The Effect of the Root Bark of Lycium chinense (Lycii Radicis Cortex) on Experimental Periodontitis and Alveolar Bone Loss in Sprague-Dawley Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of LRC
2.2. Methods for In Vitro Experiments
2.2.1. Cell Culture
2.2.2. Measurement of Nitric Oxide (NO) Production
2.2.3. Measurement of Prostaglandin E2 (PGE2) Production
2.2.4. RNA Isolation and RT-qPCR
2.2.5. Immunoblot Analysis
2.2.6. Measurement of Radical Scavenging Activity
2.3. Methods for In Vivo Experiments
2.3.1. Preparation of Test Materials
2.3.2. Animal Husbandry and Grouping
2.3.3. Induction of EPD and Administration of Test Materials
2.3.4. Measurements of Alveolar Bone Loss Scores
2.3.5. Microbiological Analysis
2.3.6. Measurement of Myeloperoxidase (MPO) Activity
2.3.7. Measurement of PGE2, MMP-8, TNF-α, and IL-1β
2.3.8. RT-qPCR Analysis for RANKL and Osteoprotegerin (OPG) mRNA Expressions
2.3.9. Measurement of Lipid Peroxidation
2.3.10. Measurement of Inducible iNOS Activity
2.3.11. Histopathological Analysis
2.4. Statistical Analysis
3. Results
3.1. Anti-Inflammatory Effect of LRC on the LPS-Stimulated RAW 264.7 Cells
3.1.1. LRC Decreased the Expression of Proinflammatory Mediators
3.1.2. LRC Inhibited the Activation of Mitogen-Activated Protein Kinases (MAPKs) and Nuclear Factor-κB (NF-κB) Signaling Pathways
3.2. The Effect of LRC on the EPD Ligation Rats
3.2.1. Experiment Procedure and Body Weight Gains
3.2.2. LRC Ameliorated Alveolar Bone Loss Scores
3.2.3. LRC Decreased Gingival Anaerobic Bacterial Count and MPO Activity
3.2.4. LRC Decreased the Gingival Expression of Proinflammatory Mediators
3.2.5. LRC Decreased MDA Levels and iNOS Activity
3.2.6. LRC Decreased MMP-8 Levels in Gingival Tissue
3.2.7. LRC Decreased RANKL/OPG Ratio
3.2.8. Histopathological Changes of Maxillary Regions
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Meyle, J.; Chapple, I. Molecular aspects of the pathogenesis of periodontitis. Periodontology 2000 2015, 69, 7–17. [Google Scholar] [CrossRef] [PubMed]
- Janakiram, C.; Dye, B.A. A public health approach for prevention of periodontal disease. Periodontology 2000 2020, 84, 202–214. [Google Scholar] [CrossRef] [PubMed]
- Durham, J.; Fraser, H.M.; McCracken, G.I.; Stone, K.M.; John, M.T.; Preshaw, P.M. Impact of periodontitis on oral health-related quality of life. J. Dent. 2013, 41, 370–376. [Google Scholar] [CrossRef] [PubMed]
- Buchwald, S.; Kocher, T.; Biffar, R.; Harb, A.; Holtfreter, B.; Meisel, P. Tooth loss and periodontitis by socio-economic status and inflammation in a longitudinal population-based study. J. Clin. Periodontol. 2013, 40, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Preshaw, P.M.; Bissett, S.M. Periodontitis and diabetes. Br. Dent. J. 2019, 227, 577–584. [Google Scholar] [CrossRef] [PubMed]
- Sanz, M.; Marco Del Castillo, A.; Jepsen, S.; Gonzalez-Juanatey, J.R.; D’Aiuto, F.; Bouchard, P.; Chapple, I.; Dietrich, T.; Gotsman, I.; Graziani, F.; et al. Periodontitis and cardiovascular diseases: Consensus report. J. Clin. Periodontol. 2020, 47, 268–288. [Google Scholar] [CrossRef]
