Occurrence of Fluoroquinolones and Sulfonamides Resistance Genes in Wastewater and Sludge at Different Stages of Wastewater Treatment: A Preliminary Case Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Sampling Sites
2.2. DNA Extraction
2.3. Identification of Aantibiotic Resistance Genes by Polymerase Chain Reaction (PCR)
2.4. Cluster Analysis
3. Results and Discussion
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Guo, J.; Li, J.; Chen, H.; Bond, P.L.; Yuan, Z. Metagenomic analysis reveals wastewater treatment plants as hotspots of antibiotic resistance genes and mobile genetic elements. Water Res. 2017, 123, 468–478. [Google Scholar] [CrossRef]
- Lye, Y.L.; Bong, C.W.; Lee, C.W.; Zhang, R.J.; Zhang, G.; Suzuki, S.; Chai, L.C. Anthropogenic impacts on sulfonamide residues and sulfonamide resistant bacteria and genes in Larut and Sangga Besar River, Perak. Sci. Total Environ. 2019, 688, 1335–1347. [Google Scholar] [CrossRef]
- WHO. WHO Report on Surveillance of Antibiotic Consumption: 2016–2018 Early Implementation; Licence: CC BY-NC-SA 3.0 IGO; World Health Organization: Geneva, Switzerland, 2018. [Google Scholar]
- Danner, M.C.; Robertson, A.; Behrends, V.; Reiss, J. Antibiotic pollution in surface fresh waters: Occurrence and effects. Sci. Total Environ. 2019, 664, 793–804. [Google Scholar] [CrossRef]
- Koniuszewska, I.; Korzeniewska, E.; Harnisz, M.; Kiedrzyńska, E.; Kiedrzyński, M.; Czatzkowska, M.; Jarosiewicz, P.; Zalewski, M. The occurrence of antibiotic-resistance genes in the Pilica River, Poland. Ecohydrol. Hydrobiol. 2020, 20, 1–11. [Google Scholar] [CrossRef]
- Xiong, W.; Sun, Y.; Ding, X.; Zhang, Y.; Zeng, Z. Antibiotic resistance genes occurrence and bacterial community composition in the Liuxi River. Front. Environ. Sci. 2014, 2, 1–6. [Google Scholar] [CrossRef]
- Andrade, L.; Kelly, M.; Hynds, P.; Weatherill, J.; Majury, A.; O’Dwyer, J. Groundwater resources as a global reservoir for antimicrobial-resistant bacteria. Water Res. 2020, 170, 115360. [Google Scholar] [CrossRef]
- Burke, V.; Richter, D.; Greskowiak, J.; Mehrtens, A.; Schulz, L.; Massmann, G.; Victoria, B.; Doreen, R.; Janek, G.; Anne, M.; et al. Occurrence of Antibiotics in Surface and Groundwater of a Drinking Water Catchment Area in Germany. Water Environ. Res. 2016, 88, 652–659. [Google Scholar] [CrossRef]
- Szekeres, E.; Chiriac, C.M.; Baricz, A.; Szőke-Nagy, T.; Lung, I.; Soran, M.-L.; Rudi, K.; Dragoş, N.; Coman, C. Investigating antibiotics, antibiotic resistance genes, and microbial contaminants in groundwater in relation to the proximity of urban areas. Environ. Pollut. 2018, 236, 734–744. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Valera, E.; Kyselková, M.; Ahmed, E.; Sladecek, F.X.J.; Goberna, M.; Elhottová, D. Native soil microorganisms hinder the soil enrichment with antibiotic resistance genes following manure applications. Sci. Rep. 2019, 9, 6760. [Google Scholar] [CrossRef] [PubMed]
- Forsberg, K.J.; Patel, S.; Gibson, M.K.; Lauber, C.L.; Knight, R.; Fierer, N.; Dantas, G. Bacterial phylogeny structures soil resistomes across habitats. Nature 2014, 509, 612–616. [Google Scholar] [CrossRef] [PubMed]
