Next Article in Journal
Molecular Evidence of the Role of the Red Fox (Vulpes vulpes) in the Epidemiology of Ungulate-Related Sarcocystis Species in Croatia, Lithuania, and Portugal
Previous Article in Journal
Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 16
Issue 4
10.3390/ani16040537
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport

by
Jingjing Wang
1,
Ming Yuan
1,
Hao Yang
1,
Jun Mei
1,2,3,4,* and
Jing Xie
1,2,3,4,*
1
College of Food Science and Technology, Shanghai Ocean University, Shanghai 201306, China
2
National Experimental Teaching Demonstration Center for Food Science and Engineering, Shanghai Ocean University, Shanghai 201306, China
3
Shanghai Engineering Research Center of Aquatic Product Processing and Preservation, Shanghai 201306, China
4
Key Laboratory of Aquatic Products High-Quality Utilization, Storage and Transportation (Co-Construction by Ministry and Province), Ministry of Agriculture and Rural Affairs, Shanghai 201306, China
*
Authors to whom correspondence should be addressed.
Animals 2026, 16(4), 537; https://doi.org/10.3390/ani16040537
Submission received: 11 December 2025 / Revised: 2 February 2026 / Accepted: 5 February 2026 / Published: 9 February 2026
(This article belongs to the Section Animal Welfare)
Browse Figures
Versions Notes

Simple Summary

The biggest challenge in long-distance transport of fish is the high mortality rate caused by stress and oxidative damage. This study aimed to investigate and evaluate the effects of Ocimum basilicum essential oil (OBEO) on oxidative stress, immunity, inflammatory response, and intestinal microbiota and metabolism of yellow croaker during simulated transport. The large yellow croakers were placed in a 5 mg/L OBEO solution and a control solution (0 mg/L OBEO) for 72 h. The results of this study showed that the samples treated with OBEO exhibited higher antioxidant and anti-inflammatory capabilities.

Abstract

Ocimum basilicum essential oil (OBEO) is an effective anesthetic and sedative for large yellow croaker (Larimichthys crocea) during live transport. This study aimed to assess the impact of OBEO on various physiological and biochemical parameters during live transport, thereby enhancing animal welfare and survival. Fish were exposed to 0 and 5 mg/L OBEO for 72 h during transport. Blood and liver samples were collected every 12 h after transport to evaluate blood biochemistry, tissue damage, oxidative stress-related and inflammation-related gene expression, intestinal microbiota, and liver metabolomics. The results demonstrated that the OBEO treatment significantly reduced serum cortisol levels and heat shock protein 70 (p < 0.05) while increasing the activity of liver antioxidant enzymes in large yellow croakers. Furthermore, compared to the control group, the expression of genes related to oxidative stress and inflammation was upregulated (p < 0.05), thereby enhancing the antioxidant and anti-inflammatory capacities of the fish. Microscopic examination of gill tissues revealed that OBEO alleviated morphological damage. Additionally, OBEO treatment altered the composition of intestinal microbiota, which contributed to the regulation of inflammatory responses. Moreover, liver metabolomics analysis identified key metabolic pathways, including arachidonic acid metabolism, steroid hormone biosynthesis, and amino acid metabolism, which could mitigate liver damage and enhance antioxidant and immune functions. In conclusion, OBEO effectively reduces transport stress in large yellow croakers through physiological, molecular, and metabolic mechanisms, providing a promising strategy to improve animal welfare and survival rate during live transport.

Graphical Abstract

1. Introduction

The large yellow croaker (larimichthys crocea) is a commercially important marine fish species in China, valued in markets for its delicate flavor and high nutritional content, particularly its richness in proteins and unsaturated fatty acids [1]. However, the poor resilience of large yellow croakers during culture and transport seriously influences growth performance and survival. Simulated transport stress, caused by excessive transport density and deteriorating water quality, can lead to metabolic dysregulation and physiological damage in fish, resulting in increased mortality [2]. Live fish command a premium market value compared to frozen fresh fish. Nevertheless, live large yellow croakers are rarely available in the market, primarily due to their timid nature and high stress susceptibility. Studies have shown that these characteristics result in elevated mortality for large yellow croakers during transport [3].
Transport stress activates the hypothalamic–pituitary–interrenal (HPI) axis, resulting in the production of cortisol (COR) [4], a primary stress hormone that induces a series of secondary stress responses, including changes in energy metabolism, blood composition, and immune function [5]. An increase in the COR level can lead to excessive accumulation of reactive oxygen species (ROS), thereby triggering oxidative stress. The enzymatic antioxidant systems represented by superoxide dismutase (SOD), cata-lase (CAT), and glutathione peroxidase (GPX) are activated, serving as the main defense line for eliminating ROS [6]. Additionally, malondialdehyde (MDA) serves as a well-established marker of lipid peroxidation that reflects the extent of oxidative damage to cell membranes [7]. However, persistent oxidative stress causes a comprehensive decline in the innate and adaptive immune functions of the body and leads to excessive activation of the inflammatory system, thereby disrupting the balance of inflammatory-related genes, including toll-like receptor 3 (tlr-3), tumor necrosis factor-α (tnf-α), and nuclear factor κB (nf-κb), and ultimately triggering an inflammatory response [8]. In addition, the excessive accumulation of ROS can further regulate the secretion of immune and inflammatory-related cytokines such as interleukin-6 (il-6) and interleukin-1β (il-1β) by activating signaling pathways such as nf-κb, exacerbating the inflammatory process [9]. The liver plays a central role in regulating energy metabolism, maintaining energy homeostasis through the dynamic modulation of glycolipid metabolism. Hepatic enzymes such as aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are key biomarkers of liver function. Among them, ALT is particularly liver-specific and serves as an indicator of liver damage, while AST can also reflect the occurrence of hepatic impairment [10]. The fish’s immune system relies heavily on non-specific immunity. To evaluate non-specific immune response, the activities of acid phosphatase (ACP), alkaline phosphatase (AKP), and lysozyme (LZM) are commonly measured. An increase in their activities helps enhance the body’s defense against pathogens [11]. Immunoglobulin M (IgM) is critical for the humoral immune response, thus making serum IgM levels a key indicator of immune status [12]. In addition, heat shock protein 70 (HSP70) is a sensitive stress marker in fish, remaining stable under normal conditions but increasing during stress to protect tissues [13]. This regulatory mechanism can help large yellow croakers resist environmental stressors such as oxidative stress, pathogen infection, and inflammatory stimulation, maintaining a normal, healthy state. The related physiological and molecular changes determine the adaptability of yellow croakers in stressful environments.
Fish gills serve an important role in gas exchange and various physiological functions, including acid–base balance, ion regulation, and nitrogenous waste excretion [14]. Their extensive surface area and direct contact with the water medium make them sensitive indicators of environmental challenge. The activity of Na+/K+-ATPase (NKA) in gill tissues is a key marker for osmoregulatory function, with transport-induced disturbances often leading to significant alterations in its enzymatic activity [15].
In addition to traditional physiological parameters, the intestinal flora has emerged as a key mediator of host health. Its composition and diversity are known to shift in response to environmental stressors, affecting nutrient absorption, immune function, and inflammatory status [16]. To further elucidate the metabolic disruptions induced by transport stress, metabolomic approaches provide a valuable tool for characterizing global changes in small-molecule metabolites [17], thereby providing a comprehensive view of physiological adaptations and potential dysregulation.
Currently, strategies to mitigate the adverse impacts of transport stress on fish typically involve the addition of anesthetics or anti-stress agents to the transport water. MS-222, a synthetic anesthetic, is the most commonly used for fish transport, although it poses a potential risk of residue accumulation [18]. Recently, plant essential oils have been explored as alternatives to synthetic anesthetics due to their natural composition and higher safety profile.
Basil (Ocimum basilicum L.), native to Asia and Africa, belongs to the genus Ocimum in the Lamiaceae family [19]. The main components of Ocimum basilicum essential oil (OBEO) are geraniol, linalool, eucalyptol, etc. [20]. OBEO has demonstrated sedative and anesthetic effects on various fish species, with some studies indicating that its inclusion in transport water can alleviate stress responses in species such as tambaqui [21] and catfish [22]. Research has shown that adding OBEO to transport water significantly reduces glucose (GLU) levels and lactate dehydrogenase activity in the serum of grouper fish, thereby decreasing their energy metabolism [20]. However, limited studies have investigated the effects of OBEO on alleviating transport stress in large yellow croakers. Distinct from existing research, this study not only evaluates the impacts of OBEO on survival rates, gill tissue morphology, and the expression of immunometabolism-related genes in large yellow croakers but also innovatively adopts a comprehensive analytical approach integrating physiological and biochemical indicators, intestinal microbiota, and liver metabolomics. By clarifying the cross-level regulatory mechanisms underlying OBEO-mediated stress mitigation, this study aims to provide theoretical support for the development of novel anesthetic strategies that enhance survival rates and animal welfare during live transport.