- Eid Abdelmagyd, H.A.; Ram Shetty, D.S.; Musa Musleh Al-Ahmari, D.M. Herbal medicine as adjunct in periodontal therapies- A review of clinical trials in past decade. J. Oral Biol. Craniofac. Res. 2019, 9, 212–217. [Google Scholar] [CrossRef]
- Lopez-Valverde, N.; Lopez-Valverde, A.; Montero, J.; Rodriguez, C.; Macedo de Sousa, B.; Aragoneses, J.M. Antioxidant, anti-inflammatory and antimicrobial activity of natural products in periodontal disease: A comprehensive review. Front. Bioeng. Biotechnol. 2023, 11, 1226907. [Google Scholar] [CrossRef]
- Hajishengallis, G. Periodontitis: From microbial immune subversion to systemic inflammation. Nat. Rev. Immunol. 2015, 15, 30–44. [Google Scholar] [CrossRef]
- Yucel-Lindberg, T.; Bage, T. Inflammatory mediators in the pathogenesis of periodontitis. Expert Rev. Mol. Med. 2013, 15, e7. [Google Scholar] [CrossRef]
- de Morais, E.F.; Pinheiro, J.C.; Leite, R.B.; Santos, P.P.A.; Barboza, C.A.G.; Freitas, R.A. Matrix metalloproteinase-8 levels in periodontal disease patients: A systematic review. J. Periodontal Res. 2018, 53, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Graves, D. Cytokines that promote periodontal tissue destruction. J. Periodontol. 2008, 79, 1585–1591. [Google Scholar] [CrossRef] [PubMed]
- Miyasaki, K.T. The neutrophil: Mechanisms of controlling periodontal bacteria. J. Periodontol. 1991, 62, 761–774. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Andrukhov, O.; Rausch-Fan, X. Oxidative Stress and Antioxidant System in Periodontitis. Front. Physiol. 2017, 8, 910. [Google Scholar] [CrossRef]
- Chapple, I.L.; Matthews, J.B. The role of reactive oxygen and antioxidant species in periodontal tissue destruction. Periodontology 2000 2007, 43, 160–232. [Google Scholar] [CrossRef]
- Sczepanik, F.S.C.; Grossi, M.L.; Casati, M.; Goldberg, M.; Glogauer, M.; Fine, N.; Tenenbaum, H.C. Periodontitis is an inflammatory disease of oxidative stress: We should treat it that way. Periodontology 2000 2020, 84, 45–68. [Google Scholar] [CrossRef]
- Jiang, T.T.; Li, J.C. Review on the systems biology research of Yin-deficiency-heat syndrome in traditional Chinese medicine. Anat. Rec. 2023, 306, 2939–2944. [Google Scholar] [CrossRef]
- Wu, Y.; Liu, M.; He, X.; Zhou, H.; Wei, J.; Li, H.; Yuan, Q.; Zuo, Y.; Zhao, L.; Xie, Y. A breakthrough in periodontitis treatment: Revealing the pharmacodynamic substances and mechanisms of Kouqiangjie formula. J. Ethnopharmacol. 2024, 323, 117738. [Google Scholar] [CrossRef]
- Jin, W.; Li, L.; Ai, H.; Jin, Z.; Zuo, Y. Efficacy and Safety of Traditional Chinese Medicine Based on the Method of “Nourishing Kidney and Clearing Heat” as Adjuvant in the Treatment of Diabetes Mellitus Patients with Periodontitis: A Systematic Review and Meta-Analysis. Evid. Based Complement. Alternat. Med. 2022, 2022, 3853303. [Google Scholar] [CrossRef]
