1597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, J.; Li, K.; Lin, Y.; Liu, Y. Protective effects and molecular mechanisms of tea polyphenols on cardiovascular diseases. Front. Nutr. 2023, 10, 1202378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clemente-Suarez, V.J.; Bustamante-Sanchez, A.; Mielgo-Ayuso, J.; Martinez-Guardado, I.; Martin-Rodriguez, A.; Tornero-Aguilera, J.F. Antioxidants and Sports Performance. Nutrients 2023, 15, 2371. [Google Scholar] [CrossRef] [Scilit]
- McCord, J.M.; Edeas, M.A. SOD, oxidative stress and human pathologies: A brief history and a future vision. Biomed. Pharmacother. 2005, 59, 139–142. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Liu, Y.; Wang, Y.; Chao, Y.; Zhang, J.; Jia, Y.; Tie, J.; Hu, D. Regulation of SIRT1 and Its Roles in Inflammation. Front. Immunol. 2022, 13, 831168. [Google Scholar] [CrossRef] [Scilit]
- Yao, H.; Sundar, I.K.; Ahmad, T.; Lerner, C.; Gerloff, J.; Friedman, A.E.; Phipps, R.P.; Sime, P.J.; McBurney, M.W.; Guarente, L.; et al. SIRT1 protects against cigarette smoke-induced lung oxidative stress via a FOXO3-dependent mechanism. Am. J. Physiol. Lung Cell Mol. Physiol. 2014, 306, L816–L828. [Google Scholar] [CrossRef] [Scilit]
- Mahlooji, M.A.; Heshmati, A.; Kheiripour, N.; Ghasemi, H.; Asl, S.S.; Solgi, G.; Ranjbar, A.; Hosseini, A. Evaluation of Protective Effects of Curcumin and Nanocurcumin on Aluminium Phosphide-Induced Subacute Lung Injury in Rats: Modulation of Oxidative Stress through SIRT1/FOXO3 Signalling Pathway. Drug. Res. (Stuttg) 2022, 72, 100–108. [Google Scholar] [CrossRef] [Scilit]
- Hu, P.; Li, H.; Yu, X.; Liu, X.; Wang, X.; Qing, Y.; Wang, Z.; Wang, H.; Zhu, M.; Xu, J.; et al. GL-V9 exerts anti-T cell malignancies effects via promoting lysosome-dependent AKT1 degradation and activating AKT1/FOXO3A/BIM axis. Free Radic. Biol. Med. 2019, 145, 237–249. [Google Scholar] [CrossRef] [Scilit]
- Budanov, A.V. The role of tumor suppressor p53 in the antioxidant defense and metabolism. Subcell. Biochem. 2014, 85, 337–358. [Google Scholar] [CrossRef] [Scilit]
- Borras, C.; Gomez-Cabrera, M.C.; Vina, J. The dual role of p53: DNA protection and antioxidant. Free Radic. Res. 2011, 45, 643–652. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, M.; Liu, Y.; Zhang, G.; Yang, Z.; Xu, W.; Chen, Q. The Applications and Mechanisms of Superoxide Dismutase in Medicine, Food, and Cosmetics. Antioxidants 2023, 12, 1675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Magalingam, K.B.; Radhakrishnan, A.; Ping, N.S.; Haleagrahara, N. Current Concepts of Neurodegenerative Mechanisms in Alzheimer’s Disease. BioMed Res. Int. 2018, 2018, 3740461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owen, J.B.; Butterfield, D.A. Measurement of oxidized/reduced glutathione ratio. Methods Mol. Biol. 2010, 648, 269–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harvey, C.J.; Thimmulappa, R.K.; Singh, A.; Blake, D.J.; Ling, G.; Wakabayashi, N.; Fujii, J.; Myers, A.; Biswal, S. Nrf2-regulated glutathione recycling independent of biosynthesis is critical for cell survival during oxidative stress. Free Radic. Biol. Med. 2009, 46, 443–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shih, A.Y.; Johnson, D.A.; Wong, G.; Kraft, A.D.; Jiang, L.; Erb, H.; Johnson, J.A.; Murphy, T.H. Coordinate regulation of glutathione biosynthesis and release by Nrf2-expressing glia potently protects neurons from oxidative stress. J. Neurosci. 2003, 23, 3394–3406. [Google Scholar] [CrossRef] [Scilit]
- He, F.; Ru, X.; Wen, T. NRF2, a Transcription Factor for Stress Response and Beyond. Int. J. Mol. Sci. 2020, 21, 4777. [Google Scholar] [CrossRef] [Scilit]
