Broccoli Byproduct Extracts Attenuate the Expression of UVB-Induced Proinflammatory Cytokines in HaCaT Keratinocytes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Extract
2.2. Characterization of Bioactive Compounds in BBE
2.3. Antioxidant Capacity of the BBEs
2.4. HaCaT Cell Culture Maintenance
2.5. Cell Viability Assay
2.6. Determination of Intracellular ROS Production
2.7. RNA Isolation and Quantitative Real-Time RT-PCR
2.8. Scratch Wound Healing Assay
2.9. Statistical Analysis
3. Results
3.1. Effect of BBE on Intracellular ROS Production in UVB-Exposed HaCaT Keratinocytes
3.2. Effect of BBE on the Expression of Inflammation-Related Genes in HaCaT Keratinocytes Exposed to UVB Light
3.3. Use of BBE to Repair Skin Wounds
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hussein, M.R. Ultraviolet Radiation and Skin Cancer: Molecular Mechanisms. J. Cutan. Pathol. 2005, 32, 191–205. [Google Scholar] [CrossRef] [PubMed]
- Godar, D. UV Doses Worldwide. Photochem. Photobiol. 2005, 81, 736–749. [Google Scholar] [CrossRef] [PubMed]
- Svobodova, A.; Walterova, D.; Vostalova, J. Ultraviolet Light Induced Alteration to the Skin. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc. Czech Repub. 2006, 150, 25–38. [Google Scholar] [CrossRef]
- Liu, S.; Guo, C.; Wu, D.; Ren, Y.; Sun, M.Z.; Xu, P. Protein Indicators for HaCaT Cell Damage Induced by UVB Irradiation. J. Photochem. Photobiol. B 2012, 114, 94–101. [Google Scholar] [CrossRef]
- Li, H.Y.; Zhang, F.R.; Deng, D.Q. Relationship between UV-Irradiated HaCaT Cell Cytokines and Th1/Th2 Imbalance. Genet. Mol. Res. 2015, 14, 7976–7985. [Google Scholar] [CrossRef] [PubMed]
- Monfrecola, G.; Gaudiello, F.; Cirillo, T.; Fabbrocini, G.; Balato, A.; Lembo, S. Nicotinamide Downregulates Gene Expression of Interleukin-6, Interleukin-10, Monocyte Chemoattractant Protein-1, and Tumour Necrosis Factor-α Gene Expression in HaCaT Keratinocytes after Ultraviolet B Irradiation. Clin. Exp. Dermatol. 2013, 38, 185–188. [Google Scholar] [CrossRef]
- Bouzroud, S.; El Maaiden, E.; Sobeh, M.; Merghoub, N.; Boukcim, H.; Kouisni, L.; El Kharrassi, Y. Biotechnological Approaches to Producing Natural Antioxidants: Anti-Ageing and Skin Longevity Prospects. Int. J. Mol. Sci. 2023, 24, 1397. [Google Scholar] [CrossRef]
- Borja-Martínez, M.; Lozano-Sánchez, J.; Borrás-Linares, I.; Pedreño, M.A.; Sabater-Jara, A.B. Revalorization of Broccoli By-Products for Cosmetic Uses Using Supercritical Fluid Extraction. Antioxidants 2020, 9, 1195. [Google Scholar] [CrossRef]
- Dang, Y.; Zhou, T.; Hao, L.; Cao, J.; Sun, Y.; Pan, D. In Vitro and in Vivo Studies on the Angiotensin-Converting Enzyme Inhibitory Activity Peptides Isolated from Broccoli Protein Hydrolysate. J. Agric. Food Chem. 2019, 67, 6757–6764. [Google Scholar] [CrossRef]
- Jang, H.W.; Moon, J.K.; Shibamoto, T. Analysis and Antioxidant Activity of Extracts from Broccoli (Brassica oleracea L.) Sprouts. J. Agric. Food Chem. 2015, 63, 1169–1174. [Google Scholar] [CrossRef]
- Ares, A.M.; Nozal, M.J.; Bernal, J. Extraction, Chemical Characterization and Biological Activity Determination of Broccoli Health Promoting Compounds. J. Chromatogr. A 2013, 1313, 78–95. [Google Scholar] [CrossRef] [PubMed]