- Zee, K.Y.; Chan, P.S.; Ho, J.C.S.; Lai, S.M.L.; Corbet, E.F.; Leung, W.K. Adjunctive use of modified Yunu-Jian in the non-surgical treatment of male smokers with chronic periodontitis: A randomized double-blind, placebo-controlled clinical trial. Chin. Med. 2016, 11, 40. [Google Scholar] [CrossRef]
- Cho, H.; Lee, D.H.; Jeong, D.H.; Jang, J.H.; Son, Y.; Lee, S.Y.; Kim, H.J. Study on Betaine and Growth Characteristics of Lycium chinense Mill. in Different Cultivation Environments in South Korea. Plants 2024, 13, 2316. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.C.; Kim, S.J.; Kim, Y.K.; Kwon, C.H.; Kim, K.H. Lycii cortex radicis extract inhibits glioma tumor growth in vitro and in vivo through downregulation of the Akt/ERK pathway. Oncol. Rep. 2012, 27, 1467–1474. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Son, R.H.; Kim, M.I.; Kim, H.M.; Guo, S.; Lee, D.H.; Lim, G.M.; Kim, S.M.; Kim, J.Y.; Kim, C.Y. Potential of Lycii Radicis Cortex as an Ameliorative Agent for Skeletal Muscle Atrophy. Pharmaceuticals 2024, 17, 462. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Olatunji, O.J.; Zhou, Y. Anti-oxidative, anti-secretory and anti-inflammatory activities of the extract from the root bark of Lycium chinense (Cortex Lycii) against gastric ulcer in mice. J. Nat. Med. 2016, 70, 610–619. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Kim, E.Y.; Lee, B.; Min, J.H.; Song, D.U.; Lim, J.M.; Eom, J.W.; Yeom, M.; Jung, H.S.; Sohn, Y. The effects of Lycii Radicis Cortex on RANKL-induced osteoclast differentiation and activation in RAW 264.7 cells. Int. J. Mol. Med. 2016, 37, 649–658. [Google Scholar] [CrossRef]
- Park, E.; Jin, H.S.; Cho, D.Y.; Kim, J.; Kim, M.C.; Choi, C.W.; Jin, Y.; Lee, J.W.; Park, J.H.; Chung, Y.S.; et al. The effect of Lycii Radicis Cortex extract on bone formation in vitro and in vivo. Molecules 2014, 19, 19594–19609. [Google Scholar] [CrossRef]
- Lee, B.; Hong, S.; Kim, M.; Kim, E.Y.; Park, H.J.; Jung, H.S.; Kim, J.H.; Sohn, Y. Lycii radicis cortex inhibits glucocorticoid-induced bone loss by downregulating Runx2 and BMP-2 expression. Int. J. Mol. Med. 2021, 48, 155. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Park, S.-I.; Kang, S.-J.; Han, C.-H.; Kim, J.-W.; Song, C.-H.; Lee, S.-N.; Ku, S.-K.; Lee, Y.-J. The Effects of Topical Application of Polycal (a 2:98 (g/g) Mixture of Polycan and Calcium Gluconate) on Experimental Periodontitis and Alveolar Bone Loss in Rats. Molecules 2016, 21, 527. [Google Scholar] [CrossRef]
- Kim, T.G.; Park, M.-R.; Ku, S.-K.; Heo, S.-M.; Kim, J.-L. Effects of Moringa oleifera L. and Eucommia ulmoides Oliver Mixed Formula on Ligation-Induced Experimental Periodontitis and Alveolar Bone Loss in Rats. J. Korean Soc. Food Sci. Nutr. 2022, 51, 765–779. [Google Scholar] [CrossRef]
- Samejima, Y.; Ebisu, S.; Okada, H. Effect of infection with Eikenella corrodens on the progression of ligature-induced periodontitis in rats. J. Periodontal Res. 1990, 25, 308–315. [Google Scholar] [CrossRef] [PubMed]