2. Materials and Methods

2.1. Fish and OBEO

Large yellow croakers (age: 8 months, weight: 500 ± 50 g, n = 180) were acquired from the aquaculture base of Shanghai Luchao Port. All the fish were acclimatized to the experimental conditions for 2 weeks in a 700 L polyethylene aquarium filled with seawater. Prior to the simulated transport experiment, the fish were fasted for 24 h, which was maintained until the end of the 72 h experiment. The temperature was maintained at 20 °C, the salinity was kept at 20 ‰, and the dissolved oxygen (DO) concentration exceeded 7.0 mg/L.
OBEO was obtained from Chunziyu Trading Company in Chongqing (Chongqing, China). The composition of OBEO was analyzed according to our previous publication. Its primary components were linalool (37.49%), isoeugenol (26.66%), and dihydroanethole (20.17%), and the lesser compounds were caryophyllene (6.03%), anethole (3.64%), dl-Limonene (2.23%), and acetyleugenol (1.19%) [20].

2.2. Experimental Design

Based on the behavioral characteristics after anesthesia induction, and consistent with the criteria proposed by Woody et al. [23], the optimal concentration of OBEO was selected to achieve the effect of deep anesthesia. Supplementary Material File S1 presents both the behavioral characteristics of large yellow croakers during anesthesia and the results of the preliminary experiment that determined the 5 mg/L OBEO concentration for the experimental group. For the formal trial, the fish exposed to 5 mg/L OBEO constituted the experimental group, whereas untreated fish maintained in transport water served as the control (CK) group. According to the Chinese National Standard (GB/T 27638-2011 [24]), which sets a fish-to-water mass ratio of 1:4, the large yellow croakers were randomly placed into two separate 108 L insulated transport boxes. One group was exposed to transport water containing pre-emulsified OBEO (the experimental group), while the other group was exposed to transport water without OBEO (CK group) [25]. The simulated transport was 72 h, which was conducted using an orbital shaker (Changzhou, China) at a constant speed of 70 rpm to mimic vibrational stress. The water parameters were the same as those of the temporary rearing condition. During the whole process, the transport box was continuously inflated. Each group consisted of 30 experimental fish, and each group was set up with three parallel trials, totaling 180 fish for the study. The survival rate of the large yellow croakers was calculated using the specified formula and recorded at 12 h intervals throughout the experimental period [26].
survival   rate = S u r v i v a l   n u m b e r S a m p l e   n u m b e r × 100 %

2.3. Sample Collection

At each designated sampling time point (0, 12, 24, 36, 48, 60, and 72 h) during the simulated transport, 3 fish were randomly selected from each treatment group. The selected fish were then anesthetized using 200 mg/L MS-222 prior to sample collection [27]. Fish blood was collected with a 5 mL syringe without an anticoagulant, and then centrifuged at 5000× g for 15 min at 4 °C. The supernatant (serum) was collected and immediately stored at −80 °C until subsequent biochemical analysis. After blood samples were collected, the liver, intestine, and second gill were rinsed in 0.85% saline to remove the blood from their surfaces, and the liver and intestine samples were then quickly frozen in liquid nitrogen and placed at −80 °C.

2.4. Water Quality Parameters

DO was measured using a DO meter (JPB-607 A, Shanghai, China), and total ammonia nitrogen (TAN) was measured using a spectrophotometer. The principle is that ammonia or ammonium ions react with Nessler’s reagent under alkaline circumstances to form a brown-colored complex [28]. The wavelength of 420 nm was used for measurement. pH was measured using a pH meter (PHBJ-261 L, Shanghai, China).

