Next Article in Journal
Training a Minesweeper Agent Using a Convolutional Neural Network
Previous Article in Journal
Evaluation of the Performance of Static Mixers in 3D Printed Millireactors Using Integrated pH-Sensitive Films
Previous Article in Special Issue
Cytotoxicity and Antioxidant Defences in Euplotes aediculatus Exposed to Single and Binary Mixtures of Heavy Metals and Nanoparticles
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure

1
Fisheries Science Institute, Chonnam National University, Yeosu 59626, Republic of Korea
2
Department of Ocean Integrated Science, Chonnam National University, Yeosu 59626, Republic of Korea
*
Author to whom correspondence should be addressed.
Appl. Sci. 2025, 15(5), 2489; https://doi.org/10.3390/app15052489
Submission received: 22 January 2025 / Revised: 19 February 2025 / Accepted: 22 February 2025 / Published: 25 February 2025

Abstract

Antifouling paints are essentially used to prevent biological fouling of marine vessels and structures, but their release into the environment has resulted in various marine ecosystem problems. Irgarol, a representative antifouling paint substance, is well known for its direct effects on plankton productivity, but studies on its harmful effects on estuarine organisms are limited. This study aimed to determine the impact of irgarol exposure at the transcriptional level in Macrophthalmus japonicus, a highly dominant crab species in estuaries. To this end, we characterized the M. japonicus arginine kinase (AK) gene, which plays a role in energy metabolism in invertebrates, and examined its expression levels in response to irgarol exposure. Consequently, AK was identified as a highly prevalent enzyme in invertebrate species, including crustaceans and insects. Following irgarol exposure, the gills of M. japonicus exhibited relatively elevated AK gene expression compared to the control group at 4 and 7 days of exposure. In addition, elevated AK gene expression was observed in the hepatopancreas. Notably, the relatively low irgarol exposure concentrations of 1 and 10 μg L−1 demonstrated comparatively higher AK gene expression in the hepatopancreas than the relatively high irgarol concentration of 30 μg L−1. The results of this study imply that irgarol exposure may disrupt the equilibrium of energy metabolic processes regulated by AK gene expression in the M. japonicus crab. Moreover, the sustained environmental accumulation of irgarol indicates that it may serve as a significant disturbance factor within estuarine ecosystems.

1. Introduction

The formation and adhesion of microbial films on marine vessels and equipment surfaces by various aquatic organisms is known as biofouling, which imposes economic and environmental costs on various industrial activities, such as ship operations and offshore structures [1]. Subsequently, using antifouling paints represents a significant strategy for protecting marine structures from biological fouling. Previously, tributyltin (TBT) was a prevalent agent, but it was globally prohibited in 2008 due to concerns regarding its significant adverse impacts on marine organisms [2]. Therefore, copper compounds and irgarol-based alternatives have become predominant in antifouling paints [1]. However, the release of biocides from antifouling paints into the marine environment has been observed to result in the induction of harmful damage to a diverse range of non-target species. Irgarol is an organic compound in the triazine family that can form metabolites upon release in water, which may contribute to its long-term antifouling effect [3,4]. Irgarol is considered a photosystem II inhibitor, which inhibits photosynthesis and blocks the conversion of photosystem II-derived energy into chemical energy [5]. Based on this evidence, it can be posited that the biological toxicity of irgarol is manifested through direct toxic effects on primary producers, such as algae. An investigation conducted by Kaamoush et al. [6] observed that marine algae, including Chlorella salina, exhibited toxicological effects upon exposure to irgarol, manifesting as a reduction in growth and essential metabolite content. Irgarol has also been observed to inhibit the growth and photosynthesis of marine algae, including cyanobacteria, diatoms, and macroalgae, with concentration-dependent damage observed even at low exposures [7]. Moreover, irgarol has been detected in concentrations in various environments in the ocean, with a particularly wide distribution in estuarine ecosystems [8,9]. Therefore, it is important to monitor the health of organisms living in estuarine environments; however, while previous studies have predominantly focused on assessing the toxicity of irgarol in algae or fish, research targeting crustaceans and other estuarine benthic organisms remains limited [10].
Macrophthalmus japonicus, a tidal flat-dwelling benthic marine organism, is widely distributed in the Indo–Pacific region and exhibits a wide range of life history characteristics depending on environmental conditions [10]. M. japonicus has high economic value in estuarine fisheries and contributes to biodiversity conservation as a key tidal mudflat food chain member. The feeding activity of M. japonicus is found to be significantly correlated with the availability of oxygen and the levels of organic carbon and nitrogen present in estuarine sediments [11]. In addition, the production and biomass of M. japonicus are directly affected by the biomass of the microphytobenthos it consumes as a food source [12]. Given its high dominance and extensive distribution in tidal flats, this species has been employed as an indicator for environmental monitoring. Moreover, it has been demonstrated in Korea that alterations to the chitinase gene can contribute to the concentration of heavy metals and the abundance of crustaceans in estuarine sediments [13]. Furthermore, alterations in several M. japonicus physiological marker genes were noted in response to varying salinity gradients [14]. Pollutants from a variety of sources released into rivers are transported into estuarine environments with flow and readily accumulate due to the physical properties of sediment particles [15,16]. Thus, the ongoing increase in pollutant sources has increased the importance of monitoring estuarine biological health.
Arginine kinase (AK) plays a significant role in energy metabolism in many marine organisms, including crustaceans, mollusks, and echinoderms [17,18]. The AK enzyme functions as a catalyst for the reversible phosphorylation of arginine, enabling the efficient storage and utilization of energy during elevated metabolic demand, such as muscle contraction or exercise [19,20]. AK plays an important role in energy metabolism in various marine organisms, including crustaceans, mollusks, and echinoderms [21]. The enzyme catalyzes the reversible phosphorylation of arginine, allowing for efficient storage and utilization of energy during times of high metabolic demand, such as muscle contraction or exercise. In marine organisms, AK is crucial in maintaining energy homeostasis in muscle tissue [14,22]. It is also well-established that AK contributes to the buffering of ATP fluctuations and the prevention of lactic acid accumulation, particularly during periods of intense activity [18]. This is closely related to the physical activity of marine organisms, including reproductive behaviors, feeding, migration, and other activities. While physiological studies of the AK gene have been widely reported, its association with antioxidant enzymes and stress-related metabolic pathways has not been fully explored. In previous studies, xenobiotic pollution stresses such as tributyltin (TBT), ammonia, and acidification have been reported to induce significant changes at the level of energy metabolism, including decreased oxygen consumption rates, increased ATP levels, and enhanced tricarboxylic acid (TCA) cycle activity [23,24,25]. However, the expression of genes related to energy metabolism in response to these stresses has been reported only to a limited extent. In this study, we analyzed irgarol-induced changes in AK gene expression in M. japonicus to determine the molecular response mechanisms of the crustacean. We also compared tissue-specific responses between gills and the liver to assess the toxicological effects of irgarol at the tissue level. These findings suggest the potential of the AK gene as a molecular marker for assessing xenobiotic pollution in estuarine ecosystems.