- Freitas, L.C.; Barbosa, J.R.; da Costa, A.L.C.; Bezerra, F.W.F.; Pinto, R.H.H.; Carvalho Junior, R.N. de From Waste to Sustainable Industry: How Can Agro-Industrial Wastes Help in the Development of New Products? Resour. Conserv. Recycl. 2021, 169, 105466. [Google Scholar] [CrossRef]
- Zhou, J.; Gullón, B.; Wang, M.; Gullón, P.; Lorenzo, J.M.; Barba, F.J. The Application of Supercritical Fluids Technology to Recover Healthy Valuable Compounds from Marine and Agricultural Food Processing By-Products: A Review. Processes 2021, 9, 357. [Google Scholar] [CrossRef]
- Park, J.; Seok, J.K.; Suh, H.J.; Boo, Y.C. Gardenia Jasminoides Extract Attenuates the UVB-Induced Expressions of Cytokines in Keratinocytes and Indirectly Inhibits Matrix Metalloproteinase-1 Expression in Human Dermal Fibroblasts. Evid.-Based Complement. Altern. Med. 2014, 2014, 429246. [Google Scholar] [CrossRef] [PubMed]
- Vostálová, J.; Zdařilová, A.; Svobodová, A. Prunella Vulgaris Extract and Rosmarinic Acid Prevent UVB-Induced DNA Damage and Oxidative Stress in HaCaT Keratinocytes. Arch. Dermatol. Res. 2010, 302, 171–181. [Google Scholar] [CrossRef]
- Zaid, M.A.; Afaq, F.; Syed, D.N.; Dreher, M.; Mukhtar, H. Inhibition of UVB-Mediated Oxidative Stress and Markers of Photoaging in Immortalized HaCaT Keratinocytes by Pomegranate Polyphenol Extract POMx. Photochem. Photobiol. 2007, 83, 882–888. [Google Scholar] [CrossRef]
- Calò, R.; Marabini, L. Protective Effect of Vaccinium Myrtillus Extract against UVA- and UVB-Induced Damage in a Human Keratinocyte Cell Line (HaCaT Cells). J. Photochem. Photobiol. B 2014, 132, 27–35. [Google Scholar] [CrossRef]
- Mansuri, R.; Diwan, A.; Kumar, H.; Dangwal, K.; Yadav, D. Potential of Natural Compounds as Sunscreen Agents. Pharmacogn. Rev. 2021, 15, 47–56. [Google Scholar] [CrossRef]
- Shibata, A.; Nakagawa, K.; Yamanoi, H.; Tsuduki, T.; Sookwong, P.; Higuchi, O.; Kimura, F.; Miyazawa, T. Sulforaphane Suppresses Ultraviolet B-Induced Inflammation in HaCaT Keratinocytes and HR-1 Hairless Mice. J. Nutr. Biochem. 2010, 21, 702–709. [Google Scholar] [CrossRef]
- Singleton, V.L.; Rossi, J.A. Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar] [CrossRef]
- Ansary, T.M.; Hossain, M.R.; Kamiya, K.; Komine, M.; Ohtsuki, M. Inflammatory Molecules Associated with Ultraviolet Radiation-mediated Skin Aging. Int. J. Mol. Sci. 2021, 22, 3974. [Google Scholar] [CrossRef]
- Piechowiak, T.; Skóra, B.; Grzelak-Błaszczyk, K.; Sójka, M. Extraction of Antioxidant Compounds from Blueberry Fruit Waste and Evaluation of Their In Vitro Biological Activity in Human Keratinocytes (HaCaT). Food Anal. Methods 2021, 14, 2317–2327. [Google Scholar] [CrossRef]
- Song, J.-L.; Gao, Y. Protective Effects of Lindera Coreana on UVB-Induced Oxidative Stress in Human HaCaT Keratinocytes. Iran. J. Pharm. Res. 2014, 13, 1369–1378. [Google Scholar] [PubMed]
- Oh, J.H.; Karadeniz, F.; Lee, J.I.; Seo, Y.; Kong, C.S. Protective Effect of 3,5-Dicaffeoyl-Epi-Quinic Acid against UVB-Induced Photoaging in Human HaCaT Keratinocytes. Mol. Med. Rep. 2019, 20, 763–770. [Google Scholar] [CrossRef] [PubMed]
- Simitzis, P.E. Agro-Industrial by-Products and Their Bioactive Compounds—An Ally against Oxidative Stress and Skin Aging. Cosmetics 2018, 5, 58. [Google Scholar] [CrossRef]
- Jaisin, Y.; Ratanachamnong, P.; Wongsawatkul, O.; Watthammawut, A.; Malaniyom, K.; Natewong, S. Antioxidant and Anti-Inflammatory Effects of Piperine on UVB-Irradiated Human HaCaT Keratinocyte Cells. Life Sci. 2020, 263, 118607. [Google Scholar] [CrossRef]