2.5. Biochemical Analysis

Using commercial kits, the oxidative enzymes and energy metabolism indicators in the liver of the large yellow croakers, as well as the immune and related indicators in the serum, were determined. The indicators were measured by spectrophotometry. The kits used for each measurement and their catalog numbers and wavelengths are as follows: SOD (BC5165), 450 nm; CAT (BC0205), 240 nm; GPX (A005-1-2), 412 nm; MDA (BC0025), 532 nm and 600 nm; glycogen (GLY) (BC0345), 620 nm; GLU (A154-1-1), 505 nm; lactic acid (LD) (A019-2-1), 530 nm; triglyceride (TG) (A110-1-1), 500 nm; AST (BC1565), 505 nm; (ALT) (BC1555), 505 nm; ACP (BC2135), 510 nm; AKP (BC2145), 510 nm; LZM (A050-1-1), 530 nm; and NKA (A070-2), 636 nm. Fish HSP70 (H264-2-1), COR (H094-1-2), and IgM (H109-1-1) levels were measured using the antibody–antigen–enzyme–antibody complex, and the absorbance was measured at 450 nm [29]. The Coomassie brilliant blue method was used to quantify the amount of soluble protein [30]. Liver tissues were used for the determination of oxidative stress markers (SOD, CAT, GPX, and MDA), energy metabolism parameters (GLU, GLY, TG, and LD), and metabolic enzyme activities (AST, ALT, ACP, and AKP). Gill tissues were specifically analyzed for NKA activity, while serum samples were utilized for immune and stress indicators (LZM, IgM, HSP70, and COR). SOD, CAT, MDA, GLY, AST, ALT, ACP, and AKP kits were acquired from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China), whereas GPX, GLU, TG, LD, LZM, IgM, HSP70, and COR kits were acquired from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The assays were run in triplicate. To guarantee data accuracy and repeatability, all assays were carried out strictly in compliance with the manufacturers’ instructions. The detailed information of the kits can be found in Supplementary Material File S1 [14,31,32,33,34,35,36,37,38,39,40].

2.6. Observation of Gill Morphology

The gills were fixed with 4% paraformaldehyde for 24 h. They were then dehydrated using a gradient of ethanol solutions, transitioned in xylene, embedded in paraffin, sectioned at 7–10 µm, and stained with hematoxylin–eosin before being observed under a light microscope (Nikon Eclipse, Nikon Corporation, Minato-ku, Tokyo, Japan), and the specific method of light microscope was referred to Mahjoubian et al. [41]. The gills were fixed in 2.5% glutaraldehyde for 24 h and then rinsed three times with 0.1 mol/L phosphate buffer (pH = 7.4). After 15 min of gradient elution with 30%, 50%, 70%, 80%, 90%, and 100% ethanol, ethanol was replaced with isoamyl acetate, and then the sample was placed in a vacuum freeze dryer for 48 h. The morphology of the gill tissue samples was observed by a Hitachi SU5000 scanning electron microscope (SEM), and the specific method of SEM was referred to Dar et al. [42]. The degree and range of change were then used to determine the severity score: (−) no histopathology; (+) <20% histopathology in the visual field; (++) 20–60% histopathology in the visual field; and (+++) >60% histopathology in the visual field [43].

2.7. RNA Extraction, Reverse Transcription (RT), and Real Time-Quantitative Polymerase Chain Reaction (RT-qPCR)

Total RNA was extracted from the liver using a commercial kit from Kangwei Century Biotechnology (Taizhou, Jiangsu, China). A NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Shanghai, China) was used to measure the absorbance at 260 and 280 nm in order to determine the purity of each sample. The RNA A260/280 ratio was determined to be between 1.9 and 2.1. The cDNA was synthesized and detected by RT-qPCR using the kit according to guidelines. Primer sequences for amplification and gene expression analysis are provided in Table 1. The real-time PCR conditions are shown in Table 2. Each assay was repeated three times, with gapdh as a reference gene, and the 2−ΔΔCT method was used to calculate relative mRNA expression [14]. There was no significant difference in the cycle threshold (Ct) values of gapdh in the CK and OBEO groups. The verification data is provided in Supplementary Material File S1.

2.8. Intestinal Flora Analysis

Sample DNA was isolated using the extraction protocol of Zhang et al. [44], followed by concentration measurement. The quality of the DNA was evaluated using 1.2% agarose gel electrophoresis. Primers 319F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) were used to amplify the bacterial 16S rRNA V3-V4 region. The Deng et al. methodology was followed in order to validate the PCR amplification products [45]. Only samples with a 260/280 ratio between 1.8 and 2.0 and no signs of degradation were used for downstream sequencing. The Illumina MiSeq platform was then used by Suzhou Panomix (Suzhou, China) to sequence the PCR results. Using a pre-trained Naive Bayes classifier in QIIME2 s 2 software (2024.10), species annotation was carried out for every representative sequence of an operational taxonomic unit (OTU) or Amplicon sequence variant (ASV). Based on high-quality sequencing data, noise removal and sequence refinement were performed using the DADA2 algorithm to denoise raw reads and filter out low-abundance sequences (≤5 reads). The resulting ASVs were used for downstream analyses. ASV abundance and alpha diversity indices were computed to assess QIIME2 s species richness and evenness within samples, and shared and unique ASVs across samples or groups were compared to reveal compositional similarities and differences.

2.9. Metabolomic Analysis

Liver tissue samples (50 mg) were homogenized in a 2 mL centrifuge tube. Proteins were then precipitated by adding 1000 µL of tissue extraction solution (75% methanol: chloroform, 9:1 v/v; 25% H2O), followed by vortexing and centrifugation. The supernatant was collected and dried under a gentle nitrogen stream. The dried metabolites were reconstituted in a suitable solvent (50% acetonitrile) for LC-MS analysis. The specific method can be referred to Chen et al. [46]. The 80% criterion was used to eliminate missing values from numerical matrices from the library search, and variables with relative deviations greater than 30% in quality control (QC) samples were not included in additional analysis. Principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) of the preprocessed numerical matrices were used to examine sample variability using R’s ropls package (version 1.6.2). The KEGG database was used to further annotate differential metabolites for metabolic pathways. Python’s scipy.stats package (version1.13.0) was used to conduct pathway enrichment analysis.