- Cycoń, M.; Mrozik, A.; Piotrowska-Seget, Z. Antibiotics in the Soil Environment—Degradation and Their Impact on Microbial Activity and Diversity. Front. Microbiol. 2019, 10, 338. [Google Scholar] [CrossRef]
- Lorenzo, P.; Adriana, A.; Jéssica, S.; Carles, B.; Marinella, F.; Marta, L.; Luis, B.J.; Pierre, S. Antibiotic resistance in urban and hospital wastewaters and their impact on a receiving freshwater ecosystem. Chemosphere 2018, 206, 70–82. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Wang, P.; Yang, Q. Occurrence and diversity of antibiotic resistance in untreated hospital wastewater. Sci. Total Environ. 2018, 621, 990–999. [Google Scholar] [CrossRef] [PubMed]
- Cacace, D.; Fatta-Kassinos, D.; Manaia, C.M.; Cytryn, E.; Kreuzinger, N.; Rizzo, L.; Karaolia, P.; Schwartz, T.; Alexander, J.; Merlin, C.; et al. Antibiotic resistance genes in treated wastewater and in the receiving water bodies: A pan-European survey of urban settings. Water Res. 2019, 162, 320–330. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Zhao, W.; Xu, T.; Zheng, B.; Yin, D. Occurrence and distribution of antibiotic resistance genes in the water and sediments of Qingcaosha Reservoir, Shanghai, China. Environ. Sci. Eur. 2019, 31, 1–9. [Google Scholar] [CrossRef]
- Osińska, A.; Korzeniewska, E.; Harnisz, M.; Felis, E.; Bajkacz, S.; Jachimowicz, P.; Niestępski, S.; Konopka, I. Small-scale wastewater treatment plants as a source of the dissemination of antibiotic resistance genes in the aquatic environment. J. Hazard. Mater. 2020, 381, 121221. [Google Scholar] [CrossRef]
- Sabri, N.A.; Schmitt, H.; Van Der Zaan, B.; Gerritsen, H.W.; Zuidema, T.; Rijnaarts, H.H.M.; Langenhoff, A.A.M. Prevalence of antibiotics and antibiotic resistance genes in a wastewater effluent-receiving river in the Netherlands. J. Environ. Chem. Eng. 2020, 8, 102245. [Google Scholar] [CrossRef]
- Stange, C.; Yin, D.; Xu, T.; Guo, X.; Schäfer, C.; Tiehm, A. Distribution of clinically relevant antibiotic resistance genes in Lake Tai, China. Sci. Total Environ. 2019, 655, 337–346. [Google Scholar] [CrossRef]
- Rizzo, L.; Manaia, C.M.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: A review. Sci. Total Environ. 2013, 447, 345–360. [Google Scholar] [CrossRef]
- Korzeniewska, E.; Harnisz, M. Relationship between modification of activated sludge wastewater treatment and changes in antibiotic resistance of bacteria. Sci. Total Environ. 2018, 639, 304–315. [Google Scholar] [CrossRef]
- Pazda, M.; Kumirska, J.; Stepnowski, P.; Mulkiewicz, E. Antibiotic resistance genes identified in wastewater treatment plant systems—A review. Sci. Total Environ. 2019, 697, 134023. [Google Scholar] [CrossRef] [PubMed]
- Jäger, T.; Hembach, N.; Elpers, C.; Wieland, A.; Alexander, J.; Hiller, C.; Krauter, G.; Schwartz, T. Reduction of Antibiotic Resistant Bacteria During Conventional and Advanced Wastewater Treatment, and the Disseminated Loads Released to the Environment. Front. Microbiol. 2018, 9, 2599. [Google Scholar] [CrossRef] [PubMed]
