Development of a Perfusing Small Intestine–Liver Microphysiological System Device
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Small Intestine–Liver Device
2.3. Differentiation of Human iPS Cell-Derived Small Intestinal Epithelial Cells and Culture of Cryopreserved Hepatocytes on Small Intestine–Liver Device
2.4. Static and Perfusion Culture Conditions
2.5. RNA Extraction and Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR) Analysis
2.6. TEER Measurement
2.7. Statistical Analysis
3. Results and Discussion
3.1. Configuration of Small Intestine–Liver Device
3.2. Hepatocytes Morphology at 0, 2, and 4 Days after Seeding on Small Intestine–Liver Device (2D and 3D Cultures)
3.3. mRNA Expression of Drug Metabolizing Enzymes and Nuclear Receptors in HiEs or Hepatocytes on Day 4 after Culturing on the Small Intestine–Liver Device (2D and 3D Cultures)
3.4. Changes in TEER Values
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Vinken, M. 3Rs toxicity testing and disease modeling projects in the European Horizon 2020 research and innovation program. Excli J. 2020, 19, 775–784. [Google Scholar] [PubMed]
- Esch, M.B.; Mahler, G.J.; Stokol, T.; Shuler, M.L. Body-on-a-chip simulation with gastrointestinal tract and liver tissues suggests that ingested nanoparticles have the potential to cause liver injury. Lab Chip 2014, 14, 3081–3092. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, J.H.; Wang, Y.; Shuler, M.L. Strategies for using mathematical modeling approaches to design and interpret multi-organ microphysiological systems (MPS). APL Bioeng. 2019, 3, 021501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wikswo, J.P.; Block, F.E., 3rd; Cliffel, D.E.; Goodwin, C.R.; Marasco, C.C.; Markov, D.A.; McLean, D.L.; McLean, J.A.; McKenzie, J.R.; Reiserer, R.S.; et al. Engineering challenges for instrumenting and controlling integrated organ-on-chip systems. IEEE Trans. Biomed. Eng. 2013, 60, 682–690. [Google Scholar] [CrossRef] [Scilit]
- Kimura, H.; Sakai, Y.; Fujii, T. Organ/body-on-a-chip based on microfluidic technology for drug discovery. Drug Metab. Pharmacokinet. 2018, 33, 43–48. [Google Scholar] [CrossRef] [Scilit]
- Baudy, A.R.; Otieno, M.A.; Hewitt, P.; Gan, J.; Roth, A.; Keller, D.; Sura, R.; Van Vleet, T.R.; Proctor, W.R. Liver microphysiological systems development guidelines for safety risk assessment in the pharmaceutical industry. Lab Chip 2020, 20, 215–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deguchi, S.; Tsuda, M.; Kosugi, K.; Sakamoto, A.; Mimura, N.; Negoro, R.; Sano, E.; Nobe, T.; Maeda, K.; Kusuhara, H.; et al. Usability of Polydimethylsiloxane-Based Microfluidic Devices in Pharmaceutical Research Using Human Hepatocytes. ACS Biomater. Sci. Eng. 2021, 7, 3648–3657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imura, Y.; Sato, K.; Yoshimura, E. Micro total bioassay system for ingested substances: Assessment of intestinal absorption, hepatic metabolism, and bioactivity. Anal. Chem. 2010, 82, 9983–9988. [Google Scholar] [CrossRef] [Scilit]