- Botelho, M.A.; Rao, V.S.; Carvalho, C.B.; Bezerra-Filho, J.G.; Fonseca, S.G.; Vale, M.L.; Montenegro, D.; Cunha, F.; Ribeiro, R.A.; Brito, G.A. Lippia sidoides and Myracrodruon urundeuva gel prevents alveolar bone resorption in experimental periodontitis in rats. J. Ethnopharmacol. 2007, 113, 471–478. [Google Scholar] [CrossRef] [PubMed]
- Bradley, P.P.; Christensen, R.D.; Rothstein, G. Cellular and extracellular myeloperoxidase in pyogenic inflammation. Blood 1982, 60, 618–622. [Google Scholar] [CrossRef] [PubMed]
- Cuzzocrea, S.; Zingarelli, B.; Hake, P.; Salzman, A.L.; Szabo, C. Antiinflammatory effects of mercaptoethylguanidine, a combined inhibitor of nitric oxide synthase and peroxynitrite scavenger, in carrageenan-induced models of inflammation. Free Radic. Biol. Med. 1998, 24, 450–459. [Google Scholar] [CrossRef] [PubMed]
- Menezes, A.M.; Rocha, F.A.; Chaves, H.V.; Carvalho, C.B.; Ribeiro, R.A.; Brito, G.A. Effect of sodium alendronate on alveolar bone resorption in experimental periodontitis in rats. J. Periodontol. 2005, 76, 1901–1909. [Google Scholar] [CrossRef]
- Zhang, G.; Ghosh, S. Toll-like receptor-mediated NF-κB activation: A phylogenetically conserved paradigm in innate immunity. J. Clin. Investig. 2001, 107, 13–19. [Google Scholar] [CrossRef]
- Yang, F.; Tang, E.; Guan, K.; Wang, C.Y. IKKβ plays an essential role in the phosphorylation of RelA/p65 on serine 536 induced by lipopolysaccharide. J. Immunol. 2003, 170, 5630–5635. [Google Scholar] [CrossRef]
- Toczewska, J.; Konopka, T.; Zalewska, A.; Maciejczyk, M. Nitrosative Stress Biomarkers in the Non-Stimulated and Stimulated Saliva, as well as Gingival Crevicular Fluid of Patients with Periodontitis: Review and Clinical Study. Antioxidants 2020, 9, 259. [Google Scholar] [CrossRef]
- Belibasakis, G.N.; Bostanci, N. The RANKL-OPG system in clinical periodontology. J. Clin. Periodontol. 2012, 39, 239–248. [Google Scholar] [CrossRef]
- Tomina, D.C.; Petrutiu, S.A.; Dinu, C.M.; Crisan, B.; Cighi, V.S.; Ratiu, I.A. Comparative Testing of Two Ligature-Induced Periodontitis Models in Rats: A Clinical, Histological and Biochemical Study. Biology 2022, 11, 634. [Google Scholar] [CrossRef]
- Ionel, A.; Lucaciu, O.; Moga, M.; Buhatel, D.; Ilea, A.; Tabaran, F.; Catoi, C.; Berce, C.; Toader, S.; Campian, R.S. Periodontal disease induced in Wistar rats— experimental study. Hum. Vet. Med. Bioflux 2015, 7, 90–95. [Google Scholar]
- Azeez, S.H.; Gaphor, S.M.; Sha, A.M.; Garib, B.T. Effect of Pistacia atlantica subsp. kurdica Gum in Experimental Periodontitis Induced in Wistar Rats by Utilization of Osteoclastogenic Bone Markers. Molecules 2020, 25, 5819. [Google Scholar] [CrossRef] [PubMed]
- Gimenez-Siurana, A.; Gomez Garcia, F.; Pagan Bernabeu, A.; Lozano-Perez, A.A.; Aznar-Cervantes, S.D.; Cenis, J.L.; Lopez-Jornet, P. Chemoprevention of Experimental Periodontitis in Diabetic Rats with Silk Fibroin Nanoparticles Loaded with Resveratrol. Antioxidants 2020, 9, 85. [Google Scholar] [CrossRef] [PubMed]