2. Materials and Methods

2.1. Test Organisms and Exposure Experiment Conditions

M. japonicus measuring 2.7 cm (±0.1 cm) in size and 7.4 g (±0.9 g) in weight were collected from a fisherman who lives in Suncheon Bay, Korea. The collected M. japonicus were selected as healthy individuals with no appendages missing, and 30 individuals each were placed in the control and exposure tanks. Exposure was performed in three replicates to reduce experimental error. All M. japonicus were exposed after a 24-hour acclimatization period to account for individual adaptation to environmental changes. The conditions of acclimatization were 22 ± 1 °C (room temperature), 30.6 ± 1‰ salinity, 17:7 photoperiod (light:dark), and an oxygenator was installed to provide oxygen to the organisms. Individuals were fed Tetramin (Tetra-Werke, Melle, Germany) at 0.95 g (±0.5 g) every 24 h.
Exposure solutions were prepared with irgarol (Sigma Aldrich, St. Louis, MO, USA). The stock solution was prepared with a 10 mg L−1 irgarol concentration by dissolving the substance in 99 percent analytical-grade acetone. The 1, 10, and 30 μg L−1 concentrations of solutions for exposure were prepared to dilute in artificial seawater with a stock solution. Five groups of crabs (corresponding to 1, 10, and 30 μg L−1 solutions, seawater, and solvent controls; n = 225) were divided. Subsequently, these groups were divided into four groups, exposed to three concentrations of irgarol with control, and used for tissue sampling to analyze gene expression at various time intervals. The experiments were conducted in triplicate. The irgarol concentrations were 1, 10, and 30 μg L−1, considered within the range of environmental concentrations; artificial seawater was employed as a control.

2.2. Identification of AK and Phylogenetic Analysis

The AK gene sequence was identified from the 454 GS-FLX-transcript databases [10]. The sequence was analyzed based on the nucleotide database using BLASTn (Ver. 2.12.0+). A phylogenetic analysis was conducted to investigate the interspecies classification of various taxa of the AK gene at the nucleotide sequence level. Nucleotide sequence data were obtained from the GenBank database through a BLAST search, and multiple sequence alignment was performed using Clustal X (Ver. 1.8). The phylogenetic tree was constructed using the neighbor-joining algorithm in Geneious Prime (Ver. 2023.2.1), with a bootstrap analysis of 1000 replicates.

2.3. Total RNA Extraction and cDNA Synthesis

Total RNA was extracted from the gill and hepatopancreas tissues in each experimental and control group using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), per the manufacturer’s guidelines. DNase I treatment (Takara, Japan) was performed on the total RNA samples to remove any genomic DNA contaminants. The purity and quality of the treated RNA were validated using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 1% agarose gel electrophoresis. The samples were then aliquoted and stored at −80 °C. Subsequently, the total RNA was utilized as a template to synthesize complementary DNA (cDNA) employing a PrimeScript™ 1st Strand cDNA Synthesis kit (Takara, Japan), as described in our previous research [26,27].

2.4. Gene Expression Analysis of M. japonicus AK

A quantitative real-time polymerase chain reaction (qRT-PCR) analysis was conducted to investigate the relative expression of target genes. The most efficient internal control gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was selected based on prior research findings. Table 1 provides the accession numbers and primer sequences for the target AK gene and the GAPDH reference gene employed in the present study.
qRT-PCR was conducted to quantify the cDNA samples. The reaction mix consisted of a 20 μL volume containing 5 μL of 40-fold diluted original cDNA, 10 μL of 2× SYBR Green Master Mix (Bioneer, Daejeon, Republic of Korea), 0.5 μL of each primer, and 4.0 μL of DEPC-treated water, using an Exicycler 96 system. The qRT-PCR protocol included one cycle of 95 °C for 10 min, followed by 40 cycles of 94 °C for 15 s, 58 °C for 45 s, and a melting curve analysis from 68 °C to 94 °C to verify the specificity of the PCR products. The Exicycler™96 real-time system automatically sets the baseline. The primer efficiencies were calculated using the equation E = 10(−1/slope) for the 10-fold serially diluted cDNA samples, and all PCR assays exhibited a strong linear fit with the cDNA template dilutions, with efficiencies ≥ 92%. The relative expression levels of the target transcripts were determined using the best-performing reference gene and the 2(−ΔΔCt) method.

2.5. Statistical Analysis

Statistical analysis of the toxic effects of irgarol exposure on AK gene expression was performed using a one-way analysis of variance, followed by Tukey’s multiple comparison test. The statistical analysis was conducted using GraphPad Prism 10 (10.4.0). Differences were considered statistically significant at p < 0.05. All data are presented as the mean ± standard error.

