Closely-Spaced Repetitions of CAMTA Trans-Factor Binding Sites in Promoters of Model Plant MEP Pathway Genes
Round 1
Reviewer 1 Report
There is scope of improvement.
Why small spacer sequence needed between the two RSRE cis element? Cite the reference.
What is the sequence of the spacer sequence between the two RSRE cis element. Is there any change in the nucleotides between the two RSRE cis elements? The change in the sequence affects the binding of transcription factor.
What if there is no space between the two RSRE cis element- any change in the binding of transcription factor. If this study has been done, then kindly cite the reference.
More insight needed in respect to the spacer sequence between the two RSRE cis element and MEP pathway genes respect to model plant.
Author Response
Responses to Reviewer 1 comments.
Dear Reviewer 1.
Thank you for your comments and the opportunity to correct the manuscript. Below are ans wers to your comments.
There is scope of improvement.
- Why small spacer sequence needed between the two RSRE cis element? Cite the reference.
Answer, following fragment was addend to the discussion section, page 5, marked in red:
Results of pull-down assays performed on CGCANTGCG palindromic core repeat showed that the interaction between 35S-myc CAMTA and FLAG-CAMTA in mice was decreased in the absence of DNA sequence. Therefore, the presented CGCANTGCG core palindromic motif greatly stimulates CAMTA dimerization in mice [42]. Moreover, the strong similarities in domain architecture between CAMTAs and NFκB trans-factors acting as homo- or heterodimers, suggest the CAMTAs inclination to dimerize [50]. Assuming, that the CAMTAs dimerization is mediated by CG-1 domain, participating also in DNA binding, the spacing between cis-active RSREs consensus sequences provides the free volume between two CAMTAs, that could be necessary for a proper folding and orientation of interacting CG-1 domains [42].
New citation added (numbered as 50):
Baldwin AS Jr. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu Rev Immunol. 1996;14:649-83.
- What is the sequence of the spacer sequence between the two RSRE cis element. Is there any change in the nucleotides between the two RSRE cis elements? The change in the sequence affects the binding of transcription factor.
Answer, following fragment was addend to the results section, page 3 and 4, marked in red). Old version of results was mainly removed.
Analyses of Zm00001d051458 (MECPS1) were performed on promoters defined by PlantPAN3.0 database in relation to different transcripts of Zm00001d05145, described as Zm00001d05145T002-T008. Among observed sequences of RSREs (G/A/C)CGCG(C/G/T) and spacers, most often were noted ACGCGGACCGCAGCCGCGC (Zm00001d05145/MECPS1_T002, T005, T006, T007, T008). Sequence CCGCGCTACCGTTCCGCGT was observed only in Zm00001d05145_T003 (File S1, Table S1). In the other gene Zm00001d017608/MECPS2_T001 was found the different sequence CCGCGCCACGAATCCGCGC (Table S1). Although spacer sequences are different in two ZmMECPS1 and ZmMECPS2 genes, they are seven nt long in both of them. Moreover, they are localized in 5’UTR region of ZmMECPS 1 and 2 genes (File S1, Table S1). Sequences of closely-spaced RSREs repetitions within Zea mays MECPS genes are presented in Table 1.
Table 1. Sequences of closely-spaced RSREs repetitions found in Zea mays MECPS1 and MECPS2 genes. Sequences of RSREs are written in bold and underlined.