- Feres, M.; Figueiredo, L.C.; Soares, G.M.; Faveri, M. Systemic antibiotics in the treatment of periodontitis. Periodontology 2000 2015, 67, 131–186. [Google Scholar] [CrossRef] [PubMed]
- Elashiry, M.; Morandini, A.C.; Cornelius Timothius, C.J.; Ghaly, M.; Cutler, C.W. Selective Antimicrobial Therapies for Periodontitis: Win the “Battle and the War”. Int. J. Mol. Sci. 2021, 22, 6459. [Google Scholar] [CrossRef]
- Lee, D.G.; Jung, H.J.; Woo, E.R. Antimicrobial property of (+)-lyoniresinol-3α-O-β-D-glucopyranoside isolated from the root bark of Lycium chinense Miller against human pathogenic microorganisms. Arch. Pharm. Res. 2005, 28, 1031–1036. [Google Scholar] [CrossRef]
- Pfeilschifter, J.; Chenu, C.; Bird, A.; Mundy, G.R.; Roodman, G.D. Interleukin-1 and Tumor Necrosis Factor Stimulate the Formation of Human Osteoclastlike Cells In Vitro. J. Bone Miner. Res. 1989, 4, 113–118. [Google Scholar] [CrossRef]
- Lader, C.S.; Flanagan, A.M. Prostaglandin E2, interleukin 1α, and tumor necrosis factor-α increase human osteoclast formation and bone resorption in vitro. Endocrinology 1998, 139, 3157–3164. [Google Scholar] [CrossRef]
- Kraft-Neumarker, M.; Lorenz, K.; Koch, R.; Hoffmann, T.; Mantyla, P.; Sorsa, T.; Netuschil, L. Full-mouth profile of active MMP-8 in periodontitis patients. J. Periodontal Res. 2012, 47, 121–128. [Google Scholar] [CrossRef]
- Jin, Q.; Cirelli, J.A.; Park, C.H.; Sugai, J.V.; Taba, M., Jr.; Kostenuik, P.J.; Giannobile, W.V. RANKL inhibition through osteoprotegerin blocks bone loss in experimental periodontitis. J. Periodontol. 2007, 78, 1300–1308. [Google Scholar] [CrossRef]
- AlQranei, M.S.; Chellaiah, M.A. Osteoclastogenesis in periodontal diseases: Possible mediators and mechanisms. J. Oral Biosci. 2020, 62, 123–130. [Google Scholar] [CrossRef] [PubMed]
- Koide, M.; Suda, S.; Saitoh, S.; Ofuji, Y.; Suzuki, T.; Yoshie, H.; Takai, M.; Ono, Y.; Taniguchi, Y.; Hara, K. In vivo administration of IL-1β accelerates silk ligature-induced alveolar bone resorption in rats. J. Oral Pathol. Med. 1995, 24, 420–434. [Google Scholar] [CrossRef] [PubMed]
- Gaspersic, R.; Stiblar-Martincic, D.; Osredkar, J.; Skaleric, U. Influence of subcutaneous administration of recombinant TNF-α on ligature-induced periodontitis in rats. J. Periodontal Res. 2003, 38, 198–203. [Google Scholar] [CrossRef] [PubMed]
- Miyauchi, M.; Ijuhin, N.; Nikai, H.; Takata, T.; Ito, H.; Ogawa, I. Effect of exogenously applied prostaglandin E2 on alveolar bone losss—Histometric analysis. J. Periodontol. 1992, 63, 405–411. [Google Scholar] [CrossRef]
- Williams, R.C.; Jeffcoat, M.K.; Kaplan, M.L.; Goldhaber, P.; Johnson, H.G.; Wechter, W.J. Flurbiprofen: A potent inhibitor of alveolar bone resorption in beagles. Science 1985, 227, 640–642. [Google Scholar] [CrossRef]
- Assuma, R.; Oates, T.; Cochran, D.; Amar, S.; Graves, D.T. IL-1 and TNF antagonists inhibit the inflammatory response and bone loss in experimental periodontitis. J. Immunol. 1998, 160, 403–409. [Google Scholar] [CrossRef]