3. Results and Discussion

3.1. Expression of proPO System-Related Genes in Gonads After Exposure to EDCs

The nucleotide sequence for the M. japonicus AK gene was 1074 bp. Meanwhile, phylogenetic analysis identified two major phylogenetic groups (Figure 1b). The M. japonicus AK gene was highly similar to those in Macrophthalmus milloti, Ilygrapsus paludicola, Thalassograpsus harpax, Cyclograpsus intermedius, Eriocheir sinensis, Pseudograpsus crassus, Chasmagnathus granulata, and Hemiplax hirtipes within a same clade. The presence of crustaceans belonging to different clusters was observed, including Scylla olivacea, Scylla paramamosain, Portunus trituberculatus, Callinectes arcuatus, Callinectes bellicosus, and Cherax quadricarinatus. The AK gene was noted in another clade group, which included many insect clades, such as Phyllotreta striolata, Bombyx mori, Solenopsis invicta, Triatoma vitticeps, Apis mellifera, Cissites cephalotes, Locusta migratoria manilensis, Schistocerca americana, Periplaneta americana, Blattella germanica, and Periplaneta americana.
The phylogenetic distribution of AK has been the focus of extensive research to elucidate its evolutionary history and functional significance across a diverse range of taxonomic groups. AK has exhibited a complex evolutionary trajectory whereby it has undergone multiple independent duplications and diversification along taxonomic lineages. This has resulted in the emergence of two distinct patterns: Those with a single AK gene and those displaying complex distribution patterns characterized by expansion and diversification. This evidence indicates that the AK gene is integral to adapting diverse organisms, particularly marine invertebrates, to specific environmental and physiological requirements [28,29]. In this study, phylogenetic tree analysis of AK showed that the studied species, M. japonicus, clustered with M. milloti and I. pahudicola. M. japonicus and M. milloti belong to the same genus, which can be explained by the high morphological and ecological similarities observed between the two species. Meanwhile, I. pahudicola belongs to the Macrophthalmidae but is in the same clade despite being a different genus, suggesting that these may be phylogenetically related at a molecular level rather than classified by morphological characters. Furthermore, the arginine binding site and ADP binding site within the AK gene exhibited the same homology with M. milloti and I. pahudicole, which are members of the same clade. This indicates that the AK gene is highly functionally conserved among intertidal species. The AK gene is widely distributed within insects and various crustaceans, suggesting that the AK gene in M. japonicus identified in this study is phylogenetically well conserved within Arthropoda. Several studies have indicated that AKs may be susceptible to numerous stressful environmental factors. As an illustration, the AK gene expression in freshwater giant prawn (Macrobrachium rosenbergii) is enhanced following exposure to infectious subcutaneous and hematopoietic necrosis viruses and has been identified as a potential contributor to crustacean immune responses [30]. Moreover, AK gene expression was substantially elevated in white-leg shrimp (Litopenaeus vannamei) in response to the presence of lipopolysaccharide, a constituent of the bacterial cell wall, suggesting a role in the immune response mechanism of crustaceans [31]. Our findings indicate that AK is widely distributed and well conserved within marine crustaceans, which suggests that the AK gene plays a pivotal role in adaptation and survival within the intricate marine ecosystem.