|
Nr |
Sequence of closely-spaced RSREs repetitions |
Gene ID/Name |
|
1 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T002/MECPS1 |
|
2 |
CCGCGCTACCGTTCCGCGT |
Zm00001d051458_T003/MECPS1 |
|
3 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T005/MECPS1 |
|
4 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T006/MECPS1 |
|
5 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T007/MECPS1 |
|
6 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T008/ MECPS1 |
|
7 |
CCGCGCCACGAATCCGCGC |
Zm00001d017608_T001/MECPS2 |
The closely spaced RSREs sequences of MEP pathway genes other than ZmMECPS1 and ZmMECPS2 were observed in Zm00001d012197/CMS (File S2, Table S2). The same sequence GCGCGCTGGTGCGCGC was noted in Zm00001d012197/CMS_T001, T005, T006, T007. The spacing is 4 nt (TGGT) that is much lower value as compared to ZmMECPS 1 and 2 genes (File S2, Table S2. These repetitions were localized in the proximal promoter, within 317 nt from the putative transcription start site. Moreover, the Os03t0732000-00/HDR gene contains CCGCGCGCCAGAGCTCGCGCGC. However, the ten nt long spacing between two RSREs in Os03t0732000-00/HDR is relatively long, exceeding the border eight nt value. Therefore, the potential to induce CAMTAs dimerization should be taken carefully. Sequences of closely-spaced RSREs repetitions found in Zea mays CMS gene. are presented in Table 2.
Table 2. Sequences of closely-spaced RSREs repetitions found in Zea mays CMS gene. Sequences of RSREs are written in bold and underlined. Repeated RSREs sequence was fund also in Oryza sativa HDR gene. The distance between both RSREs in OsHDR is higher than the threshold eight nt value. Therefore, the putative induction of CAMTAs dimerization should be taken cautiously.
|
Nr |
Sequence of closely-spaced RSREs repetitions |
Gene ID/Name |
|
1 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T001/CMS |
|
2 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T005/CMS |
|
3 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T006/CMS |
|
4 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T007/CMS |
|
5 |
CCGCGCGCCAGAGCTCGCGCGC |
Os03t0732000-00/HDR |
- What if there is no space between the two RSRE cis element- any change in the binding of transcription factor. If this study has been done, then kindly cite the reference.
Answer:
If there is no spacing between RSREs, the CAMTAs dimerization putatively could not occur due to steric problems and the lack of proper interaction development between CG-1 domains of neighboring CAMTAs. These suggestions were not experimentally verified. However, the similar studies were done on plant ARFs trans-factors, following fragment was addend to the introduction section, page 2, marked in red.
The significance of spacer length between two TGTCNN ARFs cis-active motifs was studied in A. thaliana. Distribution of direct (DR), inverted (IR) or everted repeats (ER) of these sequences with spacing ranking from 0 to 10 nt was studied in 1500 nt long promoter region of each A. thaliana gene. Comparison with RNAseq and microarray studies showed that only IR8 and DR5 were associated with the responsiveness to auxin treatment [34].
- More insight needed in respect to the spacer sequence between the two RSRE cis element and MEP pathway genes respect to model plant.
Answer, following fragment was addend to the discussion section, page 5 and 6, marked in red:
Obtained results suggest that the seven nt long spacer sequences found between two CAMTAs cis-active sites in Z. mays MECPS1 and MECPS2 are different. Moreover, the seven nt spacer length in both genes is the same. Furthermore, they are within the scope of spacer length found in ARFs cis-active motifs, enabling the interaction of ARFs [34]. In the same way, the functional role could also play the TGGT linker between two CAMTAs cis-active sites, found within Zm00001d012197/CMS. However, the putative interaction mediated by the ten nt long linker in Os03t0732000-00/HDR could be too weak to support the CAMTAs dimerization. The significance of all linkers and their mutants for CAMTAs interaction with DNA and dimerization should be experimentally verified by yeast one-hybrid, pull-down and electrophoretic mobility shift assays. Moreover, the DNA-protein complexes should be analysed by NMR or X-ray crystallography studies to suport the putative functional significance of spacing within CAMTAs cis-active elements repetitions.
Author Response File:
Author Response.doc
Reviewer 2 Report
This manuscript reported an analysis of the presence of the RSRE motif in genes of the MEP pathway in several plant species. The repetition of the RSRE motif is not ubiquitous among plants. It would be interesting to understand the specific or common functions of the repetition of RSRE in different plant species. For the results, it would be more informative if there is a table to summarize the presence of the motif in the seven species analyzed. The author mentioned in the results that the motif was found in two maize MCS genes. However, there are seven sequences from Zm00001d051458_T001 to T007. Are these different alleles? The author need to clarify. There is also no motif found in 001 and 004. The author need to explain more of these sequences. There is also another gene Zm00001d017608, which could be a homolog. Maybe an alignment of these two MCS genes can be added. Also, the author used MCS and MES for the same gene, 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase. MCS was used more than MEC, maybe MEC can be changed to MCS. The name should be consistent throughout the whole manuscript.