- Shin, S.W.; Jung, E.; Kim, S.; Kim, J.H.; Kim, E.G.; Lee, J.; Park, D. Antagonizing Effects and Mechanisms of Afzelin against UVB-Induced Cell Damage. PLoS ONE 2013, 8, e61971. [Google Scholar] [CrossRef]
- Seo, S.H.; Jeong, G.S. Fisetin Inhibits TNF-α-Induced Inflammatory Action and Hydrogen Peroxide-Induced Oxidative Damage in Human Keratinocyte HaCaT Cells through PI3K/AKT/Nrf-2-Mediated Heme Oxygenase-1 Expression. Int. Immunopharmacol. 2015, 29, 246–253. [Google Scholar] [CrossRef]
- Park, E.K.; Lee, H.J.; Lee, H.; Kim, J.H.; Hwang, J.; Koo, J.I.; Kim, S.H. The Anti-Wrinkle Mechanism of Melatonin in UVB Treated HaCaT Keratinocytes and Hairless Mice via Inhibition of ROS and Sonic Hedgehog Mediated Inflammatory Proteins. Int. J. Mol. Sci. 2018, 19, 1995. [Google Scholar] [CrossRef]
- Kammeyer, A.; Luiten, R.M. Oxidation Events and Skin Aging. Ageing Res. Rev. 2015, 21, 16–29. [Google Scholar] [CrossRef]
- Nishigori, C.; Hattori, Y.; Toyokuni, S. Role of Reactive Oxygen Species in Skin Carcinogenesis. Antioxid. Redox Signal. 2004, 6, 561–570. [Google Scholar] [CrossRef] [PubMed]
- Lembo, S.; Balato, A.; Di Caprio, R.; Cirillo, T.; Giannini, V.; Gasparri, F.; Monfrecola, G. The Modulatory Effect of Ellagic Acid and Rosmarinic Acid on Ultraviolet-B-Induced Cytokine/Chemokine Gene Expression in Skin Keratinocyte (HaCaT) Cells. BioMed Res. Int. 2014, 2014. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.S.; Cho, E.; Weon, J.B.; Park, D.; Fréchet, M.; Chajra, H.; Jung, E. Inhibition of UVB-Induced Inflammation by Laminaria Japonica Extract via Regulation of Nc886-PKR Pathway. Nutrients 2020, 12, 1958. [Google Scholar] [CrossRef] [PubMed]
- Cho, J.-W.; Lee, K.-S.; Kim, C.-W. Curcumin Attenuates the Expression of IL-1β, IL-6, and TNF-α as Well as Cyclin E in TNF-α-Treated HaCaT Cells; NF-ΚB and MAPKs as Potential Upstream Targets. Int. J. Mol. Med. 2007, 19, 469–474. [Google Scholar] [CrossRef]
- Engel, K.; Schmidt, U.; Reuter, J.; Weckesser, S.; Simon-Haarhaus, B.; Schempp, C.M. Usnea Barbata Extract Prevents Ultraviolet-B Induced Prostaglandin E2 Synthesis and COX-2 Expression in HaCaT Keratinocytes. J. Photochem. Photobiol. B 2007, 89, 9–14. [Google Scholar] [CrossRef]
- Yang, J.-H.; Hwang, Y.H.; Gu, M.J.; Cho, W.K.; Ma, J.Y. Ethanol Extracts of Sanguisorba officinalis L. Suppress TNF-α/IFN-γ-Induced pro-Inflammatory Chemokine Production in HaCaT Cells. Phytomedicine 2015, 22, 1262–1268. [Google Scholar] [CrossRef]
- Ismail, T.; Calcabrini, C.; Diaz, A.R.; Fimognari, C.; Turrini, E.; Catanzaro, E.; Akhtar, S.; Sestili, P. Ellagitannins in Cancer Chemoprevention and Therapy. Toxins 2016, 8, 151. [Google Scholar] [CrossRef] [PubMed]
- Turkoglu, M.; Pekmezci, E.; Kilic, S.; Dundar, C.; Sevinc, H. Effect of Ficus Carica Leaf Extract on the Gene Expression of Selected Factors in HaCaT Cells. J. Cosmet. Dermatol. 2017, 16, e54–e58. [Google Scholar] [CrossRef]
- Lin, J.Y.; Tournas, J.A.; Burch, J.A.; Monteiro-Riviere, N.A.; Zielinski, J. Topical Isoflavones Provide Effective Photoprotection to Skin. Photodermatol. Photoimmunol. Photomed. 2008, 24, 61–66. [Google Scholar] [CrossRef]
- Murray, J.C.; Burch, J.A.; Streilein, R.D.; Iannacchione, M.A.; Hall, R.P.; Pinnell, S.R. A Topical Antioxidant Solution Containing Vitamins C and E Stabilized by Ferulic Acid Provides Protection for Human Skin against Damage Caused by Ultraviolet Irradiation. J. Am. Acad. Dermatol. 2008, 59, 418–425. [Google Scholar] [CrossRef]