3.2. Expression Analysis of AK Genes in M. japonicus Following Irgarol Exposure

We observed changes in AK gene expression in M. japonicus gill tissue upon irgarol exposure (Figure 2). Here, upon 4 and 7 days of irgarol exposure, the AK gene showed the highest gene expression at the high concentration of 30 µg L−1, while lower gene expression was observed at 1 µg L−1 irgarol exposure, compared to the control. On day 1, an irgarol exposure of 1 µg L−1 exhibited relatively high gene expression compared to the control, but 10 µg L−1 irgarol exhibited significantly low AK gene expression (p < 0.05) (Figure 2a). At 4 days, 1 µg L−1 and 10 µg L−1 irgarol exposures produced lower AK expressions than the controls (p < 0.05), but increased AK gene expression was observed in gills exposed to 30 µg L−1 irgarol (p < 0.05) (Figure 2b). After 7 days of irgarol exposure, a sharp decrease in AK gene expression was observed at 1 µg L−1 irgarol (p < 0.001); however, expression increased to levels similar to controls as the irgarol exposure concentration rose (Figure 2c). In addition, exposure to the higher concentration of 30 µg L−1 irgarol produced a significant increase in expression in the gills compared to controls (p < 0.05).
Irgarol exposure induced higher AK gene expression in all M. japonicus hepatopancreas exposure groups compared to the control group (Figure 3). At day 1 of exposure, AK gene expression was statistically significantly increased in response to 1 µg L−1 (p < 0.05) and 10 µg L−1 (p < 0.001) irgarol exposures; however, a decrease was observed at the higher irgarol exposure concentration of 30 µg L−1 (Figure 3a). In addition, hepatopancreas tissues exposed to 1 µg L−1 and 10 µg L−1 irgarol for 4 days exhibited similar gene expression although expressions were higher for both compared to the control (p < 0.001). Comparatively, AK expression decreased after exposure to 30 µg L−1 irgarol (p < 0.05), similar to the expression pattern observed on day 1 of exposure (Figure 3b). Nevertheless, AK gene expression was significantly increased in all irgarol-exposed groups on day 7 (p < 0.001) (Figure 3c).
Irgarol is a common antifouling paint that functions as a photosynthesis inhibitor and is well known for its ability to induce a decrease in phytoplankton productivity. As antifouling paints are released into the environment, they can cause toxic effects on a variety of marine organisms, disrupting normal metabolic functions and leading to disturbances in growth, development, reproduction, and behavior [24,32]. Irgarol is a major threat to biodiversity due to its wide distribution within the marine and estuarine environment (Table 2). Prior research has demonstrated that M. japonicus exposed to irgarol exhibited a concentration-dependent reduction in exoskeleton surface roughness, accompanied by a time-concentration-dependent increase in chitinase gene expression, which plays a role in exoskeleton formation [10]. Furthermore, the coral Acropora tenuis exhibited alterations in heat shock protein gene expressions, accompanied by a notable decline in the photosynthetic efficiency of its symbiotic dinoflagellates following elevated concentrations of irgarol exposure [33]. Irgarol, a widely used antifouling agent, has been shown to exert significant physiological and behavioral effects on crustaceans. From a physiological perspective, irgarol exposure disrupts cellular homeostasis by inducing mitochondrial dysfunction and increasing reactive oxygen species (ROS) production in crustaceans [34]. In addition, irgarol exposure is closely linked to developmental delays and increased mortality rates during the larval stages of crustaceans such as Tigriopus japonicus, highlighting its high neurotoxic potential and its capacity to impair normal behavioral functions [35]. Chronic exposure to irgarol has also been reported to reduce hatching success and negatively affect early developmental stages in Artemia salina [36]. The endocrine systems of crustaceans are diverse and intricate, regulating several critical biological processes, including molting, growth, and reproduction [10,37,38]. As a result, these systems render crustaceans highly susceptible to disruption by exogenous substances. Furthermore, crustacean immune systems, which rely predominantly on innate immunity, may be vulnerable to disruption by anthropogenic chemicals. Consequently, examining the cellular-level alterations observed in M. japonicus following irgarol exposure is paramount from an ecotoxicological perspective within estuarine ecosystems.
In the present study, mRNA expression of AK in gill tissues was higher in 30 µg L−1 irgarol-exposed individuals at days 4 and 7 compared to controls, confirming a concentration-dependent trend. Notably, hepatopancreas exhibited higher AK expression compared to controls (1.0-fold) at all exposure concentrations, with the highest AK gene expression observed after 7 days of exposure alongside a clear exposure time-dependent trend (Figure 4). AK plays a role in mediating physiological stress responses in marine organisms, and its activity and expression can be highly sensitive to exposure to toxins and other harmful chemicals [45,46]. Previous studies have demonstrated a time- and concentration-dependent reduction in the survival rate of M. japonicus upon exposure to irgarol. Additionally, significant time-dependent upregulation of genes associated with exoskeleton formation (e.g., Chitinase 1, 4, 5), endocrine regulation (Ecdysteroid receptor), and immune response (serine proteinase) was observed [10]. Irgarol exposure also induced a significant time-dependent increase in p38 MAPK gene expression in the gill and hepatopancreas tissues of M. japonicus [27]. These findings suggest that irgarol exerts toxicological effects on M. japonicus, promoting increased expression of endocrine and immune-related genes while impacting exoskeleton formation processes. Consistent with these prior observations, our study also revealed a similar trend of increased AK gene expression in M. japonicus under irgarol exposure, further supporting its role in mediating molecular responses to environmental stressors. In addition, previous studies have characterized the molecular features of the AK gene in mud crabs and found that acute toxic effects were observed in the hepatopancreas tissue upon infection with the bacterium Vibrio alginolyticus [47]. Moreover, concentration- and time-dependent alterations in the AK gene expression were observed in the gills and hepatopancreas of M. japonicus in response to changes in salinity (low salinity: 10 PSU, control: 25 PSU, high salinity: 30 PSU) [14]. Therefore, the AK gene expression observed in M. japonicus gills and hepatopancreas in this study was found to be highly sensitive to external agents, a result that is consistent with those of previous studies [33,48]. Furthermore, an earlier study indicated a direct correlation between arginine activity and ovarian development in the Chinese mitten crab (Eriocheir sinensis), suggesting its involvement in crustacean reproduction [49]. This indicates that AK may directly or indirectly affect energy metabolism and other physiological processes such as reproduction, feeding, and movement. In addition, irgarol exposure may be involved in arginine metabolism, which may be involved in a wide range of molecular-level stresses, including oxidative stress and cellular activity (Figure 1a). Previous studies have shown that arginine kinase is highly conserved in marine crabs, such as Callinectes sapidus and Carcinus maenas, and that its enzymatic activity doubles when exposed to low-salinity environments [50]. This suggests that arginine kinase functions as an efficient energy buffer when the ATP/ADP ratio is low, responding to physiological mechanisms that support ATP supply during external stress responses. Nevertheless, to date, studies on AK in crustaceans have been largely confined to molecular characterizations and effects in response to salinity or bacterial infections. Consequently, there is a pressing need for further studies on cellular responses at different substance levels to provide a comprehensive picture of the ecotoxicological effects.
The gills and hepatopancreas of crustaceans are important tissues for biological processes as a defense response to external stress. In this study, an exposure time-dependent increase in expression was observed in gill tissue at low concentrations (1 μg L−1), while hepatopancreas tissue demonstrated a concentration-dependent increase in AK gene expression across all exposure groups (Figure 4). Additionally, the hepatopancreas exhibited tissue-specific differences, with relatively higher AK gene expression than the gills. The observed tissue-specific differences in gene expression align with trends reported in previous studies. For instance, in M. japonicus exposed to irgarol, the expression of the Chitinase 5 gene was significantly higher in the hepatopancreas compared to the gills [10]. Similarly, exposure to the di-(2-ethylhexyl) phthalate (DEHP) revealed heightened sensitivity of the hepatopancreas, as evidenced by increased expression of the ryanodine receptor gene, which is involved in energy metabolism [26]. The observed differences in expression patterns across different tissues in response to irgarol exposure can be attributed to variations in biological functional groups. The gills are important in homeostasis, osmotic control, and ion transport between the external medium and the hemolymph [51]. The gills are also used as a marker for stress response, as they show direct contact with exogenous substances. Hepatopancreas tissue performs typical liver functions in vertebrates and is involved in a variety of molecular functions such as the activation of the prophenoloxidase system, the main immune mechanism in crustaceans, nutrient absorption, and the production of digestive enzymes [10]. These differences in tissue function are likely attributable to the fact that the hepatopancreas exhibits a markedly disparate expression profile to AK genes, which are implicated in energy metabolism due to their involvement in maintaining homeostasis and regulating immune responses (Figure 5).
Furthermore, the role of arginine in regulating the production of reactive nitrogen–oxygen species (RNOS) within the tissue in response to irgarol exposure may influence AK expression. Previous studies have demonstrated that endocrine disruptors and heavy metal stresses are highly sensitive to innate immunity in the gill and hepatopancreas of M. japonicus [52]. Additionally, external stressors can potentially disrupt energy metabolism by disturbing the homeostasis of calcium channels in the gills and hepatopancreas of M. japonicus [26]. However, the expression patterns at the mRNA level observed in the present study confirm the molecular trends observed in response to irgarol exposure, suggesting further studies on the distribution and functional roles of AK genes in different tissues of crustaceans.

4. Conclusions

This study investigated the molecular phylogenetic distribution and gene expression of AK in M. japonicus following exposure to the antifouling paint irgarol. The results show that the AK gene is distributed at different species levels within crustaceans and insects. AK gene expression exhibited a relatively high increase in gill tissues following 4 and 7 days of exposure to high irgarol concentrations (30 µg L1) compared to controls. Additionally, the hepatopancreas of M. japonicus exposed to irgarol showed a higher AK gene expression than the controls in all exposure groups. A comparison of tissue-specific expression differences found that the AK gene was relatively more sensitive to irgarol exposure in hepatopancreas than gills, possibly due to tissue-specific functional differences. These changes in AK gene expression suggest that irgarol exposure may have toxicological effects in M. japonicus tissues, leading to disrupted energy metabolism.