- Marano, R.B.M.; Cytryn, E. The Mobile Resistome in Wastewater Treatment Facilities and Downstream Environments. In Antimicrobial Resistance in Wastewater Treatment Processes; Keen, P.L., Fugère, R., Eds.; John Wiley & Sons, Inc. (Wiley): Hoboken, NJ, USA, 2017; pp. 129–155. [Google Scholar]
- Kaplan, E.; Ofek, M.; Jurkevitch, E.; Cytryn, E. Characterization of fluoroquinolone resistance and qnr diversity in Enterobacteriaceae from municipal biosolids. Front. Microbiol. 2013, 4, 144. [Google Scholar] [CrossRef] [PubMed]
- Minister of Economy. Internet System of Legal Acts. Available online: http://isap.sejm.gov.pl/isap.nsf/DocDetails.xsp?id=WDU20150001277 (accessed on 21 August 2020). (In Polish)
- Lee, J.; Shin, S.G.; Jang, H.M.; Kim, Y.B.; Lee, J.; Kim, Y.M. Characterization of antibiotic resistance genes in representative organic solid wastes: Food waste-recycling wastewater, manure, and sewage sludge. Sci. Total Environ. 2017, 579, 1692–1698. [Google Scholar] [CrossRef]
- Chen, Q.-L.; An, X.; Li, H.; Su, J.; Ma, Y.; Zhu, Y.-G. Long-term field application of sewage sludge increases the abundance of antibiotic resistance genes in soil. Environ. Int. 2016, 92, 1–10. [Google Scholar] [CrossRef]
- Gao, P.; Munir, M.; Xagoraraki, I. Correlation of tetracycline and sulfonamide antibiotics with corresponding resistance genes and resistant bacteria in a conventional municipal wastewater treatment plant. Sci. Total Environ. 2012, 421, 173–183. [Google Scholar] [CrossRef]
- Munir, M.; Xagoraraki, I. Levels of Antibiotic Resistance Genes in Manure, Biosolids, and Fertilized Soil. J. Environ. Qual. 2011, 40, 248–255. [Google Scholar] [CrossRef]
- Ma, Y.; Wilson, C.A.; Novak, J.T.; Riffat, R.; Aynur, S.; Murthy, S.; Pruden, A. Effect of Various Sludge Digestion Conditions on Sulfonamide, Macrolide, and Tetracycline Resistance Genes and Class I Integrons. Environ. Sci. Technol. 2011, 45, 7855–7861. [Google Scholar] [CrossRef]
- Yang, L.; Liu, W.; Zhu, D.; Hou, J.; Ma, T.; Wu, L.; Zhu, Y.; Christie, P. Application of biosolids drives the diversity of antibiotic resistance genes in soil and lettuce at harvest. Soil Biol. Biochem. 2018, 122, 131–140. [Google Scholar] [CrossRef]
- European Centre for Disease Prevention and Control (ECDC). Surveillance of Antimicrobial Resistance in Europe 2018; Annual report of the European Antimicrobial Resistance Surveillance Network (EARS-Net); ECDC: Stockholm, Sweden, 2018.
- Ruiz, J.; Pons, M.J.; Gomes, C. Transferable mechanisms of quinolone resistance. Int. J. Antimicrob. Agents 2012, 40, 196–203. [Google Scholar] [CrossRef]
- Wong, M.H.; Chan, E.W.; Liu, L.Z.; Chen, S. PMQR genes oqxAB and aac(6′)Ib-cr accelerate the development of fluoroquinolone resistance in Salmonella typhimurium. Front. Microbiol. 2014, 5, 521. [Google Scholar] [CrossRef] [PubMed]
- European Centre for Disease Prevention and Control (ECDC). Antimicrobial Consumption—Annual Epidemiological Report for 2018; ECDC: Stockholm, Sweden, 2019.