There are some spelling errors.
L. 106 search is missing the a.
L. 114, proximal is missing the r.
L. 130, should be promoter.
Author Response
Responses to Reviewer 2 comments.
Dear Reviewer 2.
Thank you for your comments and the opportunity to correct the manuscript. Below are ans wers to your comments.
This manuscript reported an analysis of the presence of the RSRE motif in genes of the MEP pathway in several plant species. The repetition of the RSRE motif is not ubiquitous among plants. It would be interesting to understand the specific or common functions of the repetition of RSRE in different plant species.
- For the results, it would be more informative if there is a table to summarize the presence of the motif in the seven species analyzed. The author mentioned in the results that the motif was found in two maize MCS genes. However, there are seven sequences from Zm00001d051458_T001 to T007. Are these different alleles? The author need to clarify.
Answer:
Two tables (Table S1 and Table S2), summarizing properties of DNA sequences provided in the study were added; Moreover two tables (Table 1 and 2) summarizing observed repeated RSREs sequences and their linkers in MECPS and other MEP pathway genes were added to the manuscript.
Following fragment was added to the results section, page nr 4, marked in red. The old version of results section was mainly removed:
Analyses of Zm00001d051458 (MECPS1) were performed on promoters defined by PlantPAN3.0 database in relation to different transcripts of Zm00001d05145, described as Zm00001d05145T002-T008. Among observed sequences of RSREs (G/A/C)CGCG(C/G/T) and spacers, most often were noted ACGCGGACCGCAGCCGCGC (Zm00001d05145/MECPS1_T002, T005, T006, T007, T008). Sequence CCGCGCTACCGTTCCGCGT was observed only in Zm00001d05145_T003 (File S1, Table S1). In the other gene Zm00001d017608/MECPS2_T001 was found the different sequence CCGCGCCACGAATCCGCGC (Table S1). Although spacer sequences are different in two ZmMECPS1 and ZmMECPS2 genes, they are seven nt long in both of them. Moreover, they are localized in 5’UTR region of ZmMECPS 1 and 2 genes (File S1, Table S1). Sequences of closely-spaced RSREs repetitions within Zea mays MECPS genes are presented in Table 1.
Table 1. Sequences of closely-spaced RSREs repetitions found in Zea mays MECPS1 and MECPS2 genes. Sequences of RSREs are written in bold and underlined.
|
Nr |
Sequence of closely-spaced RSREs repetitions |
Gene ID/Name |
|
1 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T002/MECPS1 |
|
2 |
CCGCGCTACCGTTCCGCGT |
Zm00001d051458_T003/MECPS1 |
|
3 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T005/MECPS1 |
|
4 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T006/MECPS1 |
|
5 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T007/MECPS1 |
|
6 |
ACGCGGACCGCAGCCGCGC |
Zm00001d051458_T008/ MECPS1 |
|
7 |
CCGCGCCACGAATCCGCGC |
Zm00001d017608_T001/MECPS2 |
The closely spaced RSREs sequences of MEP pathway genes other than ZmMECPS1 and ZmMECPS2 were observed in Zm00001d012197/CMS (File S2, Table S2). The same sequence GCGCGCTGGTGCGCGC was noted in Zm00001d012197/CMS_T001, T005, T006, T007. The spacing is 4 nt (TGGT) that is much lower value as compared to ZmMECPS 1 and 2 genes (File S2, Table S2. These repetitions were localized in the proximal promoter, within 317 nt from the putative transcription start site. Moreover, the Os03t0732000-00/HDR gene contains CCGCGCGCCAGAGCTCGCGCGC. However, the ten nt long spacing between two RSREs in Os03t0732000-00/HDR is relatively long, exceeding the border eight nt value. Therefore, the potential to induce CAMTAs dimerization should be taken carefully. Sequences of closely-spaced RSREs repetitions found in Zea mays CMS gene. are presented in Table 2.