Author Contributions

Conceptualization, I.-S.K.; methodology, W.-S.K. and K.P.; software, W.-S.K.; validation, W.-S.K.; formal analysis, W.-S.K. and K.P.; investigation, W.-S.K. and J.P.; resources, W.-S.K.; data curation, K.P. and I.-S.K.; writing—original draft preparation, W.-S.K.; writing—review and editing, W.-S.K., K.P. and I.-S.K.; visualization, W.-S.K. and J.P.; supervision, I.-S.K.; project administration, I.-S.K.; funding acquisition, I.-S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Research Foundation of Korea (NRF) grant [NRF-2018-R1A6A1A-03024314] and “Risk Assessment to Prepare Standards for Protecting Marine Ecosystems” of Korea Institute of Marine Science and Technology Promotion (KIMST) funded by the Ministry of Oceans and Fisheries (KIMST-20220383) and the Korea Environment Industry and Technology Institute (KEITI) through the Aquatic Ecosystem Conservation Research Program sponsored by the Korea Ministry of Environment (MOE 2021003050001).

Institutional Review Board Statement

This research utilized invertebrate species (crabs), which are exempt from ethical approval requirements under South Korea’s Animal Protection Act (Law No. 19880).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data in this study will be disclosed upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Silva, E.R.; Ferreira, O.; Ramalho, P.A.; Azevedo, N.F.; Bayón, R.; Igartua, A.; Bordado, J.C.; Calhorda, M.J. Eco-friendly non-biocide-release coatings for marine biofouling prevention. Sci. Total Environ. 2019, 650, 2499–2511. [Google Scholar] [CrossRef] [PubMed]
  2. Beyer, J.; Song, Y.; Tollefsen, K.E.; Berge, J.A.; Tveiten, L.; Helland, A.; Øxnevad, S.; Schøyen, M. The ecotoxicology of marine tributyltin (TBT) hotspots: A review. Mar. Environ. Res. 2022, 179, 105689. [Google Scholar] [CrossRef]
  3. Sapozhnikova, Y.; Wirth, E.; Schiff, K.; Fulton, M. Antifouling biocides in water and sediments from California marinas. Mar. Pollut. Bull. 2013, 69, 189–194. [Google Scholar] [CrossRef] [PubMed]
  4. Zhou, J.L. Occurrence and persistence of antifouling biocide Irgarol 1051 and its main metabolite in the coastal waters of Southern England. Sci. Total Environ. 2008, 406, 239–246. [Google Scholar] [CrossRef] [PubMed]
  5. Eriksson, K.M.; Antonelli, A.; Nilsson, R.H.; Clarke, A.K.; Blanck, H. A phylogenetic approach to detect selection on the target site of the antifouling compound irgarol in tolerant periphyton communities. Environ. Microbiol. 2009, 11, 2065–2077. [Google Scholar] [CrossRef] [PubMed]
  6. Kaamoush, M.I.A. Biological monitoring of inhibitory effects of antifouling agent Irgarol 1051 on growth and essential metabolites of marine alga Chlorella salina. Int. Marit. Transp. Logist. J. 2022, 11, 145–158. [Google Scholar] [CrossRef]
  7. Zhang, A.Q.; Zhou, G.-J.; Lam, M.H.W.; Leung, K.M.Y. Toxicities of the degraded mixture of Irgarol 1051 to marine organisms. Chemosphere 2019, 225, 565–573. [Google Scholar] [CrossRef]
  8. Ali, H.R.; Arifin, M.M.; Sheikh, M.A.; Shazili, N.A.M.; Bachok, Z. Occurrence and distribution of antifouling biocide Irgarol-1051 in coastal waters of Peninsular Malaysia. Mar. Pollut. Bull. 2013, 70, 253–257. [Google Scholar] [CrossRef]
  9. Sheikh, M.A.; Juma, F.S.; Staehr, P.; Dahl, K.; Rashid, R.J.; Mohammed, M.S.; Ussi, A.M.; Ali, H.R. Occurrence and distribution of antifouling biocide Irgarol-1051 in coral reef ecosystems, Zanzibar. Mar. Pollut. Bull. 2016, 109, 586–590. [Google Scholar] [CrossRef]
  10. Park, K.; Nikapitiya, C.; Kim, W.-S.; Kwak, T.-S.; Kwak, I.-S. Changes of exoskeleton surface roughness and expression of crucial participation genes for chitin formation and digestion in the mud crab (Macrophthalmus japonicus) following the antifouling biocide irgarol. Ecotoxicol. Environ. Saf. 2016, 132, 186–195. [Google Scholar] [CrossRef]
  11. Koo, B.J.; Kim, S.-H.; Hyun, J.-H. Feeding behavior of the ocypodid crab Macrophthalmus japonicus and its effects on oxygen-penetration depth and organic-matter removal in intertidal sediments. Estuar. Coast. Shelf Sci. 2019, 228, 106366. [Google Scholar] [CrossRef]
  12. Otani, S.; Kozuki, Y. Growth characteristics and population dynamics of Macrophthalmus japonicus with decreasing microphytobenthos biomass in muddy estuarine tidal flat. Reg. Stud. Mar. Sci. 2024, 72, 103436. [Google Scholar] [CrossRef]
  13. Park, K.; Kwak, T.-S.; Kim, W.-S.; Kwak, I.-S. Changes in exoskeleton surface roughness and expression of chitinase genes in mud crab Macrophthalmus japonicus following heavy metal differences of estuary. Mar. Pollut. Bull. 2019, 138, 11–18. [Google Scholar] [CrossRef] [PubMed]
  14. Nikapitiya, C.; Kim, W.-S.; Park, K.; Kwak, I.-S. Identification of potential markers and sensitive tissues for low or high salinity stress in an intertidal mud crab (Macrophthalmus japonicus). Fish. Shellfish Immun. 2014, 41, 407–416. [Google Scholar] [CrossRef]
  15. Brady, J.P.; Ayoko, G.A.; Martens, W.N.; Goonetilleke, A. Development of a hybrid pollution index for heavy metals in marine and estuarine sediments. Environ. Monit. Assess. 2015, 187, 306. [Google Scholar] [CrossRef]