- Jiang, H.; Cheng, H.; Liang, Y.; Yu, S.; Yu, T.; Fang, J.; Zhu, C. Diverse Mobile Genetic Elements and Conjugal Transferability of Sulfonamide Resistance Genes (sul1, sul2, and sul3) in Escherichia coli Isolates From Penaeus vannamei and Pork From Large Markets in Zhejiang, China. Front. Microbiol. 2019, 10, 1787. [Google Scholar] [CrossRef]
- Hsu, J.T.; Chen, C.Y.; Young, C.W.; Chao, W.L.; Li, M.H.; Liu, Y.H.; Lin, C.M.; Ying, C. Prevalence of sulfonamide-resistant bacteria, resistance genes and integron-associated horizontal gene transfer in natural water bodies and soils adjacent to a swine feedlot in northern Taiwan. J. Hazard. Mater. 2014, 277, 34–43. [Google Scholar] [CrossRef] [PubMed]
- Yan, M.; Xu, C.; Huang, Y.; Nie, H.; Wang, J. Tetracyclines, sulfonamides and quinolones and their corresponding resistance genes in the Three Gorges Reservoir, China. Sci. Total Environ. 2018, 840–848. [Google Scholar] [CrossRef] [PubMed]
- Romańczuk, P.; Pieczykolan, M. Porównanie eksploatowanych ciągów technologicznych ściekowych na oczyszczalni ścieków Tychy–Urbanowice. Gaz Woda Tech. Sanit. 2006, 7-8, 49–53. [Google Scholar]
- Pei, R.; Kim, S.C.; Carlson, K.H.; Pruden, A. Effect of River Landscape on the sediment concentrations of antibiotics and corresponding antibiotic resistance genes (ARG). Water Res. 2006, 40, 2427–2435. [Google Scholar] [CrossRef]
- Li, J.; Wang, T.; Shao, B.; Shen, J.; Wang, S.; Wu, Y. Plasmid-Mediated Quinolone Resistance Genes and Antibiotic Residues in Wastewater and Soil Adjacent to Swine Feedlots: Potential Transfer to Agricultural Lands. Environ. Heal. Perspect. 2012, 120, 1144–1149. [Google Scholar] [CrossRef]
- Park, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of aac(6′)-Ib-cr Encoding a Ciprofloxacin-Modifying Enzyme. Antimicrob. Agents Chemother. 2006, 50, 3953–3955. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Boil. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- Kurasam, J.; Sihag, P.; Mandal, P.K.; Sarkar, S. Presence of fluoroquinolone resistance with persistent occurrence of gyrA gene mutations in a municipal wastewater treatment plant in India. Chemosphere 2018, 211, 817–825. [Google Scholar] [CrossRef]
- Osińska, A.; Harnisz, M.; Korzeniewska, E. Prevalence of plasmid-mediated multidrug resistance determinants in fluoroquinolone-resistant bacteria isolated from sewage and surface water. Environ. Sci. Pollut. Res. 2016, 23, 10818–10831. [Google Scholar] [CrossRef]
- Ziembińska-Buczyńska, A.; Felis, E.; Folkert, J.; Meresta, A.; Stawicka, D.; Gnida, A.; Surmacz-Górska, J. Detection of antibiotic resistance genes in wastewater treatment plant—Molecular and classical approach. Arch. Environ. Prot. 2015, 41, 23–32. [Google Scholar] [CrossRef]
- Wen, Y.; Pu, X.; Zheng, W.; Hu, G. High Prevalence of Plasmid-Mediated Quinolone Resistance and IncQ Plasmids Carrying qnrS2 Gene in Bacteria from Rivers near Hospitals and Aquaculture in China. PLoS ONE 2016, 11, e0159418. [Google Scholar] [CrossRef] [PubMed]
- Dong, P.; Wang, H.; Fang, T.; Wang, Y.; Ye, Q. Assessment of extracellular antibiotic resistance genes (eARGs) in typical environmental samples and the transforming ability of eARG. Environ. Int. 2019, 125, 90–96. [Google Scholar] [CrossRef] [PubMed]
- Tačić, A.; Nikolić, V.; Nikolić, L.; Savić, I. Antimicrobial sulfonamide drugs. Adv. Technol. 2017, 6, 58–71. [Google Scholar] [CrossRef]
- Gouvras, G. The European Centre for Disease Prevention and Control. Eurosurveillance 2004, 9, 2. [Google Scholar] [CrossRef]