Table 2. Sequences of closely-spaced RSREs repetitions found in Zea mays CMS gene. Sequences of RSREs are written in bold and underlined. Repeated RSREs sequence was fund also in Oryza sativa HDR gene. The distance between both RSREs in OsHDR is higher than the threshold eight nt value. Therefore, the putative induction of CAMTAs dimerization should be taken cautiously.
|
Nr |
Sequence of closely-spaced RSREs repetitions |
Gene ID/Name |
|
1 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T001/CMS |
|
2 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T005/CMS |
|
3 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T006/CMS |
|
4 |
GCGCGCTGGTGCGCGC |
Zm00001d012197_T007/CMS |
|
5 |
CCGCGCGCCAGAGCTCGCGCGC |
Os03t0732000-00/HDR |
- There is also no motif found in 001 and 004. The author need to explain more of these sequences. There is also another gene Zm00001d017608, which could be a homolog. Maybe an alignment of these two MCS genes can be added.
Answer: following fragment was added to the results section, page nr 4, marked in red.
Analyses of Zm00001d051458 (MECPS1) were performed on promoters defined by PlantPAN3.0 database in relation to different transcripts of Zm00001d05145, described as Zm00001d05145T002-T008. Among observed sequences of RSREs (G/A/C)CGCG(C/G/T) and spacers, most often were noted ACGCGGACCGCAGCCGCGC (Zm00001d05145/MECPS1_T002, T005, T006, T007, T008). Sequence CCGCGCTACCGTTCCGCGT was observed only in Zm00001d05145_T003 (File S1, Table S1). In the other gene Zm00001d017608/MECPS2_T001 was found the different sequence CCGCGCCACGAATCCGCGC (Table S1).
Answer: Following fragment was added to the discussion section, page nr 6, marked in red.
According to the maize genome database Zm00001d05145/ MECPS1 and Zm00001d017608 MECPS2 are different MECPS genes, localised on chromosome nr 4 and 5. [55]. Results obtained for other plants suggest, that in the genome of Catharanthus roseus was found only one copy of MECPS gene, while the rubber tree (Hevea brasiliensis) has at least two copies [56,57].
Following three citations were added:
- Woodhouse MR, Cannon EK, Portwood JL 2nd, Harper LC, Gardiner JM, Schaeffer ML, Andorf CM. A pan-genomic approach to genome databases using maize as a model system. BMC Plant Biol. 2021 Aug 20;21(1):385. doi: 10.1186/s12870-021-03173-5
- Sando T, Takeno S, Watanabe N, Okumoto H, Kuzuyama T, Yamashita A, Hattori M, Ogasawara N, Fukusaki E, Kobayashi A. Cloning and characterization of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway genes of a natural-rubber producing plant, Hevea brasiliensis. Biosci Biotechnol Biochem. 2008 Nov;72(11):2903-17. doi: 10.1271/bbb.80387.
- Veau B, Courtois M, Oudin A, Chénieux JC, Rideau M, Clastre M. Cloning and expression of cDNAs encoding two enzymes of the MEP pathway in Catharanthus roseus. Biochim Biophys Acta. 2000 Dec 15;1517(1):159-63. doi: 10.1016/s0167-4781(00)00240-2.
- Also, the author used MCS and MES for the same gene, 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase. MCS was used more than MEC, maybe MEC can be changed to MCS. The name should be consistent throughout the whole manuscript for 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase gene or protein.
Answer: The abbreviation MECPS was used within the whole text and tables. This abbreviation will be more consistent with observed in databases.
- Comments on the Quality of English Language
There are some spelling errors.
- 106 search is missing the a.
- 114, proximal is missing the r.
- 130, should be promoter.
Answer: All mentioned typographical errors were corrected
Author Response File:
Author Response.doc
Round 2
Reviewer 2 Report
The manuscript was improved substantially. Some suggestions for writing.
1. There should not be an s in CAMTA in the phrase CAMTA dimerization. Please correct this throughout the manuscript.
2. 8 is missing in some Zm00001d05145. Please change them.
3. L.113. The sentence doesn't sound correct. For my understanding, an as is needed after noted.
4. L.115. The sentence should be written as "A different sequence, CCGCGCCACGAATCCGCGC, was found in the gene Zm00001d017608/MECPS2_T001".
5. L.126. lower value can be changed to less.
6. L.130. border can be changed to limit or threshold and of is needed after the word.
7. L. 135. fund should be found. of is needed after threshold and value can be deleted.
8. L.179. The sentence is confusing. Maybe it should be written like this, "The manuscript was improved substantially. Some suggestions for writing.
1. There should not be an s in CAMTA in the phrase CAMTA dimerization. Please correct this throughout the manuscript.
2. 8 is missing in some Zm00001d05145. Please change them.
3. L.113. The sentence doesn't sound correct. For my understanding, an as is needed after noted.
4. L.115. The sentence should be written as "A different sequence, CCGCGCCACGAATCCGCGC, was found in the gene Zm00001d017608/MECPS2_T001".
5. L.126. lower value can be changed to less.
6. L.130. border can be changed to limit or threshold and of is needed after the word.
7. L. 135. fund should be found. of is needed after threshold and value can be deleted.
8. L.179. The sentence is confusing. Maybe it should be written like this, "The TGGT linker between two CAMTA cis-active sites found within Zm00001d012197/CMS could also play the same role" if this was what the authors wanted to say.
9. L.182. CAMTA should not be plural here.
10. L.191. The sentence doesn't read correct. From my understanding, it can be written like this, "Results obtained for other plants suggest that only one copy of the MECPS gene in the genome of Catharanthus roseus was found, while rubber tree (Hevea brasiliensis) has at least two copies."
see above
Author Response
Dear Reviewer nr 2. Thank you very much for your comments. I correcetd manuscript according to your suggestions.
All suggestions presented below were addressed and all proposed changes were introduced into the manuscript :
- There should not be an s in CAMTA in the phrase CAMTA dimerization. Please correct this throughout the manuscript.
- . 8 is missing in some Zm00001d05145. Please change them.
3. L.113. The sentence doesn't sound correct. For my understanding, an as is needed after noted.
4. L.115. The sentence should be written as "A different sequence, CCGCGCCACGAATCCGCGC, was found in the gene Zm00001d017608/MECPS2_T001".
5. L.126. lower value can be changed to less.
6. L.130. border can be changed to limit or threshold and of is needed after the word.
7. L. 135. fund should be found. of is needed after threshold and value can be deleted.
8. L.179. The sentence is confusing. Maybe it should be written like this, "The manuscript was improved substantially. Some suggestions for writing.
1. There should not be an s in CAMTA in the phrase CAMTA dimerization. Please correct this throughout the manuscript.
2. 8 is missing in some Zm00001d05145. Please change them.
3. L.113. The sentence doesn't sound correct. For my understanding, an as is needed after noted.
4. L.115. The sentence should be written as "A different sequence, CCGCGCCACGAATCCGCGC, was found in the gene Zm00001d017608/MECPS2_T001".
5. L.126. lower value can be changed to less.
6. L.130. border can be changed to limit or threshold and of is needed after the word.
7. L. 135. fund should be found. of is needed after threshold and value can be deleted.
8. L.179. The sentence is confusing. Maybe it should be written like this, "The TGGT linker between two CAMTA cis-active sites found within Zm00001d012197/CMS could also play the same role" if this was what the authors wanted to say.
9. L.182. CAMTA should not be plural here.
10. L.191. The sentence doesn't read correct. From my understanding, it can be written like this, "Results obtained for other plants suggest that only one copy of the MECPS gene in the genome of Catharanthus roseus was found, while rubber tree (Hevea brasiliensis) has at least two copies."