- Kabeya, T.; Mima, S.; Imakura, Y.; Miyashita, T.; Ogura, I.; Yamada, T.; Yasujima, T.; Yuasa, H.; Iwao, T.; Matsunaga, T. Pharmacokinetic functions of human induced pluripotent stem cell-derived small intestinal epithelial cells. Drug Metab. Pharmacokinet. 2020, 35, 374–382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arakawa, H.; Kamioka, H.; Jomura, T.; Koyama, S.; Idota, Y.; Yano, K.; Kojima, H.; Ogihara, T. Preliminary Evaluation of Three-Dimensional Primary Human Hepatocyte Culture System for Assay of Drug-Metabolizing Enzyme-Inducing Potential. Biol. Pharm. Bull. 2017, 40, 967–974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kabeya, T.; Qiu, S.; Hibino, M.; Nagasaki, M.; Kodama, N.; Iwao, T.; Matsunaga, T. Cyclic AMP Signaling Promotes the Differentiation of Human Induced Pluripotent Stem Cells into Intestinal Epithelial Cells. Drug Metab. Dispos. 2018, 46, 1411–1419. [Google Scholar] [CrossRef] [Scilit]
- Ogihara, T.; Arakawa, H.; Jomura, T.; Idota, Y.; Koyama, S.; Yano, K.; Kojima, H. Utility of human hepatocyte spheroids without feeder cells for evaluation of hepatotoxicity. J. Toxicol. Sci. 2017, 42, 499–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.M.L.; Bertinetti-Lapatki, C.; Schiergens, T.S.; Jauch, K.W.; Roth, A.B.; Thasler, W.E. Concurrent isolation of hepatic stem cells and hepatocytes from the human liver. In Vitro Cell. Dev. Biol. Anim. 2020, 56, 253–260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stejskalova, L.; Dvorak, Z.; Pavek, P. Endogenous and exogenous ligands of aryl hydrocarbon receptor: Current state of art. Curr. Drug Metab. 2011, 12, 198–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faucette, S.R.; Zhang, T.C.; Moore, R.; Sueyoshi, T.; Omiecinski, C.J.; LeCluyse, E.L.; Negishi, M.; Wang, H. Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. J. Pharmacol. Exp. Ther. 2007, 320, 72–80. [Google Scholar] [CrossRef] [Scilit]






| Gene Names | Forward Primer Sequences (5′-3′) | Reverse Primer Sequences (5′-3′) |
|---|---|---|
| AhR | GCACGAGAGGCTCAGGTTATCA | GTGCATTAGACTGGACCCAAGTC |
| CAR | TGATCAGCTGCAAGAGGAGA | TGGATGTGCTGGATTTGGTA |
| CYP1A2 | CTTTGACAAGAACAGTGTCCG | AGTGTCCAGCTCCTTCTGGAT |
| CYP2C9 | GACATGAACAACCCTCAGGACTTT | TGCTTGTCGTCTCTGTCCCA |
| CYP2C19 | GAACACCAAGAATCGATGGACA | TCAGCAGGAGAAGGAGAGCATA |
| CYP2D6 | CCTACGCTTCCAAAAGGCTTTT | AGAGAACAGGTCAGCCACCACT |
| CYP3A4 | CTGTGTGTTTCCAAGAGAAGTTAC | TGCATCAATTTCCTCCTGCAG |
| HPRT | CTTTGCTTTCCTTGGTCAGG | TCAAGGGCATATCCTACAACA |
| MDR1 | CCCATCATTGCAATAGCAGG | TGTTCAAACTTCTGCTCCTGA |
| PXR | AGGATGGCAGTGTCTGGAAC | AGGGAGATCTGGTCCTCGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sakai, Y.; Matsumura, M.; Yamada, H.; Doi, A.; Saito, I.; Iwao, T.; Matsunaga, T. Development of a Perfusing Small Intestine–Liver Microphysiological System Device. Appl. Sci. 2023, 13, 10510. https://doi.org/10.3390/app131810510
Sakai Y, Matsumura M, Yamada H, Doi A, Saito I, Iwao T, Matsunaga T. Development of a Perfusing Small Intestine–Liver Microphysiological System Device. Applied Sciences. 2023; 13(18):10510. https://doi.org/10.3390/app131810510
Chicago/Turabian StyleSakai, Yoko, Masanari Matsumura, Hideki Yamada, Atsushi Doi, Isao Saito, Takahiro Iwao, and Tamihide Matsunaga. 2023. "Development of a Perfusing Small Intestine–Liver Microphysiological System Device" Applied Sciences 13, no. 18: 10510. https://doi.org/10.3390/app131810510
APA StyleSakai, Y., Matsumura, M., Yamada, H., Doi, A., Saito, I., Iwao, T., & Matsunaga, T. (2023). Development of a Perfusing Small Intestine–Liver Microphysiological System Device. Applied Sciences, 13(18), 10510. https://doi.org/10.3390/app131810510