  16. Pan, K.; Wang, W.-X. Trace metal contamination in estuarine and coastal environments in China. Sci. Total Environ. 2012, 421, 3–16. [Google Scholar] [CrossRef]
  17. Laino, A.; Lopez-Zavala, A.A.; Garcia-Orozco, K.D.; Carrasco-Miranda, J.S.; Santana, M.; Stojanoff, V.; Sotelo-Mundo, R.R.; Garcia, C.F. Biochemical and structural characterization of a novel arginine kinase from the spider Polybetes pythagoricus. PeerJ 2017, 5, e3787. [Google Scholar] [CrossRef]
  18. Yousef, M.S.; Clark, S.A.; Pruett, P.K.; Somasundaram, T.; Ellington, W.R.; Chapman, M.S. Induced fit in guanidino kinases—Comparison of substrate-free and transition state analog structures of arginine kinase. Protein Sci. 2003, 12, 103–111. [Google Scholar] [CrossRef]
  19. Bragg, J.; Rajkovic, A.; Anderson, C.; Curtis, R.; Houten, J.V.; Begres, B.; Naples, C.; Snider, M.; Fraga, D.; Singer, M. Identification and Characterization of a Putative Arginine Kinase Homolog from Myxococcus xanthus Required for Fruiting Body Formation and Cell Differentiation. J. Bacteriol. 2012, 194, 2668–2676. [Google Scholar] [CrossRef]
  20. Wu, Q.-Y.; Li, F.; Wang, X.-Y. Val65 plays an important role in the substrate synergism, structural stability and activity of arginine kinase. Int. J. Biol. Macromol. 2009, 45, 393–398. [Google Scholar] [CrossRef]
  21. Tong, B.C.; Barbul, A. Cellular and physiological effects of arginine. Mini Rev. Med. Chem. 2004, 4, 823–832. [Google Scholar] [CrossRef] [PubMed]
  22. Yin, S.J.; Zhang, L.; Zhang, L.; Wan, J.; Song, W.; Jiang, X.; Park, Y.D.; Si, Y.X. Metabolic responses and arginine kinase expression of juvenile cuttlefish (Sepia pharaonis) under salinity stress. Int. J. Biol. Macromol. 2018, 113, 881–888. [Google Scholar] [CrossRef] [PubMed]
  23. Lin, W.; Luo, H.; Wu, J.; Hung, T.C.; Cao, B.; Liu, X.; Yang, J.; Yang, P. A review of the emerging risks of acute ammonia nitrogen toxicity to aquatic decapod crustaceans. Water 2022, 15, 27. [Google Scholar] [CrossRef]
  24. Vogt, É.L.; Model, J.F.; Vinagre, A.S. Effects of organotins on crustaceans: Update and perspectives. Front. Endocrinol. 2018, 9, 65. [Google Scholar] [CrossRef]
  25. Thor, P.; Vermandele, F.; Bailey, A.; Guscelli, E.; Loubet-Sartrou, L.; Dupont, S.; Calosi, P. Ocean acidification causes fundamental changes in the cellular metabolism of the Arctic copepod Calanus glacialis as detected by metabolomic analysis. Sci. Rep. 2022, 12, 22223. [Google Scholar] [CrossRef]
  26. Kim, W.-S.; Park, K.; Kim, J.-H.; Kwak, I.-S. Effect of endocrine-disrupting chemicals on the expression of a calcium ion channel receptor (ryanodine receptor) in the mud crab (Macrophthalmus japonicus). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2024, 283, 109972. [Google Scholar] [CrossRef]
  27. Park, K.; Kim, W.-S.; Choi, B.; Kwak, I.-S. Expression Levels of the Immune-Related p38 Mitogen-Activated Protein Kinase Transcript in Response to Environmental Pollutants on Macrophthalmus japonicus Crab. Genes 2020, 11, 958. [Google Scholar] [CrossRef]
  28. Pereira, C.A.; Alonso, G.D.; Paveto, M.C.; Iribarren, A.; Cabanas, M.L.; Torres, H.N.; Flawiá, M.M. Trypanosoma cruzi Arginine Kinase Characterization and Cloning A Novel Energetic Pathway in Protozoan Parasites. J. Biol. Chem. 2020, 275, 1495–1501. [Google Scholar] [CrossRef]
  29. Si, Y.-X.; Song, J.-J.; Fang, N.-Y.; Wang, W.; Wang, Z.-J.; Yang, J.-M.; Qian, G.-Y.; Yin, S.-J.; Park, Y.-D. Purification, characterization, and unfolding studies of arginine kinase from Antarctic krill. Int. J. Biol. Macromol. 2014, 67, 426–432. [Google Scholar] [CrossRef]
  30. Arockiaraj, J.; Vanaraja, P.; Easwvaran, S.; Singh, A.; Alinejaid, T.; Othman, R.Y.; Bhassu, S. Gene profiling and characterization of arginine kinase-1 (MrAK-1) from freshwater giant prawn (Macrobrachium rosenbergii). Fish Shellfish Immunol. 2011, 31, 81–89. [Google Scholar] [CrossRef]
  31. Yao, C.-L.; Ji, P.-F.; Kong, P.; Wang, Z.-Y.; Xiang, J.-H. Arginine kinase from Litopenaeus vannamei: Cloning, expression and catalytic properties. Fish Shellfish Immunol. 2009, 26, 553–558. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, Q.; Hong, H.; Yang, D.; Li, J.; Chen, S.; Pan, C.; Lu, H.; Liu, J.; Yan, C. Health risk assessment of heavy metal and its mitigation by glomalin-related soil protein in sediments along the South China coast. Environ. Pollut. 2020, 263, 114565. [Google Scholar] [CrossRef] [PubMed]
  33. Kamei, Y.; Hatazawa, Y.; Uchitomi, R.; Yoshimura, R.; Miura, S. Regulation of skeletal muscle function by amino acids. Nutrients 2020, 12, 261. [Google Scholar] [CrossRef]
  34. Liang, B.; Wang, L.; He, T.; Liu, W.; Li, Q.; Li, M. In vitro reactive oxygen species production by mitochondria from the rabbitfish Siganus fuscessens livers and the effects of Irgarol-1051. Environ. Toxicol. Pharmacol. 2013, 35, 154–160. [Google Scholar] [CrossRef] [PubMed]
  35. Bao, V.W.; Leung, K.M.; Lui, G.C.; Lam, M.H. Acute and chronic toxicities of Irgarol alone and in combination with copper to the marine copepod Tigriopus japonicus. Chemosphere 2013, 90, 1140–1148. [Google Scholar] [CrossRef] [PubMed]
  36. Lee, D.H.; Eom, H.J.; Kim, M.; Jung, J.H.; Rhee, J.S. Non-target effects of antifouling agents on mortality, hatching success, and acetylcholinesterase activity in the brine shrimp Artemia salina. ToxEHS 2017, 9, 237–243. [Google Scholar] [CrossRef]