- Matthews, J.B.; Wright, H.J.; Roberts, A.; Cooper, P.R.; Chapple, I.L. Hyperactivity and reactivity of peripheral blood neutrophils in chronic periodontitis. Clin. Exp. Immunol. 2007, 147, 255–264. [Google Scholar] [CrossRef]
- Mohideen, K.; Chandrasekar, K.; Ramsridhar, S.; Rajkumar, C.; Ghosh, S.; Dhungel, S. Assessment of Oxidative Stress by the Estimation of Lipid Peroxidation Marker Malondialdehyde (MDA) in Patients with Chronic Periodontitis: A Systematic Review and Meta-Analysis. Int. J. Dent. 2023, 2023, 6014706. [Google Scholar] [CrossRef]
- Cherian, D.A.; Peter, T.; Narayanan, A.; Madhavan, S.S.; Achammada, S.; Vynat, G.P. Malondialdehyde as a Marker of Oxidative Stress in Periodontitis Patients. J. Pharm. Bioallied Sci. 2019, 11, S297–S300. [Google Scholar] [CrossRef]
- Kang, S.J.; Lee, E.K.; Han, C.H.; Lee, B.H.; Lee, Y.J.; Ku, S.K. Inhibitory effects of Persicariae Rhizoma aqueous extracts on experimental periodontitis and alveolar bone loss in Sprague-Dawley rats. Exp. Ther. Med. 2016, 12, 1563–1571. [Google Scholar] [CrossRef][Green Version]
- Ahn, B.Y.; Gwak, J.S.; Ryu, S.H.; Moon, G.S.; Choi, D.S.; Park, S.H.; Han, J.H. Protective effect of water extract of Lycii Cortex Radicis on lipid peroxidation of rat skin exposed to ultraviolet B radiation. Appl. Biol. Chem. 2002, 45, 218–222. [Google Scholar]
- Kim, H.G.; Oh, M.S. Protective Effect of Lycii Radicis Cortex against 6-Hydroxydopamine-Induced Dopaminergic Neuronal Cell Death. J. Food Biochem. 2015, 39, 281–288. [Google Scholar] [CrossRef]
- Li, Y.-Y.; Di, R.; Baibado, J.T.; Cheng, Y.-S.; Huang, Y.-Q.; Sun, H.; Cheung, H.-Y. Identification of kukoamines as the novel markers for quality assessment of Lycii Cortex. Food Res. Int. 2014, 55, 373–380. [Google Scholar] [CrossRef]
- Wang, L.; Wang, P.; Wang, D.; Tao, M.; Xu, W.; Olatunji, O.J. Anti-Inflammatory Activities of Kukoamine A From the Root Bark of Lycium chinense Miller. Nat. Prod. Commun. 2020, 15, 1934578X20912088. [Google Scholar] [CrossRef]
- Sun, J.; Zhang, Y.; Wang, C.; Ruan, Q. Kukoamine A protects mice against osteoarthritis by inhibiting chondrocyte inflammation and ferroptosis via SIRT1/GPX4 signaling pathway. Life Sci. 2023, 332, 122117. [Google Scholar] [CrossRef]
- Zhang, Y.; Gao, L.; Cheng, Z.; Cai, J.; Niu, Y.; Meng, W.; Zhao, Q. Kukoamine A Prevents Radiation-Induced Neuroinflammation and Preserves Hippocampal Neurogenesis in Rats by Inhibiting Activation of NF-κB and AP-1. Neurotox. Res. 2017, 31, 259–268. [Google Scholar] [CrossRef]
- Qin, W.T.; Wang, X.; Shen, W.C.; Sun, B.W. A novel role of kukoamine B: Inhibition of the inflammatory response in the livers of lipopolysaccharide-induced septic mice via its unique property of combining with lipopolysaccharide. Exp. Ther. Med. 2015, 9, 725–732. [Google Scholar] [CrossRef]
- Zhao, Q.; Li, L.; Zhu, Y.; Hou, D.; Li, Y.; Guo, X.; Wang, Y.; Olatunji, O.J.; Wan, P.; Gong, K. Kukoamine B Ameliorate Insulin Resistance, Oxidative Stress, Inflammation and Other Metabolic Abnormalities in High-Fat/High-Fructose-Fed Rats. Diabetes Metab. Syndr. Obes. 2020, 13, 1843–1853. [Google Scholar] [CrossRef]
- Wang, H.; Wang, T.; Hu, X.; Deng, C.; Jiang, J.; Qin, H.; Dong, K.; Chen, S.; Jin, C.; Zhao, Q.; et al. Fixed dosing of kukoamine B in sepsis patients: Results from population pharmacokinetic modelling and simulation. Br. J. Clin. Pharmacol. 2022, 88, 4111–4120. [Google Scholar] [CrossRef]
- Liu, X.; Zheng, X.; Wang, N.; Cao, H.; Lu, Y.; Long, Y.; Zhao, K.; Zhou, H.; Zheng, J. Kukoamine B, a novel dual inhibitor of LPS and CpG DNA, is a potential candidate for sepsis treatment. Br. J. Pharmacol. 2011, 162, 1274–1290. [Google Scholar] [CrossRef]
- Liu, X.; Zheng, X.; Long, Y.; Cao, H.; Wang, N.; Lu, Y.; Zhao, K.; Zhou, H.; Zheng, J. Dual targets guided screening and isolation of Kukoamine B as a novel natural anti-sepsis agent from traditional Chinese herb Cortex lycii. Int. Immunopharmacol. 2011, 11, 110–120. [Google Scholar] [CrossRef] [PubMed]
- Olatunji, O.J.; Chen, H.; Zhou, Y. Neuroprotective effect of trans-N-caffeoyltyramine from Lycium chinense against H2O2 induced cytotoxicity in PC12 cells by attenuating oxidative stress. Biomed. Pharmacother. 2017, 93, 895–902. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.-Y.; Hu, S.; Huang, Y.-Q.; Han, Y.; Cheung, H.-Y. Preventing H2O2-induced toxicity in primary cerebellar granule neurons via activating the PI3-K/Akt/GSK3β pathway by kukoamine from Lycii Cortex. J. Funct. Foods 2015, 17, 709–721. [Google Scholar] [CrossRef]
- Li, X.; Lin, J.; Chen, B.; Xie, H.; Chen, D. Antioxidant and Cytoprotective Effects of Kukoamines A and B: Comparison and Positional Isomeric Effect. Molecules 2018, 23, 973. [Google Scholar] [CrossRef] [PubMed]
- Park, E.; Kim, J.; Kim, M.C.; Yeo, S.; Kim, J.; Park, S.; Jo, M.; Choi, C.W.; Jin, H.S.; Lee, S.W.; et al. Anti-Osteoporotic Effects of Kukoamine B Isolated from Lycii Radicis Cortex Extract on Osteoblast and Osteoclast Cells and Ovariectomized Osteoporosis Model Mice. Int. J. Mol. Sci. 2019, 20, 2784. [Google Scholar] [CrossRef]
- Park, E.; Kim, J.; Jin, H.S.; Choi, C.W.; Choi, T.H.; Choi, S.; Huh, D.; Jeong, S.Y. Scopolin Attenuates Osteoporotic Bone Loss in Ovariectomized Mice. Nutrients 2020, 12, 3565. [Google Scholar] [CrossRef]
- Luo, L.; Guan, Z.; Jin, X.; Guan, Z.; Jiang, Y. Identification of kukoamine a as an anti-osteoporosis drug target using network pharmacology and experiment verification. Mol. Med. 2023, 29, 36. [Google Scholar] [CrossRef]










| Target Gene | Orientation | Sequence (5′–3′) | NCBI Accession No. |
|---|---|---|---|
| iNOS | Sense Antisense | GACAAGCTGCATGTGACATC, GCTGGTAGGTTCCTGTTGTT | NM_001313922.1 |
| COX-2 | Sense Antisense | TCCAGATCACATTTGATTGA, TCTTTGACTGTGGGAGGATA | NM_011198.5 |
| TNF-α | Sense Antisense | ATGAGCACAGAAAGCATGAT, TACAGGCTTGTCACTCGAAT | NM_013693.3 |
| IL-1β | Sense Antisense | ATGGCAACTGTTCCTGAACT, CAGGACAGGTATAGATTCTT | NM_008361.4 |
| MCP-1 | Sense Antisense | TGATCCCAATGAGTAGGCTGG, ATGTCTGGACCCATTCCTTCT | NM_011333.3 |
| GAPDH | Sense Antisense | AACGACCCCTTCATTGAC, TCCACGACATACTCAGCAC | NM_001411843.1 |
| RANKL | Sense Antisense | CTGATGAAAGGAGGGAGCAC, GAAGGGTTGGACACCTGAATGC | NM_057149.2 |
| OPG | Sense Antisense | TCCTGGCACCTACCTAAAACAGCA, ACACTGGGCTGCAATACACA | U94331.1 |
| β-actin | Sense Antisense | TCAGGTCATCACTATCGCCAAT, AAAGAAAGGGTGTAAAACGCA | NM_031144.3 |
| Group | In Gingival Tissues | ||
|---|---|---|---|
| Histological Scores (Max =3) | Inflammatory Cells (cells/mm2) | Collagen Fibers (%/mm2) | |
| Intact vehicle | 0.30 ± 0.48 | 58.60 ± 17.02 | 76.50 ± 10.58 |
| EPD | 2.90 ± 0.32 ** | 743.40 ± 67.48 ** | 14.16 ± 4.20 ** |
| IND (5 mg/kg) | 1.50 ± 0.53 ## | 257.40 ± 94.73 ## | 51.20 ± 10.11 ## |
| INP (63 mg/kg) | 2.10 ± 0.57 # | 532.80 ± 100.41 ## | 31.48 ± 7.46 ## |
| LRC (50 mg/kg) | 2.00 ± 0.67 ## | 524.90 ± 101.41 ## | 31.54 ± 10.01 ## |
| LRC (100 mg/kg) | 1.70 ± 0.48 ## | 387.80 ± 110.89 ## | 41.86 ± 12.35 ## |
| LRC (200 mg/kg) | 1.40 ± 0.52 ## | 242.20 ± 84.66 ## | 52.16 ± 10.29 ## |
| Group | In Alveolar Bone Regions | ||
|---|---|---|---|
| Alveolar Bone Volume (%) | Osteoclast Cell (cells/mm2) | OC/BS (%) | |
| Intact vehicle | 78.59 ± 6.50 | 7.80 ± 2.57 | 3.89 ± 1.47 |
| EPD | 20.65 ± 6.22 ** | 51.40 ± 7.72 ** | 68.42 ± 6.45 ** |
| IND (5 mg/kg) | 53.30 ± 6.41 ## | 26.00 ± 5.89 ## | 29.20 ± 8.95 ## |
| INP (63 mg/kg) | 36.80 ± 4.61 ## | 37.40 ± 2.84 ## | 47.56 ± 6.20 ## |
| LRC (50 mg/kg) | 36.76 ± 7.69 ## | 37.20 ± 3.55 ## | 47.45 ± 7.31 ## |
| LRC (100 mg/kg) | 41.78 ± 6.92 ## | 31.60 ± 5.48 ## | 36.05 ± 6.83 ## |
| LRC (200 mg/kg) | 53.89 ± 12.74 ## | 25.80 ± 3.82 ## | 29.10 ± 11.92 ## |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Song, H.; Lee, J.; Chung, H.; Kwon, Y.-S.; Jegal, K.-H.; Kim, J.-K.; Ku, S.-K. The Effect of the Root Bark of Lycium chinense (Lycii Radicis Cortex) on Experimental Periodontitis and Alveolar Bone Loss in Sprague-Dawley Rats. Antioxidants 2024, 13, 1332. https://doi.org/10.3390/antiox13111332
Yang J, Song H, Lee J, Chung H, Kwon Y-S, Jegal K-H, Kim J-K, Ku S-K. The Effect of the Root Bark of Lycium chinense (Lycii Radicis Cortex) on Experimental Periodontitis and Alveolar Bone Loss in Sprague-Dawley Rats. Antioxidants. 2024; 13(11):1332. https://doi.org/10.3390/antiox13111332
Chicago/Turabian StyleYang, Jinwon, Hyosun Song, Jeongjun Lee, Hunsuk Chung, Young-Sam Kwon, Kyung-Hwan Jegal, Jae-Kwang Kim, and Sae-Kwang Ku. 2024. "The Effect of the Root Bark of Lycium chinense (Lycii Radicis Cortex) on Experimental Periodontitis and Alveolar Bone Loss in Sprague-Dawley Rats" Antioxidants 13, no. 11: 1332. https://doi.org/10.3390/antiox13111332
APA StyleYang, J., Song, H., Lee, J., Chung, H., Kwon, Y.-S., Jegal, K.-H., Kim, J.-K., & Ku, S.-K. (2024). The Effect of the Root Bark of Lycium chinense (Lycii Radicis Cortex) on Experimental Periodontitis and Alveolar Bone Loss in Sprague-Dawley Rats. Antioxidants, 13(11), 1332. https://doi.org/10.3390/antiox13111332