- Kumar, A.; Agarwal, K.; Singh, M.; Saxena, A.; Yadav, P.; Maurya, A.K.; Yadav, A.; Tandon, S.; Chanda, D.; Bawankule, D.U. Essential Oil from Waste Leaves of Curcuma longa L. Alleviates Skin Inflammation. Inflammopharmacology 2018, 26, 1245–1255. [Google Scholar] [CrossRef] [PubMed]
- Ma, H.; Huang, Q.; Qu, W.; Li, L.; Wang, M.; Li, S.; Chu, F. In Vivo and in Vitro Anti-Inflammatory Effects of Sophora Flavescens Residues. J. Ethnopharmacol. 2018, 224, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Won, K.J.; Kim, D.Y.; Kim, H.B.; Kang, H.M.; Lee, S.Y.; Lee, H.M. Positive Promoting Effects of Smilax China Flower Absolute on the Wound Healing/Skin Barrier Repair-Related Responses of HaCaT Human Skin Keratinocytes. Chem. Biodivers. 2021, 18, e2001051. [Google Scholar] [CrossRef] [PubMed]
- Muniandy, K.; Gothai, S.; Tan, W.S.; Suresh Kumar, S.; Mohd Esa, N.; Chandramohan, G.; Al-Numair, K.S.; Arulselvan, P. In Vitro Wound Healing Potential of Stem Extract of Alternanthera Sessilis. Evid.-Based Complement. Altern. Med. 2018, 2018, 3142073. [Google Scholar] [CrossRef]
- Nicolas-Espinosa, J.; Yepes-Molina, L.; Carvajal, M. Bioactive Peptides from Broccoli Stems Strongly Enhance Regenerative Keratinocytes by Stimulating Controlled Proliferation. Pharm. Biol. 2022, 60, 235–246. [Google Scholar] [CrossRef]
- Yazarlu, O.; Iranshahi, M.; Kashani, H.R.K.; Reshadat, S.; Habtemariam, S.; Iranshahy, M.; Hasanpour, M. Perspective on the Application of Medicinal Plants and Natural Products in Wound Healing: A Mechanistic Review. Pharmacol. Res. 2021, 174, 105841. [Google Scholar] [CrossRef]
Target Gene | GenBank® Accession Number | Primer Pairs (5′-Forward-3′/5′-Reverse-3′) | Fragment Size (bp) |
---|---|---|---|
GAPDH | NM_002046 | TGAGCATCTACGGTTTGCTG/TGCTTGTCTGGAACAACTGC | 202 |
IL-1β | NM_000576 | GCAACCGCTTCCCTATTTAT/TGCTTGTCTGGAACAACTGC | 90 |
IL-6 | NM_000600 | ACCTTCCAAAGATGGCTGAA/TGGCTTGTTCCTCACTACTC | 146 |
IL-8 | BC013615 | GTTAAATCTGGCAACCCTAG/GGTAAGATGGTGGCTAATAC | 111 |
TNF-α | NM_000594 | CAGGGACCTCTCTCTAATCA/TGCTACAACATGGGCTACAG | 89 |
COX-2 | M90100 | TTGACAGTCCACCAACTTAC/GAGGAAGGGCTCTAGTATAA | 88 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Borja-Martínez, M.; Pedreño, M.A.; Sabater-Jara, A.B. Broccoli Byproduct Extracts Attenuate the Expression of UVB-Induced Proinflammatory Cytokines in HaCaT Keratinocytes. Antioxidants 2024, 13, 1479. https://doi.org/10.3390/antiox13121479
Borja-Martínez M, Pedreño MA, Sabater-Jara AB. Broccoli Byproduct Extracts Attenuate the Expression of UVB-Induced Proinflammatory Cytokines in HaCaT Keratinocytes. Antioxidants. 2024; 13(12):1479. https://doi.org/10.3390/antiox13121479
Chicago/Turabian StyleBorja-Martínez, María, María A. Pedreño, and Ana Belén Sabater-Jara. 2024. "Broccoli Byproduct Extracts Attenuate the Expression of UVB-Induced Proinflammatory Cytokines in HaCaT Keratinocytes" Antioxidants 13, no. 12: 1479. https://doi.org/10.3390/antiox13121479
APA StyleBorja-Martínez, M., Pedreño, M. A., & Sabater-Jara, A. B. (2024). Broccoli Byproduct Extracts Attenuate the Expression of UVB-Induced Proinflammatory Cytokines in HaCaT Keratinocytes. Antioxidants, 13(12), 1479. https://doi.org/10.3390/antiox13121479