- Koczura, R.; Mokracka, J.; Taraszewska, A.; Łopacinska, N. Abundance of Class 1 Integron-Integrase and Sulfonamide Resistance Genes in River Water and Sediment is Affected by Anthropogenic Pressure and Environmental Factors. Microb. Ecol. 2016, 72, 909–916. [Google Scholar] [CrossRef]
- Mohameda, H.S.A.; Uswege, M.; Robinson, H.M. Correlation between antibiotic concentrations genes contaminations at Mafisa wastewater treatment plant in Morogoro Municipality, Tanzania. Glob. Environ. Health Saf. 2018, 2, 5. [Google Scholar]
- Tao, C.-W.; Hsu, B.-M.; Ji, W.-T.; Hsu, T.-K.; Kao, P.-M.; Hsu, C.-P.; Shen, S.-M.; Shen, T.-Y.; Wan, T.-J.; Huang, Y.-L. Evaluation of five antibiotic resistance genes in wastewater treatment systems of swine farms by real-time PCR. Sci. Total Environ. 2014, 496, 116–121. [Google Scholar] [CrossRef]
- Szekeres, E.; Baricz, A.; Chiriac, C.M.; Farkas, A.; Opriş, O.; Soran, M.-L.; Andrei, A.Ş.; Rudi, K.; Balcázar, J.L.; Dragos, N.; et al. Abundance of antibiotics, antibiotic resistance genes and bacterial community composition in wastewater effluents from different Romanian hospitals. Environ. Pollut. 2017, 225, 304–315. [Google Scholar] [CrossRef]
- Gundogdu, A.; Long, Y.B.; Vollmerhausen, T.L.; Katouli, M. Antimicrobial resistance and distribution of sul genes and integron-associated intI genes among uropathogenic Escherichia coli in Queensland, Australia. J. Med. Microbiol. 2011, 60, 1633–1642. [Google Scholar] [CrossRef] [PubMed]
- Poey, M.E.; Azpiroz, M.F.; Laviña, M. On sulfonamide resistance, sul genes, class 1 integrons and their horizontal transfer in Escherichia coli. Microb. Pathog. 2019, 135, 103611. [Google Scholar] [CrossRef] [PubMed]
- Statistics Poland; Agriculture Department. Farm Animals in 2017. 2018. Available online: https://stat.gov.pl/files/gfx/portalinformacyjny/pl/defaultaktualnosci/5508/6/18/1/zwierzeta_gospodarskie_w_2017_roku.pdf (accessed on 2 July 2020).
- Fares, A. Factors Influencing the Seasonal Patterns of Infectious Diseases. Int. J. Prev. Med. 2013, 4, 128–132. [Google Scholar] [PubMed]
- Zachara, J.; Zachara, R.; Zachara, N.; Matuszczak, A.; Kłoda, K. The comparison of use of antibiotics due to acute respiratory infections in the rural population of primary care in 2010 and 2017. J. Educ. Health Sport 2019, 9, 70–83. [Google Scholar]
- Yan, L.; Liu, D.; Wang, X.-H.; Wang, Y.; Zhang, B.; Wang, M.; Xu, H. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China. Sci. Rep. 2017, 7, 40610. [Google Scholar] [CrossRef] [PubMed]
- Périchon, B.; Courvalin, P.; Galimand, M. Transferable Resistance to Aminoglycosides by Methylation of G1405 in 16S rRNA and to Hydrophilic Fluoroquinolones by QepA-Mediated Efflux in Escherichia coli. Antimicrob. Agents Chemother. 2007, 51, 2464–2469. [Google Scholar] [CrossRef] [PubMed]
- Yamane, K.; Wachino, J.-I.; Suzuki, S.; Kimura, K.; Shibata, N.; Kato, H.; Shibayama, K.; Konda, T.; Arakawa, Y. New Plasmid-Mediated Fluoroquinolone Efflux Pump, QepA, Found in an Escherichia coli Clinical Isolate. Antimicrob. Agents Chemother. 2007, 51, 3354–3360. [Google Scholar] [CrossRef]
- Martínez-Martínez, L.; Pascual, A.; Jacoby, G.A. Quinolone resistance from a transferable plasmid. Lancet 1998, 351, 797–799. [Google Scholar] [CrossRef]
- Eurostat. Sewage Sludge Production and Disposal from Urban Wastewater (in Dry Substance (d.s)). Dataset [Tables], Product Code: Ten00030, Updated on 31 Jan 2020. Available online: http://ec.europa.eu/eurostat/tgm/table.do?tab=table&plugin=1&language=en&pcode=ten00030 (accessed on 2 July 2020).