  37. Jagiello, Z.; Dylewski, Ł.; Szulkin, M. The plastic homes of hermit crabs in the Anthropocene. Sci. Total Environ. 2024, 913, 168959. [Google Scholar] [CrossRef]
  38. Zheng, J.; Cai, L.; Jia, Y.; Chi, M.; Cheng, S.; Liu, S.; Li, F.; Gu, Z. Identification and functional analysis of the doublesex gene in the redclaw crayfish, Cherax quadricarinatus. Gene Expr. Patterns 2020, 37, 119129. [Google Scholar] [CrossRef]
  39. Kim, N.S.; Shim, W.J.; Yim, U.H.; Hong, S.H.; Ha, S.Y.; Han, G.M.; Shin, K.H. Assessment of TBT and organic booster biocide contamination in seawater from coastal areas of South Korea. Mar. Pollut. Bull. 2014, 78, 201–208. [Google Scholar] [CrossRef]
  40. Saleh, A.; Molaei, S.; Fumani, N.S.; Abedi, E. Antifouling paint booster biocides (Irgarol 1051 and diuron) in marinas and ports of Bushehr, Persian Gulf. Mar. Pollut. Bull. 2016, 105, 367–372. [Google Scholar] [CrossRef]
  41. Batista-Andrade, J.A.; Caldas, S.S.; de Oliveira Arias, J.L.; Castro, I.B.; Fillmann, G.; Primel, E.G. Antifouling booster biocides in coastal waters of Panama: First appraisal in one of the busiest shipping zones. Mar. Pollut. Bull. 2016, 112, 415–419. [Google Scholar] [CrossRef] [PubMed]
  42. Kaonga, C.C.; Takeda, K.; Sakugawa, H. Concentration and degradation of alternative biocides and an insecticide in surface waters and their major sinks in a semi-enclosed sea, Japan. Chemosphere 2016, 145, 256–264. [Google Scholar] [CrossRef] [PubMed]
  43. Lam, N.H.; Jeong, H.H.; Kang, S.D.; Kim, D.J.; Ju, M.J.; Horiguchi, T.; Cho, H.S. Organotins and new antifouling biocides in water and sediments from three Korean Special Management Sea Areas following ten years of tributyltin regulation: Contamination profiles and risk assessment. Mar. Pollut. Bull. 2017, 121, 302–312. [Google Scholar] [CrossRef] [PubMed]
  44. Harino, H.; Ohji, M.; Kono, K.; Onduka, T.; Hano, T.; Mochida, K. Current Status of Antifouling Biocides Contamination in the Seto Inland Sea, Japan. Arch. Environ. Contam. Toxicol. 2023, 85, 333–348. [Google Scholar] [CrossRef] [PubMed]
  45. Huang, Y.; Wu, D.; Li, Y.; Chen, Q.; Zhao, Y. Characterization and expression of arginine kinase 2 from Macrobrachium nipponense in response to salinity stress. Dev. Comp. Immunol. 2020, 113, 103804. [Google Scholar] [CrossRef]
  46. Yang, Z.; Huang, X.; Liao, H.; Zhang, Z.; Sun, F.; Kou, S.; Bao, Z. Structure and functional analysis reveal an important regulated role of arginine kinase in Patinopecten yessoensis under low pH stress. Aquat. Toxicol. 2020, 222, 105452. [Google Scholar] [CrossRef]
  47. Xie, Y.; Gong, J.; Ye, H.; Huang, H.; Yang, Y. Molecular Characteristic and Responsive Expression of Arginine Kinase in the Mud Crab, Scylla paramamosain. J. World Aquac. Soc. 2014, 45, 127–137. [Google Scholar] [CrossRef]
  48. Guo, S.-Y.; Guo, Z.; Guo, Q.; Chen, B.-Y.; Wang, X.-C. Expression, purification, and characterization of arginine kinase from the sea cucumber Stichopus japonicus. Protein Expr. Purif. 2003, 29, 230–234. [Google Scholar] [CrossRef]
  49. Qi, C.; Li, J.; Huang, K.; Wang, X.; Qin, C.; Li, E.; Qin, J.; Chen, L. The regulatory effects of arginine on ovary development in the Chinese mitten crab Eriocheir sinensis. Aquac. Rep. 2024, 37, 102277. [Google Scholar] [CrossRef]
  50. Kotlyar, S.; Weihrauch, D.; Paulsen, R.S.; Towle, D.W. Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus. J. Exp. Biol. 2000, 203, 2395–2404. [Google Scholar] [CrossRef]
  51. McNamara, J.C.; Faria, S.C. Evolution of osmoregulatory patterns and gill ion transport mechanisms in the decapod Crustacea: A review. J. Comp. Physiol. B 2012, 182, 997–1014. [Google Scholar] [CrossRef]
  52. Park, K.; Kim, W.-S.; Kwak, I.-S. Endocrine-disrupting chemicals impair the innate immune prophenoloxidase system in the intertidal mud crab, Macrophthalmus japonicus. Fish Shellfish Immun. 2019, 87, 322–332. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic diagram of the arginine pathway (a) and phylogenetic analysis (b) of the AK gene in M. japonicus. A diagram of the three major processes that arginine contributes to in the cytoplasm: (1) RNOS synthesis via NOS production to induce oxidative stress, (2) contribution to the urea cycle and cellular homeostasis via ARG, and (3) contribution to energy metabolism via AGAT and AK. AK gene construction for phylogenetic analysis through neighbor-joining analysis (bootstrap value 1000). The numbers at the nodes are the percentage bootstrap values. NADPH: nicotinamide adenine dinucleotide phosphate, NOS: nitric oxide synthase, NO: nitric oxide, RNOS: reactive nitrogen–oxygen species, ARG: arginase, ODC: ornithine decarboxylase, OAT: ornithine aminotransferase, AGAT: arginine: glycine aminotransferase, AK: arginine kinase, ATP: adenosine triphosphate.