- Ingold, I.; Conrad, M. Oxidative Stress, Selenium Redox Systems Including GPX/TXNRD Families. Mol. Integr. Toxicol. 2018. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Duan, S.; Zhou, Y.; Yu, S.; Wu, J.; Wu, X.; Zhao, J.; Zhao, Y. Sulfiredoxin-1 attenuates oxidative stress via Nrf2/ARE pathway and 2-Cys Prdxs after oxygen-glucose deprivation in astrocytes. J. Mol. Neurosci. 2015, 55, 941–950. [Google Scholar] [CrossRef] [Scilit]










| Gene Symbol for Primer | Forward | Reverse |
|---|---|---|
| Rn18s (NR_003278.3) | TTCTGGCCAACGGTCTAGACAAC | CCAGTGGTCTTGGTGTGCTGA6 |
| Sirt1 (NM_001159589.2) | ACGGTATCTATGCTCGCCTTGC | GACACAGAGACGGCTGGAACTG |
| Nfe212 (Nrf2); NM_001399226.1 | AGTTGCCACCGCCAGGACTA | CGTGCTCAGAAACCTCCTTCCAAA |
| Foxo3 (NM_001376967.1) | TCCGTGAGCAAGCCGTGTACT | AGCAGGTCGTCCATGAGGTTCT |
| Trp53 (NM_001127233.2) | GCATGAACCGCCGACCTATCCT | CAGGGCAGGCACAAACACGAA |
| Akt1 (NM_001165894.2) | AAGGAGGTCATCGTCGCCAAGG | CGGTCGTGGGTCTGGAATGAGT |
| Sod1 (NM_011434.2) | GAACCAGTTGTGTTGTCAG | GTACAGCCTTGTGTATTGTC |
| Sod2 (NM_013671.3) | CAACTCAGGTCGCTCTTC | TGATAGCCTCCAGCAACT |
| Sod3 (NM_011435.3) | CTTGTTCTACGGCTTGCTA | CTATCTTCTCAACCAGGTCAA |
| Gclm (NM_008129.4) | CATGGCTTCGCCTCCGATTGA | GCTGCTCCAACTGTGTCTTGTC |
| Gss (NM_001291111.1) | GCTGTGGTGTACTTCCGAGATGG | GGACACTTGGCAGCACGAGAT |
| Gpx1 (NM_001329527.1) | GCAATCAGTTCGGACACCAGAAT | CTCACCATTCACTTCGCACTTCTC |
| Gpx3 (NM_001329860.1) | ATGGCGGTATGAGTGGTA | CAAGGTATTGGTCTGTCAGA |
| Gclc (NM_010295.2) | CACATCTACCACGCAGTCAAGGA | AGTCTCAAGAACATCGCCTCCATT |
| Gsr (NM_010344.4) | CGGCGTGGAGGTGTTGAAGTT | ACATCTGGAATCATGGTCGTGGTG |
| Txn1 (NM_011660.3) | GCTTGTCGTGGTGGACTTCTCTG | CAGCAACATCCTGGCAGTCATCC |
| Cat (NM_080483.3) | GATGGAGAGGCAGTCTATTG | ATTGGCGATGGCATTGAA |
| Hmox1 (NM_010442.2) | GACCGCCTTCCTGCTCAACATT | CCTCTGACGAAGTGACGCCATC |
| Nqo1 (NM_008706.5) | GGTAGCGGCTCCATGTACTCTC | ACGCAGGATGCCACTCTGAATC |
| Prdx1 (NM_011034.5) | GCCGCTCTGTGGATGAGATTATAC | GCTTGATGGTATCACTGCCAGGTT |
| Txnrd2 (NM_001353143.1) | GCACAGGTGATGCAGACAGTAGG | TAGCCTCAGCAACCAGTCACAGTA |
| Srxn1 (NM_029688.6) | CCCAGGGTGGCGACTACTACTA | GCTTGGCAGGAATGGTCTCTCT |
| Il6 (NM_001314054.1) | CTTGGGACTGATGCTGGTGACA | GCCTCCGACTTGTGAAGTGGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Tong, Y.; Wang, S.; Tagawa, T.; Seki, Y.; Ma, S.; Zhang, Z.; Cao, T.; Kobori, H.; Suzuki, K. 8-Week Kaempferia parviflora Extract Administration Improves Submaximal Exercise Capacity in Mice by Enhancing Skeletal Muscle Antioxidant Gene Expression and Plasma Antioxidant Capacity. Antioxidants 2024, 13, 1147. https://doi.org/10.3390/antiox13091147
Huang J, Tong Y, Wang S, Tagawa T, Seki Y, Ma S, Zhang Z, Cao T, Kobori H, Suzuki K. 8-Week Kaempferia parviflora Extract Administration Improves Submaximal Exercise Capacity in Mice by Enhancing Skeletal Muscle Antioxidant Gene Expression and Plasma Antioxidant Capacity. Antioxidants. 2024; 13(9):1147. https://doi.org/10.3390/antiox13091147
Chicago/Turabian StyleHuang, Jiapeng, Yishan Tong, Shuo Wang, Takashi Tagawa, Yasuhiro Seki, Sihui Ma, Ziwei Zhang, Tiehan Cao, Haruki Kobori, and Katsuhiko Suzuki. 2024. "8-Week Kaempferia parviflora Extract Administration Improves Submaximal Exercise Capacity in Mice by Enhancing Skeletal Muscle Antioxidant Gene Expression and Plasma Antioxidant Capacity" Antioxidants 13, no. 9: 1147. https://doi.org/10.3390/antiox13091147
APA StyleHuang, J., Tong, Y., Wang, S., Tagawa, T., Seki, Y., Ma, S., Zhang, Z., Cao, T., Kobori, H., & Suzuki, K. (2024). 8-Week Kaempferia parviflora Extract Administration Improves Submaximal Exercise Capacity in Mice by Enhancing Skeletal Muscle Antioxidant Gene Expression and Plasma Antioxidant Capacity. Antioxidants, 13(9), 1147. https://doi.org/10.3390/antiox13091147