- Nair, C.G.; Chao, C.; Ryall, B.; Williams, H.D. Sub-lethal concentrations of antibiotics increase mutation frequency in the cystic fibrosis pathogen Pseudomonas aeruginosa. Lett. Appl. Microbiol. 2013, 56, 149–154. [Google Scholar] [CrossRef]
- Kohanski, M.A.; Depristo, M.A.; Collins, J.J. Sublethal Antibiotic Treatment Leads to Multidrug Resistance via Radical-Induced Mutagenesis. Mol. Cell 2010, 37, 311–320. [Google Scholar] [CrossRef]
- Giebułtowicz, J.; Nałęcz-Jawecki, G.; Harnisz, M.; Kucharski, D.; Korzeniewska, E.; Płaza, G. Environmental Risk and Risk of Resistance Selection Due to Antimicrobials’ Occurrence in Two Polish Wastewater Treatment Plants and Receiving Surface Water. Molecules 2020, 25, 1470. [Google Scholar] [CrossRef] [PubMed]
- European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters Version 9.0, Valid from 1 January 2019. Available online: https://korld.nil.gov.pl/pdf/EUCAST_breakpoints_tlumaczenie_wersja%209.0_strona.pdf (accessed on 2 July 2020). (in Polish)
- Bengtsson-Palme, J.; Larsson, D.G.J. Concentrations of antibiotics predicted to select for resistant bacteria: Proposed limits for environmental regulation. Environ. Int. 2016, 86, 140–149. [Google Scholar] [CrossRef]
- Rowe, W.P.M.; Baker-Austin, C.; Verner-Jeffreys, D.W.; Ryan, J.J.; Micallef, C.; Maskell, D.J.; Pearce, G.P. Overexpression of antibiotic resistance genes in hospital effluents over time. J. Antimicrob. Chemother. 2017, 72, 1617–1623. [Google Scholar] [CrossRef] [PubMed]
- Ju, F.; Beck, K.; Yin, X.; Maccagnan, A.; McArdell, C.S.; Singer, H.P.; Johnson, D.R.; Zhang, T.; Bürgmann, H. Wastewater treatment plant resistomes are shaped by bacterial composition, genetic exchange, and upregulated expression in the effluent microbiomes. ISME J. 2019, 13, 346–360. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Klümper, U.; Liu, Y.; Yang, Y.; Wei, Q.; Lin, J.-G.; Gu, J.-D.; Li, M. Metagenomic and metatranscriptomic analyses reveal activity and hosts of antibiotic resistance genes in activated sludge. Environ. Int. 2019, 129, 208–220. [Google Scholar] [CrossRef] [PubMed]
| Region of Silesia (S-WWTP)* (n = 18) | Region of Warmia and Mazury (WM-WWTP)** (n = 18) | |||
|---|---|---|---|---|
| Type of Sample | Symbol | Type of Sample | Symbol | |
| Liquid samples from WWTPs | Untreated wastewater | S1 | Untreated wastewater | W1 |
| Wastewater from the outlet of the primary clarifier | S2 | Wastewater from the outlet of the primary clarifier | W2 | |
| Wastewater from the outlet of the secondary clarifier | S3 | Wastewater in the biological chamber | W3 | |
| Wastewater from the outlet of the C-TECH reactor | S4 | Wastewater from the outlet of the multipurpose reactor | W4 | |
| Treated wastewater | S5 | Treated wastewater | W5 | |
| Solid samples from WWTPs | Sludge from the outlet of the mechanical concentrator | S6 | Sludge from the outlet of the open fermentation pool | W6 |
| Sludge from the outlet of the gravity concentrator | S7 | Treated sludge | W7 | |