Figure 1. Schematic diagram of the arginine pathway (a) and phylogenetic analysis (b) of the AK gene in M. japonicus. A diagram of the three major processes that arginine contributes to in the cytoplasm: (1) RNOS synthesis via NOS production to induce oxidative stress, (2) contribution to the urea cycle and cellular homeostasis via ARG, and (3) contribution to energy metabolism via AGAT and AK. AK gene construction for phylogenetic analysis through neighbor-joining analysis (bootstrap value 1000). The numbers at the nodes are the percentage bootstrap values. NADPH: nicotinamide adenine dinucleotide phosphate, NOS: nitric oxide synthase, NO: nitric oxide, RNOS: reactive nitrogen–oxygen species, ARG: arginase, ODC: ornithine decarboxylase, OAT: ornithine aminotransferase, AGAT: arginine: glycine aminotransferase, AK: arginine kinase, ATP: adenosine triphosphate.
Applsci 15 02489 g001
Figure 2. Change in M. japonicus gill AK mRNA expression levels on days 1 (a), 4 (b), and 7 (c) after exposure to 1, 10, and 30 µg L−1 irgarol. The values were normalized against GAPDH expression and are presented as the mean ± SE. The expression level of the control was set as 1. Significant differences are indicated with asterisks: ** p < 0.05, *** p < 0.001.
Figure 2. Change in M. japonicus gill AK mRNA expression levels on days 1 (a), 4 (b), and 7 (c) after exposure to 1, 10, and 30 µg L−1 irgarol. The values were normalized against GAPDH expression and are presented as the mean ± SE. The expression level of the control was set as 1. Significant differences are indicated with asterisks: ** p < 0.05, *** p < 0.001.
Applsci 15 02489 g002
Figure 3. Change in M. japonicus hepatopancreas AK mRNA expression levels on days 1 (a), 4 (b), and 7 (c) after exposure to 1, 10, and 30 µg L−1 irgarol. The values were normalized against GAPDH and are presented as the mean ± SE. The expression level of the control was set as 1. Significant differences are indicated with asterisks: ** p < 0.05, *** p < 0.001.
Figure 3. Change in M. japonicus hepatopancreas AK mRNA expression levels on days 1 (a), 4 (b), and 7 (c) after exposure to 1, 10, and 30 µg L−1 irgarol. The values were normalized against GAPDH and are presented as the mean ± SE. The expression level of the control was set as 1. Significant differences are indicated with asterisks: ** p < 0.05, *** p < 0.001.
Applsci 15 02489 g003
Figure 4. Heatmap of relative mRNA levels in the M. japonicus gill and hepatopancreas after exposure to 1, 10, and 30 µg L−1 irgarol on days 1, 4, and 7. The color schematically represents the up- or downregulation of AK expression.
Figure 4. Heatmap of relative mRNA levels in the M. japonicus gill and hepatopancreas after exposure to 1, 10, and 30 µg L−1 irgarol on days 1, 4, and 7. The color schematically represents the up- or downregulation of AK expression.
Applsci 15 02489 g004
Figure 5. Shematic diagram of the effects of AK expression in M. japonicus gills and hepatopancreas after irgarol exposure. Create diagrams showing trends and effects of AK gene expression in M. japonicus exposed to irgarol based on current expression results. The irgarol-induced upregulation of AK gene disrupts energy metabolism, leading to an imbalance in intracellular homeostasis. This led to a decreased survival rate [10,27].
Figure 5. Shematic diagram of the effects of AK expression in M. japonicus gills and hepatopancreas after irgarol exposure. Create diagrams showing trends and effects of AK gene expression in M. japonicus exposed to irgarol based on current expression results. The irgarol-induced upregulation of AK gene disrupts energy metabolism, leading to an imbalance in intracellular homeostasis. This led to a decreased survival rate [10,27].
Applsci 15 02489 g005
Table 1. Primers used for gene amplification.
Table 1. Primers used for gene amplification.
GenePrimer SequenceAmplification
Size (bp)
Efficiency (%)Accession Number
AKTACGACATCTCCAACAAGCG7596KJ653259
AAGAATACCGTCCTGCATCTCC
GAPDHTGCTGATGCACCCATGTTTG147105KJ653265
AGGCCCTGGACAATCTCAAAG
Table 2. The environmentally relevant concentration of irgarol.
Table 2. The environmentally relevant concentration of irgarol.
SourceCountryTypeConcentration (ng L−1)Reference
WaterPeninsular MalaysiaCoast, Marine2021.00[8]
CaliforniaCoast254.00[3]
South KoreaCoast, Marine14.10[39]
Iran, BushehrCoast, Marine63.40[40]
ZanzibarCoast15.44[9]
PanamaCoast, Marine5.00[41]
SedimentCaliforniaCoast9.00[3]
Iran, BushehrCoast, Marine35.40[40]
JapanOcean61.00[42]
South KoreaCoast7.79[43]
JapanCoast, Marine128.00[44]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, W.-S.; Park, K.; Park, J.; Kwak, I.-S. Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Appl. Sci. 2025, 15, 2489. https://doi.org/10.3390/app15052489

AMA Style

Kim W-S, Park K, Park J, Kwak I-S. Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Applied Sciences. 2025; 15(5):2489. https://doi.org/10.3390/app15052489

Chicago/Turabian Style

Kim, Won-Seok, Kiyun Park, Jiwon Park, and Ihn-Sil Kwak. 2025. "Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure" Applied Sciences 15, no. 5: 2489. https://doi.org/10.3390/app15052489

APA Style

Kim, W.-S., Park, K., Park, J., & Kwak, I.-S. (2025). Energy Metabolism-Related Arginine Kinase Gene Expression in Mud Crab (Macrophthalmus japonicus) Following Irgarol Exposure. Applied Sciences, 15(5), 2489. https://doi.org/10.3390/app15052489

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop