Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut–Kidney Axis
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Analysis of NO Pathway by HPLC
2.3. Analysis of Plasma SCFA Levels by GC-MS
2.4. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
2.5. Analysis of Gut Microbiota
2.6. Statistical Analysis
3. Results
3.1. Blood Pressure and Renal Function
3.2. NO-Related Parameters
3.3. Plasma SCFA Levels and Renal SCFA Receptors
3.4. Aryl Hydrocarbon Receptor Signaling
3.5. Gut Microbiota Compositions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Luyckx, V.A.; Tonelli, M.; Stanifer, J.W. The global burden of kidney disease and the sustainable development goals. Bull. World Health Organ. 2018, 96, 414–422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Hsu, C.N. Developmental Origins of Chronic Kidney Disease: Should We Focus on Early Life? Int. J. Mol. Sci. 2017, 18, 381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, C.J.; Moxey-Mims, M.; Jerry-Fluker, J.; Warady, B.A.; Furth, S.L. CKiD (CKD in children) prospective cohort study: A review of current findings. Am. J. Kidney Dis. 2012, 60, 1002–1011. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flynn, J.T.; Mitsnefes, M.; Pierce, C.; Cole, S.R.; Parekh, R.S.; Furth, S.L.; Warady, B.A. Chronic Kidney Disease in Children Study Group: Blood pressure in children with chronic kidney disease: A report from the Chronic Kidney Disease in Children study. Hypertension 2008, 52, 631–637. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Lu, P.C.; Lo, M.H.; Lin, I.C.; Tain, Y.L. The association between nitric oxide pathway, blood pressure abnormalities, and cardiovascular risk profile in pediatric chronic kidney disease. Int. J. Mol. Sci. 2019, 20, 5301. [Google Scholar] [CrossRef] [Scilit]
- Claramunt, D.; Gil-Peña, H.; Fuente, R.; Hernández-Frías, O.; Santos, F. Animal models of pediatric chronic kidney disease. Is adenine intake an appropriate model? Nefrologia 2015, 35, 517–522. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Adenine-Induced Chronic Kidney Disease Programs Hypertension in Adult Male Rat Offspring: Implications of Nitric Oxide and Gut Microbiome Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Tain, Y.L. Developmental Origins of Kidney Disease: Why Oxidative Stress Matters? Antioxidants 2020, 10, 33. [Google Scholar] [CrossRef] [Scilit]
- Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. The gut microbiota and the brain-gut-kidney axis in hypertension and chronic kidney disease. Nat. Rev. Nephrol. 2018, 14, 442–456. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hou, C.Y.; Hsu, W.H.; Tain, Y.L. Cardiovascular Diseases of Developmental Origins: Preventive Aspects of Gut Microbiota-Targeted Therapy. Nutrients 2021, 13, 2290. [Google Scholar] [CrossRef] [Scilit]
- Jeandet, P.; Vannozzi, A.; Sobarzo-Sánchez, E.; Uddin, M.S.; Bru, R.; Martínez-Márquez, A.; Clément, C.; Cordelier, S.; Manayi, A.; Nabavi, S.F.; et al. Phytostilbenes as agrochemicals: Biosynthesis, bioactivity, metabolic engineering and biotechnology. Nat. Prod. Rep. 2021, 38, 1282–1329. [Google Scholar] [CrossRef] [Scilit]
- Fraga, C.G.; Croft, K.D.; Kennedy, D.O.; Tomás-Barberán, F.A. The effects of polyphenols and other bioactives on human health. Food Funct. 2019, 10, 514–528. [Google Scholar] [CrossRef] [Scilit]
- Petrovski, G.; Gurusamy, N.; Das, D.K. Resveratrol in cardiovascular health and disease. Ann. N. Y. Acad. Sci. 2011, 1215, 22–33. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hou, C.Y.; Tain, Y.L. Preventive aspects of early resveratrol supplementation in cardiovascular and kidney disease of developmental origins. Int. J. Mol. Sci. 2021, 22, 4210. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Yang, H.W.; Tain, Y.L. Perinatal Resveratrol Therapy Prevents Hypertension Programmed by Maternal Chronic Kidney Disease in Adult Male Offspring: Implications of the Gut Microbiome and Their Metabolites. Biomedicines 2020, 8, 567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walle, T.; Hsieh, F.; DeLegge, M.H.; Oatis, J.E., Jr.; Walle, U.K. High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab. Dispos. 2004, 32, 1377–1382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Chang, S.K.C.; Liao, J.X.; Chen, Y.W.; Huang, H.T.; Li, Y.L.; Hou, C.Y. Synthesis of Short-Chain-Fatty-Acid Resveratrol Esters and Their Antioxidant Properties. Antioxidants 2021, 10, 420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weldegiorgis, M.; Woodward, M. The impact of hypertension on chronic kidney disease and end-stage renal disease is greater in men than women: A systematic review and meta-analysis. BMC Nephrol. 2020, 21, 506. [Google Scholar]
- Tain, Y.L.; Lee, W.C.; Wu, K.L.H.; Leu, S.; Chan, J.Y.H. Resveratrol Prevents the Development of Hypertension Programmed by Maternal Plus Post-Weaning High- Fructose Consumption through Modulation of Oxidative Stress, Nutrient-Sensing Signals, and Gut Microbiota. Mol. Nutr. Food Res. 2018, 62, e1800066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Chan, J.Y.H.; Wu, K.L.H.; Yu, H.R.; Lee, W.C.; Hou, C.Y.; Tain, Y.L. Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure. Int. J. Mol. Sci. 2021, 22, 2674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Jheng, L.C.; Chang, S.K.C.; Chen, Y.W.; Huang, L.T.; Liao, J.X.; Hou, C.Y. Synthesis and Characterization of Novel Resveratrol Butyrate Esters That Have the Ability to Prevent Fat Accumulation in a Liver Cell Culture Model. Molecules 2020, 25, 4199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, J.X.; Chen, Y.W.; Shih, M.K.; Tain, Y.L.; Yeh, Y.T.; Chiu, M.H.; Chang, S.K.C.; Hou, C.Y. Resveratrol Butyrate Esters Inhibit BPA-Induced Liver Damage in Male Offspring Rats by Modulating Antioxidant Capacity and Gut Microbiota. Int. J. Mol. Sci. 2021, 22, 5273. [Google Scholar] [CrossRef] [Scilit]
- Shih, M.K.; Tain, Y.L.; Cheng, C.M.; Hsu, C.N.; Chen, Y.W.; Huang, H.T.; Chang, C.I.; Hou, C.Y. Separation and Identification of Resveratrol Butyrate Ester Complexes and Their Bioactivity in HepG2 Cell Models. Int. J. Mol. Sci. 2021, 22, 13539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gambini, J.; Inglés, M.; Olaso, G.; Lopez-Grueso, R.; Bonet-Costa, V.; Gimeno-Mallench, L.; Mas-Bargues, C.; Abdelaziz, K.M.; Gomez-Cabrera, M.C.; Vina, J.; et al. Properties of resveratrol: In vitro and in vivo studies about metabolism, bioavailability, and biological effects in animal models and humans. Oxid. Med. Cell Longev. 2015, 2015, 837042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menet, M.C.; Baron, S.; Taghi, M.; Diestra, R.; Dargère, D.; Laprévote, O.; Nivet-Antoine, V.; Beaudeux, J.L.; Bédarida, T.; Cottart, C.H. Distribution of trans-resveratrol and its metabolites after acute or sustained administration in mouse heart, brain, and liver. Mol. Nutr. Food Res. 2017, 61, 1600686. [Google Scholar] [CrossRef] [Scilit]
- Pluznick, J.L. Microbial short-chain fatty acids and blood pressure regulation. Curr. Hypertens. Rep. 2017, 19, 25. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Lin, Y.J.; Lu, P.C.; Tain, Y.L. Maternal Resveratrol Therapy Protects Male Rat Offspring against Programmed Hypertension Induced by TCDD and Dexamethasone Exposures: Is It Relevant to Aryl Hydrocarbon Receptor? Int. J. Mol. Sci. 2018, 19, 2459. [Google Scholar] [CrossRef] [Scilit]
- Bird, J.K.; Raederstorff, D.; Weber, P.; Steinert, R.E. Cardiovascular and Antiobesity Effects of Resveratrol Mediated through the Gut Microbiota. Adv. Nutr. 2017, 8, 839–849. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Arango, L.F.; Barrett, H.L.; McIntyre, H.D.; Callaway, L.K.; Morrison, M.; Dekker Nitert, M.; SPRING Trial Group. Increased Systolic and Diastolic Blood Pressure Is Associated with Altered Gut Microbiota Composition and Butyrate Production in Early Pregnancy. Hypertension 2016, 68, 974–981. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.M.; Yang, M.X.; Wu, Q.F.; Chen, J.; Deng, S.F.; Chen, L.; Wei, D.N.; Liang, F.R. Improvement of intestinal flora: Accompany with the antihypertensive effect of electroacupuncture on stage 1 hypertension. Chin. Med. 2021, 16, 7. [Google Scholar] [CrossRef] [Scilit]
- Cai, T.T.; Ye, X.L.; Li, R.R.; Chen, H.; Wang, Y.Y.; Yong, H.J.; Pan, M.L.; Lu, W.; Tang, Y.; Miao, H.; et al. Resveratrol Modulates the Gut Microbiota and Inflammation to Protect Against Diabetic Nephropathy in Mice. Front. Pharmacol. 2020, 11, 1249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cani, P.D.; de Vos, W.M. Next-Generation Beneficial Microbes: The Case of Akkermansia muciniphila. Front. Microbiol. 2017, 8, 1765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Mao, B.; Gu, J.; Wu, J.; Cui, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Blautia—A new functional genus with potential probiotic properties? Gut Microbes 2021, 13, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Hanchi, H.; Mottawea, W.; Sebei, K.; Hammami, R. The Genus Enterococcus between Probiotic Potential and Safety Concerns-An Update. Front. Microbiol. 2018, 9, 1791. [Google Scholar] [CrossRef] [Scilit]
- Thandapilly, S.J.; Louis, X.L.; Behbahani, J.; Movahed, A.; Yu, L.; Fandrich, R.; Zhang, S.; Kardami, E.; Anderson, H.D.; Netticadan, T. Reduced hemodynamic load aids low-dose resveratrol in reversing cardiovascular defects in hypertensive rats. Hypertens. Res. 2013, 36, 866–872. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Hung, C.H.; Hou, C.Y.; Chang, C.I.; Tain, Y.L. Perinatal Resveratrol Therapy to Dioxin-Exposed Dams Prevents the Programming of Hypertension in Adult Rat Offspring. Antioxidants 2021, 10, 1393. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Forward | Reverse |
|---|---|---|
| GPR41 | 5 tcttcaccaccgtctatctcac 3 | 5 cacaagtcctgccaccctc 3 |
| GPR43 | 5 ctgcctgggatcgtctgtg 3 | 5 cataccctcggccttctgg 3 |
| GPR109A | 5 cggtggtctactatttctcc 3 | 5 cccctggaatacttctgatt 3 |
| Olfr78 | 5 gaggaagctcacttttggtttgg 3 | 5 cagcttcaatgtccttgtcacag 3 |
| AhR | 5 gtcctcagcaggaacgaaag 3 | 5 ccagggaagtccaactgtgt 3 |
| AHRR | 5 cagcaacatggcttctttca 3 | 5 tgaagcactgcattccagac 3 |
| CYP1A1 | 5 gcactctggacaaacacctg 3 | 5 atatccaccttctcgcctgg 3 |
| ARNT | 5 gtctccctcccagatgatga 3 | 5 gctggtagccaacagtagcc 3 |
| TIPARP | 5 gttgagggccaattaccaga 3 | 5 gctcctggcacataatccat 3 |
| R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
| Groups | CN | CKD | CKREV | CKRBEL | CKRBEH |
|---|---|---|---|---|---|
| Mortality | 0% | 0% | 0% | 0% | 0% |
| Body weight (BW) (g) | 429 ± 21 | 430 ± 32 | 413 ± 28 | 426 ± 25 | 413 ± 37 |
| Left kidney weight (g) | 1.88 ± 0.14 | 3.18 ± 0.5 * | 3.02 ± 0.35 * | 2.99 ± 0.53 * | 2.94 ± 0.43 * |
| Left kidney weight/100 g BW | 0.44 ± 0.03 | 0.74 ± 0.07 * | 0.73 ± 0.11 * | 0.70 ± 0.11 * | 0.71 ± 0.10 * |
| Systolic BP (mmHg) | 134 ± 3 | 150 ± 4 * | 138 ± 3 # | 141 ± 3 # | 141 ± 5 # |
| Diastolic BP (mmHg) | 92 ± 7 | 102 ± 5 * | 92 ± 5 # | 89 ± 11 # | 92 ± 7 # |
| Mean arterial pressure (mmHg) | 106 ± 5 | 118 ± 4 * | 108 ± 3 # | 107 ± 8 # | 108 ± 5 # |
| Creatinine (μM) | 31.6 ± 4.1 | 51.3 ± 6.4 * | 35.5 ± 1.6 # | 33.2 ± 2.1 # | 33.5 ± 3.0 # |
| Creatinine clearance rate (mL/min) | 2.4 ± 0.3 | 1.4 ± 0.1 * | 2.3 ± 0.3 # | 2.1 ± 0.2 # | 2.1 ± 0.3 # |
| Groups | CN | CKD | CKREV | CKRBEL | CKRBEH |
|---|---|---|---|---|---|
| l-citrulline (μM) | 106.5 ± 9.6 | 120.7 ± 7.6 | 77.3 ± 7.1 *# | 79.2 ± 4.5 *# | 80.3 ± 6.5 *# |
| l-arginine (μM) | 407.2 ± 33.9 | 256.4 ± 13.2 * | 234.2 ± 13.9 * | 243.5 ± 12.4 * | 229.3 ± 21 * |
| Asymmetric dimethylarginine (μM) | 1.88 ± 0.30 | 2.61 ± 0.26 | 2.41 ± 0.14 | 2.46 ± 0.26 | 1.91 ± 0.27 |
| Symmetric dimethylarginine (μM) | 1.38 ± 0.14 | 1.37 ± 0.08 | 1.38 ± 0.15 | 1.53 ± 0.08 | 1.33 ± 0.11 |
| l-arginine-to-ADMA ratio (μM/μM) | 252 ± 39 | 108 ± 16 * | 103 ± 14 * | 112 ± 17 * | 139 ± 27 * |
| Groups | CN | CKD | CKREV | CKRBEL | CKRBEH |
|---|---|---|---|---|---|
| Acetic acid (μM) | 525 ± 61 | 547 ± 55 | 391 ± 38 # | 371 ± 31 *# | 412 ± 42 |
| Propionic acid (μM) | 2.74 ± 0.62 | 1.38 ± 0.33 | 0.92 ± 0.1 * | 0.94 ± 0.19 * | 1.38 ± 0.59 |
| Isobutyric acid (μM) | 2.5 ± 0.25 | 2.65 ± 0.54 | 2.19 ± 0.13 | 2.05 ± 0.19 | 2.33 ± 0.15 |
| Butyric acid (μM) | 3.55 ± 0.35 | 2.85 ± 0.32 | 1.98 ± 0.15 *# | 2.53 ± 0.26 * | 3 ± 0.44 |
| Isovaleric acid (μM) | 3.15 ± 0.76 | 2.56 ± 0.49 | 1.94 ± 0.63 | 1.74 ± 0.58 | 1.88 ± 0.46 |
| Valeric acid (μM) | 3.83 ± 0.86 | 4.96 ± 0.94 | 4.28 ± 0.54 | 4.12 ± 0.45 | 3.92 ± 0.58 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, C.-N.; Hou, C.-Y.; Chang, C.-I.; Tain, Y.-L. Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut–Kidney Axis. Antioxidants 2022, 11, 83. https://doi.org/10.3390/antiox11010083
Hsu C-N, Hou C-Y, Chang C-I, Tain Y-L. Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut–Kidney Axis. Antioxidants. 2022; 11(1):83. https://doi.org/10.3390/antiox11010083
Chicago/Turabian StyleHsu, Chien-Ning, Chih-Yao Hou, Chi-I Chang, and You-Lin Tain. 2022. "Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut–Kidney Axis" Antioxidants 11, no. 1: 83. https://doi.org/10.3390/antiox11010083
APA StyleHsu, C.-N., Hou, C.-Y., Chang, C.-I., & Tain, Y.-L. (2022). Resveratrol Butyrate Ester Protects Adenine-Treated Rats against Hypertension and Kidney Disease by Regulating the Gut–Kidney Axis. Antioxidants, 11(1), 83. https://doi.org/10.3390/antiox11010083