| River water | River water upstream the effluent discharge point | S8 | River water upstream the effluent discharge point | W8 |
| River water downstream the effluent discharge point | S9 | River water downstream the effluent discharge point | W9 | |
| Target Gene | Primer Sequence (5′-3′) | Amplicon Size (bp) | PCR Annealing Temp (°C) | References |
|---|---|---|---|---|
| sul1 | CGCACCGGAAACATCGCTGCAC | 163 | 55.9 | [41] |
| TGAAGTTCCGCCGCAAGGCTCG | ||||
| sul2 | TCCGGTGGAGGCCGGTATCTGG | 191 | 60.8 | |
| CGGGAATGCCATCTGCCTTGAG | ||||
| qepA | CCAGCTCGGCAACTTGATAC | 570 | 58 | [42] |
| ATGCTCGCCTTCCAGAAAA | ||||
| aac(6′)-Ib-cr | TTGCGATGCTCTATGAGTGGCTA | 482 | 55 | [43] |
| CTCGAATGCCTGGCGTGTTT |
| Symbol | sul1 | sul2 | qepA | aac(6′)-Ib-cr | |||||
|---|---|---|---|---|---|---|---|---|---|
| Summer | Fall | Summer | Fall | Summer | Fall | Summer | Fall | ||
| S-WWTP * | S1 | + | + | + | + | + | + | + | + |
| S2 | + | + | + | + | − | + | + | + | |
| S3 | + | + | + | − | − | + | + | + | |
| S4 | + | + | + | − | − | − | + | + | |
| S5 | + | + | + | − | − | + | + | + | |
| S6 | + | + | − | + | − | − | + | + | |
| S7 | + | + | + | + | + | + | + | + | |
| S8 | + | + | − | + | − | − | + | + | |
| S9 | + | + | − | + | − | − | + | + | |
| WM-WWTP ** | W1 | + | + | + | + | + | + | + | + |
| W2 | + | + | + | + | + | + | + | + | |
| W3 | + | + | + | + | − | + | + | + | |
| W4 | + | + | + | + | + | − | + | + | |
| W5 | + | + | + | − | + | + | + | + | |
| W6 | + | + | + | + | − | − | + | + | |
| W7 | + | + | + | + | + | − | + | + | |
| W8 | + | + | − | − | − | − | + | + | |
| W9 | + | + | + | − | − | + | + | + | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rolbiecki, D.; Harnisz, M.; Korzeniewska, E.; Jałowiecki, Ł.; Płaza, G. Occurrence of Fluoroquinolones and Sulfonamides Resistance Genes in Wastewater and Sludge at Different Stages of Wastewater Treatment: A Preliminary Case Study. Appl. Sci. 2020, 10, 5816. https://doi.org/10.3390/app10175816
Rolbiecki D, Harnisz M, Korzeniewska E, Jałowiecki Ł, Płaza G. Occurrence of Fluoroquinolones and Sulfonamides Resistance Genes in Wastewater and Sludge at Different Stages of Wastewater Treatment: A Preliminary Case Study. Applied Sciences. 2020; 10(17):5816. https://doi.org/10.3390/app10175816
Chicago/Turabian StyleRolbiecki, Damian, Monika Harnisz, Ewa Korzeniewska, Łukasz Jałowiecki, and Grażyna Płaza. 2020. "Occurrence of Fluoroquinolones and Sulfonamides Resistance Genes in Wastewater and Sludge at Different Stages of Wastewater Treatment: A Preliminary Case Study" Applied Sciences 10, no. 17: 5816. https://doi.org/10.3390/app10175816
APA StyleRolbiecki, D., Harnisz, M., Korzeniewska, E., Jałowiecki, Ł., & Płaza, G. (2020). Occurrence of Fluoroquinolones and Sulfonamides Resistance Genes in Wastewater and Sludge at Different Stages of Wastewater Treatment: A Preliminary Case Study. Applied Sciences, 10(17), 5816. https://doi.org/10.3390/app10175816