2.10. Statistical Analysis

The statistical program SPSS version 21.0 (IBM Corp., New York, NY, USA) was used to analyze the data. All data verified the assumptions of normality (using the Shapiro–Wilk test) and homoscedasticity (using Levene’s test) prior to running the ANOVA. Two-way analysis of variance (ANOVA) was used to statistically examine the parameters in order to identify major effects and the interaction between time and treatment (Supplementary Material File S1). Data are presented as mean ± standard deviation (SD) (n = 3). Significant differences were found between different lowercase words (p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant. Microsoft Excel 2021 (Microsoft Corp., Washington, DC, USA) was used for data processing, while graphical representations were created with Origin 2022 (OriginLab Corp., Northampton, MA, USA).

3. Results

3.1. Survival Rate and Water Quality Parameters

Table 3 presents the survival rates during transport, while Figure 1 shows the water quality parameters during transport. During the transport simulation, the OBEO group maintained 100% survival throughout the experimental period. In contrast, the CK group exhibited a time-dependent decline in survival, reaching 86.66% by 60 h and 83.33% by 72 h. DO showed a decreasing trend, while TAN concentration increased over time. In the CK group, DO decreased significantly compared with the OBEO group, and the TAN level increased significantly compared with the OBEO group (p < 0.05). During the transport process, the pH value remained between 7.0 and 7.7, showing a downward trend. Compared with the CK group, the fluctuation range of the OBEO group was significantly smaller (p < 0.05).

3.2. Energy Metabolism and Liver Tissue Damage

Figure 2 shows the parameters related to energy metabolism and liver tissue damage in large yellow croakers during live transport. The levels of GLY decreased significantly over time, while GLU levels increased (p < 0.05). In the OBEO group, the GLU level was lower than that in the CK group. The LD level increased slowly at the beginning of the transport process, and then sharply elevated after 36 h. The increase rate of the OBEO group was slower compared to the CK group. TG levels decreased over time, and the OBEO group maintained higher TG levels than the CK group. AST and ALT levels were elevated during the early transport phase, peaking at 24 h. The OBEO group exhibited a smaller increase in AST and ALT than the CK group at 12 and 24 h (p < 0.05). After 24 h, there was no significant difference in AST levels between the CK group and the OBEO group. However, at 72 h, AST levels in the OBEO group were significantly higher than those in the CK group (p < 0.05). After 24 h, the ALT levels decreased over time, but the ALT levels in the CK group were higher than those in the OBEO group (p < 0.05).

3.3. Immune Metabolism and Serum Biochemistry

Figure 3 presents immune-related metabolic parameters and serum biochemistry indicators of large yellow croakers subjected to OBEO treatment during live transport. This study showed elevated ACP and AKP levels in the liver. However, AKP activity in the OBEO group was significantly lower than that in the CK group (p < 0.05). LZM activity in serum initially increased and then decreased, with significantly higher activity observed in the OBEO group compared to the CK group (p < 0.05). Serum IgM levels were significantly higher in the OBEO group (p < 0.05). Serum COR levels increased during the early transport phase, followed by a subsequent decrease. Furthermore, the OBEO group exhibited significantly lower COR levels compared to the CK group. Serum HSP70 levels increased throughout transport, with the CK group exhibiting significantly higher levels than the OBEO group (p < 0.05).

3.4. Oxidative Stress

Figure 4 presents the oxidative stress parameters in large yellow croakers during live transport with OBEO treatment. In this study, SOD, CAT, and GPX activities in the liver exhibited an increasing trend during early transport stages. However, SOD, CAT, and GPX activities gradually decreased over time during later transport stages (p < 0.05). The activities of SOD, CAT, and GPX in the OBEO group were higher than those in the CK group (p < 0.05). MDA levels in the liver exhibited a time-dependent increase; however, in the OBEO group, liver MDA levels increased more slowly than in the CK group (p < 0.05).

3.5. Morphological Analysis of Gill Tissue

Figure 5 shows the parameters related to gill tissue in large yellow croakers during transport with OBEO treatment. Gills’ NKA activity typically exhibited an initial increase and then a gradual decrease during live transport (p < 0.05). Compared with the CK group, the addition of OBEO significantly reduced NKA activity (p < 0.05). Consistent findings were observed through both SEM and light microscopy. In the light microscope image, some damage had occurred to the gills, including gill filaments folding, epithelial cell proliferation, and lumens formation. Before transport (0 h), the gill filaments in the CK group were wide and structurally intact, but after 36 h, they exhibited folding, collapse, and contraction. In contrast, the OBEO group showed only slight contraction. After 72 h, the CK group displayed fused secondary epithelial layers and an increase in mitochondria-rich cells. Notably, mucus cells were more in the CK group than in the OBEO group. In the SEM image, after 72 h of live transport, large yellow croakers in the OBEO group displayed only slight gill folding, while the CK group exhibited severe contraction and deformation. Semi-quantitative assessment of gill morphology showed that OBEO treatment markedly reduced the severity of tissue damage (Figure 5).

3.6. Expression of Antioxidant-Related Genes

Figure 6 presents the parameters related to antioxidant-related gene expressions in large yellow croakers during live transport. With the prolonged transport time, hepatic expression of antioxidant genes (e.g., sod, cat, and gpx) initially increased but subsequently declined. Compared to the CK group, the OBEO group showed significantly elevated mRNA levels of antioxidant-related genes (including gpx, cat, sod, and nrf2) in the liver (p < 0.05). Concurrently, the mRNA expression levels of keap1 expression were significantly downregulated (p < 0.05). The mRNA expression levels of nrf2 expression were upregulated before 36 h of transport and then significantly downregulated (p < 0.05). Compared with the CK group, the mRNA expression levels of nrf2 in the OBEO group were significantly increased (p < 0.05).

3.7. Expression of Inflammation-Related Genes

Figure 7 presents the expression parameters of inflammation-related genes in large yellow croakers during live transport. In this study, the mRNA expression levels of key inflammatory mediators, including tlr-3, nf-κb, il-6, tnf-α, and il-1β, showed a significant time-dependent increase (p < 0.05). The OBEO group exhibited significantly lower mRNA expression levels of nf-κb, il-6, tnf-α, and il-1β compared to the CK group (p < 0.05). The mRNA expression level of hepatic hsp70 initially increased and then decreased (p < 0.05). Furthermore, OBEO treatment significantly reduced the mRNA levels of hsp70 (p < 0.05).

3.8. Intestinal Microbiota Diversity and Composition

Alpha diversity indices were used to evaluate species richness and diversity across sample groups. The box plot illustrating the alpha diversity indices is presented in Figure 8A. The Chao1 index in the CK-72h and OBEO-72h groups was significantly lower than that in the CK-0h group (p < 0.05). The Shannon index in the OBEO-72h group notably exceeded that in the CK-72h group (p < 0.05). Beta diversity serves as an indicator for measuring species diversity across various microbial communities. The differences between samples can be assessed through non-metric multidimensional scaling (NMDS) analysis. The NMDS graph (Figure 8C) revealed significant differences between CK-0h and CK-72h, as well as between CK-0h and OBEO-72h. However, compared to the CK group, both the diversity of intestinal flora and the composition of dominant flora were altered in the OBEO group. At the genus level, the relative abundance of Alivibrio, Vibrio, and Photobacterium decreased significantly, while the relative abundance of Xanthomonas significantly increased after transport (p < 0.05). In the OBEO-72h group, the relative abundance of Xanthomonas significantly decreased, whereas that of Methylobacterium, Alivibrio, Vibrio, Ralstonia, and Pseudomonas significantly increased in comparison to the CK-72h group (Figure 8D).

3.9. Metabolomics Analysis

In total, 4548 distinct metabolite ion signatures were identified, with 1735 metabolites selected after filtering and differential analysis. PCA showed significant metabolic differences between the CK-0h, CK-72h, and OBEO-72h groups (Figure 9A). The OBEO-72h group had 808 differential metabolites compared to the CK-72h group, with 248 metabolites upregulated and 560 metabolites downregulated. The list of metabolites is in Supplementary Material File S2, with KEGG pathway enrichment results in Supplementary Material File S3. Metabolite clustering heat map shows the variations in metabolites during live transport for both the CK and OBEO groups (Figure 9B). Figure 9C shows a volcano plot of differential metabolites between samples from the OBEO-72h group and samples from the CK-72h group. Red indicated upregulated and blue represented downregulated metabolite levels. The metabolites count and the top 20 key pathways from the KEGG database were compiled and presented (Figure 9D). Notably, significant upregulation was observed in L-glutamic acid, fumaric acid, and L-arginine, while the levels of differential metabolites such as prostaglandin E2 (PGE2) and prostaglandin F2α were significantly downregulated. Metabolites like fumaric acid, L-glutamic acid, L-arginine, COR, and prostaglandin E2 were involved in various metabolic pathways, including arachidonic acid (AA) metabolism, alanine, aspartate, and glutamate metabolism, neuroactive ligand–receptor interaction, and steroid hormone biosynthesis.

4. Discussion

In this study, the survival rate in the CK group gradually decreased during the later stage of transport, while no mortality was observed in the OBEO group. This suggests that the addition of OBEO improved the survival rate of large yellow croakers during live transport. Meanwhile, the DO level decreased, and the TAN concentration increased. The decrease in pH might be due to the CO2 produced by the fish’s respiratory metabolism. These changes may be explained by OBEO’s sedative effects, which reduce metabolic activity and subsequently decrease ammonia excretion [47].
GLY, GLU, LD, and TG are key indicators of energy metabolism, involved in energy supply and storage, and closely related to the response of fish to environmental stressors [48]. In normal conditions, GLY and GLU levels in the liver of fish remain relatively stable. However, this study found that liver GLY levels decreased significantly over time, while GLU levels increased. This phenomenon is likely due to the combined effects of crowding and hypoxic stress during live transport, which trigger the secretion of adrenaline and COR. These hormones accelerate the breakdown of GLY into GLU to provide energy, helping the fish to cope with stress [49]. Brandão et al. also demonstrated that transport stress led to an increase in liver GLU, indicating GLY degradation [50]. In the OBEO group, GLU level was lower than that in the CK group, indicating that COR-induced excessive GLU consumption led to a decrease in liver GLU levels due to altered cellular metabolism. OBEO may reduce the energy demands during live transport. Similar findings were observed in Cururu stingrays treated with Lippia alba essential oil [51]. LD levels increased over time, likely reflecting enhanced anaerobic metabolism due to declining DO levels, which is similar to the results in large yellow croakers reported by Guo et al. [1]. However, the OBEO group showed slower LD accumulation, indicating that OBEO’s anesthetic effect reduced the fish’s metabolic activity and energy demand. This is in line with findings in sea bass treated with lemon balm essential oil [26]. Simultaneously, the TG levels decreased, likely due to prolonged transport stress, which increases energy demand, leading to TG catabolism into fatty acids following GLY depletion [52]. Elevated levels of both AST and ALT indicate metabolic stress or liver damage, which may impair liver detoxification, deplete energy reserves, and weaken immune function [53]. In this study, the levels of liver AST and ALT increased during the early stage of transport, indicating that the liver of large yellow croakers suffered functional impairment under transport stress. However, the AST and ALT levels in the OBEO group increased more slowly than those in the CK group, suggesting that OBEO alleviated liver damage caused by transport stress. This protective effect may be exerted by scavenging excessive ROS induced by stress and inhibiting the overactivation of stress response pathways. These results are similar to those of previous studies, which demonstrated that β-carotene exerted a similar effect on AST and ALT in zebrafish [54]. However, at the end of transport, the AST level in the OBEO group was higher than that in the CK group, which might be due to the long-time exposure to OBEO that caused liver damage [55]. Another study also found that carp had higher AST levels when exposed to linalool for a long time [56].
ACP and AKP serve as valuable biomarkers for fish immunity, effectively reflecting the impact of environmental stress on fish physiology [11]. ACP, primarily located in LZM, functions to degrade pathogens and damaged cellular structures, thereby combating infections. AKP contributes to immune defense by regulating phosphate metabolism and modulating immune cell activity through dephosphorylation processes [39]. The elevated ACP and AKP levels observed in this study indicated stress-induced immune suppression and concurrent hepatic damage during live transport, which is consistent with the findings reported in rainbow trout [57]. Moreover, the AKP activity in the CK group was higher than that in the OBEO group, demonstrating that OBEO may mitigate immune system impairment. LZM serves as the first line of defense in the immune system by degrading bacterial cell walls to prevent infections [27]. In this study, the OBEO group exhibited higher LZM activity, which aligns with previous research demonstrating that Ducrosia anethifolia essential oil enhances LZM activity in rainbow trout during live transport [58]. Serum IgM was significantly higher in the OBEO group, further supporting its immune-enhancing properties. This is consistent with a study by Wang et al., who demonstrated that Melissa officinalis essential oil effectively enhances the immune capacity of sea bass during live transport [59]. In this study, serum COR levels increased initially and then decreased. The initial increase in COR levels indicated a neuroendocrine stress response, with fish secreting substantial amounts of COR. The subsequent decline in COR levels suggested gradual physiological adaptation to transport conditions [60]. This phenomenon is consistent with the findings by Hong et al., who observed increased serum COR levels in golden pomfret fish after transport [61]. The COR levels of the large yellow croakers treated with OBEO were lower than those in the CK group. These findings align with a study by Alexssandro et al. on the use of Lippia alba essential oil during live transport of silver catfish [62]. This may be attributed to OBEO’s inhibitory effect on adrenocorticotropic hormone secretion. Collectively, these findings demonstrate that OBEO effectively mitigated stress responses and enhanced overall physiological stability in fish during live transport, likely by reducing their sensitivity to external stressors and thereby improving immune function.
Redox equilibrium is principally regulated by the antioxidant defense system, which comprises both antioxidant enzymes and associated signaling pathways [63]. The antioxidant defense system, which includes SOD, CAT, and GPX, is essential for mitigating oxidative stress by scavenging ROS. SOD serves as the primary defense in the antioxidant defense system, protecting cells by catalyzing the conversion of superoxide radicals (O2−) to molecular oxygen (O2) and hydrogen peroxide (H2O2) [64]. GPX also contributes to cellular protection by eliminating peroxides, thus mitigating oxidative damage and promoting cellular homeostasis. In this study, SOD, CAT, and GPX activities increased during early transport stages, potentially due to the activation of the Nrf2 pathway by OBEO. However, these enzyme activities gradually decreased during later transport stages, probably due to oxidative stress-induced depletion of antioxidant enzymes [65]. Correspondingly, the expression levels of the oxidation genes (e.g., sod, cat, and gpx) also increased initially and then decreased. Under oxidative stress, the Keap1–Nrf2 signaling pathway serves as a central regulator of cellular oxidative stress and facilitates the elimination of ROS [66]. Nrf2, an essential protein in combating oxidative stress, protects cells by upregulating antioxidant enzyme systems (e.g., SOD and GPX) [67]. Under normal physiological conditions, nrf2 is bound to keap1 in the cytoplasm to preserve redox equilibrium [68]. However, during oxidative stress, nrf2 translocates to the nucleus and triggers the transcription and expression of antioxidant genes like gpx, sod, and cat [69]. When the Keap1–Nrf2 pathway is activated, nrf2 separates from keap1 and enhances the transcription and production of key antioxidant enzymes (e.g., SOD, GPX, and CAT) [68]. This process effectively neutralizes excess ROS and restores redox balance. In this study, it was found that OBEO upregulated the hepatic expression of antioxidant-related genes (including gpx, cat, sod, and nrf2). OBEO likely activated the Nrf2 signaling pathway to exert its antioxidant benefits, thereby enhancing antioxidant gene expression, reducing ROS levels, and ultimately protecting cells from oxidative damage. Mohammadi et al. demonstrated that the addition of ginger extract enhanced SOD and CAT activities in carp, improving antioxidant capacity and mitigating oxidative stress [70]. Collectively, these results showed that OBEO effectively triggered the Keap1–Nrf2 signaling pathway, upregulated the expression of antioxidant genes (e.g., sod, cat, and gpx), and provided comprehensive cellular protection against oxidative stress during live transport. In the OBEO group, MDA levels increased more slowly than in the CK group, indicating that OBEO alleviated lipid peroxidation and reduced free radical production, thereby mitigating oxidative stress. Similar results were reported in a prior study, where zebrafish exhibited a notable increase in MDA levels after the addition of essential oils [71].
Gills are essential for respiration and osmoregulation. Under stress conditions, fish may undergo structural alterations in gill tissues as they adapt to changing environmental conditions [72]. The gill NKA is essential for maintaining homeostasis by regulating key physiological processes, including osmoregulation, acid–base balance, and excretion [73]. NKA activity in the gills typically exhibited an initial increase and then a gradual decrease during live transport. This phenomenon likely resulted from ammonia–nitrogen stress, as fish strive to maintain osmotic balance while adjusting to transport conditions. NKA facilitates NH4+ transport from the hemolymph to the external environment via the sodium–potassium pump [74]. OBEO has been shown to be effective in reducing agitation, stress responses, and ion imbalance induced during live transport. A previous study reported reduced gill NKA activity in gilthead seabream following anesthetic treatment [75], which is consistent with the lower NKA activity observed in the OBEO group of the present study. In this study, prolonged transport caused significant gill damage in large yellow croakers, characterized by structural changes such as filament folding, collapse, and contraction, along with fusion of secondary lamellae and an increase in mitochondria-rich cells. This damage may result from the proliferation of gill filaments as an adaptation to enhance oxygen intake [76]. The increased respiratory frequency led to excretory product accumulation, leading to higher ammonia nitrogen levels, exacerbating oxidative damage and gill tissue diseases in large yellow croakers [77]. The gill epithelium’s mucus cells and secretion may assist fish in adjusting to changing water conditions [78]. Fewer mucous cells were observed in the OBEO group, indicating that OBEO may stabilize the mucus cell numbers. Wang et al. [79] also reported that stress disrupts gill filament organization, creating visible inter-filamentary gaps.
Tlr-3, a key member of the Toll-like receptor family, plays a critical role in pathogen recognition [80]. It acts as a crucial mediator of immune regulation, oxidative stress responses, and inflammatory processes. Mechanistically, tlr-3 promotes inflammatory cascades by activating transcription factors such as nf-κb, thereby enhancing host defense mechanisms [81]. The TLR-signaling pathway and ROS (especially H2O2) activate nf-κb, which causes the release of pro-inflammatory cytokines such as tnf-α, il-1β, and il-6 [79]. During inflammation, tnf-α initiates a cytokine cascade that directly stimulates the production of il-1β and il-6. This study revealed that transport stress induced the upregulation of mRNA expression for key inflammatory mediators, including tlr-3, nf-κb, il-6, tnf-α, and il-1β. This is consistent with the findings of previous studies that elevated ammonia levels during live transport can exacerbate immune response by activating the NF-κB pathway [82]. These findings demonstrated that transport stress activated both transcriptional and functional pathways involving tlr-3 and nf-κb, which in turn upregulated inflammation-related genes in the liver and triggered subsequent inflammatory responses. Furthermore, OBEO treatment significantly reduced the mRNA levels of nf-κb, tlr-3, and its downstream inflammatory cytokines (tnf-α, il-1β, and il-6), indicating that OBEO treatment modulated the TLR-3 pathway to enhance immune responsiveness to pathogenic challenges, thereby exerting potent anti-inflammatory effects. HSP70, a molecular chaperone, plays crucial roles in cellular protection against thermal and oxidative damage while contributing to immune regulation and pathogen recognition [83]. Hepatic HSP70 protein levels increased initially and then decreased during transport, with the CK group exhibiting significantly higher levels than the OBEO group. This differential protein expression was preceded by a distinct transcriptional response: hepatic hsp70 mRNA showed an initial upregulation followed by a subsequent decline. The level of HSP70 protein showed the same response in the OBEO group, demonstrating the protective effect of OBEO in mitigating transport-induced physiological stress, which is consistent with the findings reported by Wang et al. [84]. Additionally, Guo et al. documented that oregano essential oil supplementation significantly upregulated the expression level of immune-related genes in turbot [85].
The intestinal microbiota plays an important role in physiological, growth metabolism, and immune functions [86]. This study showed that transport stress significantly alters the composition and diversity of intestinal flora. Specifically, α-diversity indices (including the Shannon and Simpson indices) were significantly lower in the CK group than in the OBEO group, indicating that transport without OBEO disrupted the stability of the fish’s intestinal flora, while OBEO supplementation enhanced the disease resistance of large yellow croakers by maintaining intestinal flora homeostasis. Previous studies have shown that transport stress reduced intestinal flora diversity in yellowtail kingfish [87]. This reduction may result from elevated ammonia and nitrogen concentrations in transport water, which limit nutrient availability for intestinal microbes, thereby decreasing microbiota diversity [88]. The diversity of intestinal flora and the composition of dominant flora were altered in the OBEO group. At the genus level, the relative abundance of Methylobacterium, Alivibrio, Vibrio, Ralstonia, and Pseudomonas significantly increased, while the relative abundance of Xanthomonas decreased. Excessive proliferation of Xanthomonas in the intestine has been associated with intestinal pathologies, particularly under conditions of immune suppression or intestinal barrier impairment [89]. This indicates that OBEO decreased inflammatory factor levels, improved intestinal barrier function, and enhanced immunocompetence. Additionally, some Alivibrio species are capable of establishing symbiotic relationships with their hosts. Within the intestinal ecosystem, these microorganisms likely cooperate with other resident microbiota to maintain intestinal homeostasis [90]. Overall, OBEO can regulate the composition and diversity of the intestinal microbiota structure of large yellow croakers, providing both preventive and protective effects against intestinal microbiota disturbances.
In this study, fumaric acid, L-arginine, and L-glutamic acid were identified as potential biomarkers involved in metabolic processes. L-glutamic acid is essential for cell energy metabolism and neurological function, as it participates in the tricarboxylic acid cycle to maintain energy balance. It serves as a precursor for the synthesis of γ-aminobutyric acid (GABA), an inhibitory neurotransmitter that regulates nervous system excitability and maintains neural homeostasis. Additionally, L-glutamic acid exerts antioxidant properties by interacting with glutathione to reduce free radical generation, thereby protecting cells from oxidative stress [91]. L-arginine plays a vital role in the urea cycle. During this cycle, L-arginine is converted into urea, which is subsequently excreted through the kidneys, thereby facilitating the elimination of harmful substances like ammonia. This process is essential for maintaining nitrogen balance in the body [92]. Fumaric acid performs many important physiological functions. It can react with the thiol group of cysteine residues, inhibiting the activity of keap1, activating the transcription factor nrf2, and promoting the expression of antioxidant and anti-inflammatory genes [93]. The significant upregulation of L-glutamic acid and fumaric acid levels and the upregulation of L-arginine indicated that amino acid metabolism and arginine biosynthesis were activated after transport with OBEO. This suggests that OBEO promoted the citrate cycle in large yellow croakers. AA plays an essential role in lipid metabolism, with its metabolites contributing to prostaglandin production [94]. Moreover, AA is involved in various physiological processes, including cholesterol esterification and the modulation of inflammatory responses [95]. In response to various stimuli, AA is released from cell membranes by PGE2 and subsequently converted to intermediate metabolites (PGG2 and PGH2) via the action of prostaglandin H synthase. These metabolites can trigger inflammation and tissue damage [96]. Notably, differential metabolites, such as PGE2 and prostaglandin F2α, were significantly downregulated. Under normal circumstances, the binding of nf-κb to the inhibitor of nf-κb (IκB) is in an inactivated state. In response to external stressors, a signaling cascade activates the phosphorylated IκB kinase (IKKs) within the cell [97]. Phosphorylated IκB causes nf-κb to translocate to the nucleus, which promotes the increased expression of inflammation-related genes. In the OBEO group, the expressions of inflammation-related genes such as nf-κb and tlr-3 were lower compared to the CK group, mirroring the results of AA metabolism. This suggests that OBEO treatment mitigated inflammation. Steroid hormones regulate carbohydrate metabolism and fluid homeostasis [98]. COR, the principal glucocorticoid, elevates blood GLU levels through mechanisms including insulin antagonism, reduced GLU utilization, increased gluconeogenesis, and promotion of TG breakdown. To preserve energy for gluconeogenesis, glucocorticoids inhibit phospholipase A2, thereby reducing prostaglandin synthesis and exerting anti-inflammatory effects [99]. Meanwhile, the lower serum COR levels observed in the OBEO group compared to the CK group confirmed that OBEO regulates energy metabolism in large yellow croakers during transport. These results suggest that fish may employ metabolic regulation as a response to counter stress.

5. Conclusions

This study evaluated the effects of adding OBEO on the physiological metabolic status and stress response of large yellow croakers during live transport. The results demonstrated that OBEO addition upregulated the expression of antioxidant- and immune-related genes and affected the metabolic pathways of the liver during live transport. OBEO alleviated tissue damage in the gills and liver, enhanced immunity and antioxidant capacity, reduced energy metabolism, and remodeled the intestinal microbiota of large yellow croakers. This study indicates that OBEO can be used as a novel anesthetic for large yellow croakers during live transport.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani16040537/s1.

Author Contributions

Conceptualization, J.M.; methodology, J.W. and H.Y.; software, J.W.; investigation, J.W. and M.Y.; resources, J.X.; data curation, J.W. and H.Y.; writing—original draft preparation, J.W.; writing—review and editing, J.W. and J.M.; supervision, J.M. and J.X.; funding acquisition, J.X.; analysis, J.W., M.Y. and J.M.; material preparation, J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Key Research and Development Program of China (2023YFD2401402) and the Agriculture Research System of China (CARS-47).

Institutional Review Board Statement

The experiment procedure was approved by the Animal Care and Use Committee of the Shanghai Ocean University (SHOU-DW-2024–155, 1 June 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Guo, M.; Xu, Z.; Zhang, H.; Mei, J.; Xie, J. The Effects of Acute Exposure to Ammonia on Oxidative Stress, Hematological Parameters, Flesh Quality, and Gill Morphological Changes of the Large Yellow Croaker (Larimichthys crocea). Animals 2023, 13, 2534. [Google Scholar] [CrossRef]
  2. Su, Y.; Kokau, S.; Zhang, X.-N.; Dong, Y.-W. Transcriptomic responses to transportation stress in the juvenile Chinese sea bass (Lateolabrax maculatus). Aquacult. Rep. 2024, 39, 102467. [Google Scholar] [CrossRef]
  3. Zhou, Y.; Yin, X.; Li, W.; Gao, Y.; Chu, Z. Effects of transportation on physiological indices and metabolomics of the large yellow croaker Larimichthys crocea. Fish Physiol. Biochem. 2023, 49, 641–654. [Google Scholar] [CrossRef] [PubMed]
  4. Jia, R.; Han, C.; Lei, J.-L.; Liu, B.-L.; Huang, B.; Huo, H.-H.; Yin, S.-T. Effects of nitrite exposure on haematological parameters, oxidative stress and apoptosis in juvenile turbot (Scophthalmus maximus). Aquat. Toxicol. 2015, 169, 1–9. [Google Scholar] [CrossRef]
  5. Herman, J.P.; McKlveen, J.M.; Ghosal, S.; Kopp, B.; Wulsin, A.; Makinson, R.; Scheimann, J.; Myers, B. Regulation of the Hypothalamic-Pituitary-Adrenocortical Stress Response. Compr. Physiol. 2016, 6, 603–621. [Google Scholar] [CrossRef]
  6. Giri, S.S.; Jung, W.J.; Lee, S.B.; Jo, S.J.; Hwang, M.H.; Park, J.H.; Venkatachalam, S.; Park, S.C. Effect of dietary heat-killed Lactiplantibacillus plantarum VSG3 on growth, immunity, antioxidant status, and immune-related gene expression in pathogen-aggravated Cyprinus carpio. Fish Shellfish Immunol. 2024, 149, 109547. [Google Scholar] [CrossRef]
  7. Giri, S.S.; Jun, J.W.; Yun, S.; Kim, H.J.; Kim, S.G.; Kim, S.W.; Woo, K.J.; Han, S.J.; Oh, W.T.; Kwon, J.; et al. Effects of dietary heat-killed Pseudomonas aeruginosa strain VSG2 on immune functions, antioxidant efficacy, and disease resistance in Cyprinus carpio. Aquaculture 2020, 514, 734489. [Google Scholar] [CrossRef]
  8. Liu, S.; Liu, J.; Wang, Y.; Deng, F.; Deng, Z. Oxidative Stress: Signaling Pathways, Biological Functions, and Disease. MedComm 2025, 6, e70268. [Google Scholar] [CrossRef] [PubMed]
  9. Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2018, 54, 287–293. [Google Scholar] [CrossRef]
  10. Sun, Z.; Tan, X.; Liu, Q.; Ye, H.; Zou, C.; Xu, M.; Zhang, Y.; Ye, C. Physiological, immune responses and liver lipid metabolism of orange-spotted grouper (Epinephelus coioides) under cold stress. Aquaculture 2019, 498, 545–555. [Google Scholar] [CrossRef]
  11. Dawood, M.A.O. Nutritional immunity of fish intestines: Important insights for sustainable aquaculture. Rev. Aquac. 2021, 13, 642–663. [Google Scholar] [CrossRef]
  12. Kim, J.-H.; Kang, J.-C. The immune responses in juvenile rockfish, Sebastes schlegelii for the stress by the exposure to the dietary lead (II). Environ. Toxicol. Pharmacol. 2016, 46, 211–216. [Google Scholar] [CrossRef]
  13. Liu, B.; Jia, R.; Han, C.; Huang, B.; Lei, J.-L. Effects of stocking density on antioxidant status, metabolism and immune response in juvenile turbot (Scophthalmus maximus). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2016, 190, 1–8. [Google Scholar] [CrossRef]
  14. Bhatt, S.; Sahu, N.P.; Gupta, S.; Krishnan, S.; Akhila, S.; Nathaniel, T.P.; Varghese, T. Combined physiological effects of high temperature and salinity stress on genetically improved farmed tilapia (Oreochromis niloticus) reared in inland saline water. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2026, 281, 111165. [Google Scholar] [CrossRef]
  15. Sardella, B.A.; Matey, V.; Cooper, J.; Gonzalez, R.J.; Brauner, C.J. Physiological, biochemical and morphological indicators of osmoregulatory stress in ‘California’ Mozambique tilapia (Oreochromis mossambicus × O. urolepis hornorum) exposed to hypersaline water. J. Exp. Biol. 2004, 207, 1399–1413. [Google Scholar] [CrossRef]
  16. Wu, S.; Pan, M.; Zan, Z.; Jakovlić, I.; Zhao, W.; Zou, H.; Ringø, E.; Wang, G. Regulation of lipid metabolism by gut microbiota in aquatic animals. Rev. Aquac. 2024, 16, 34–46. [Google Scholar] [CrossRef]
  17. Sun, H.; Gui, F.; Feng, D.; Wang, P.; Qu, X.; Niu, S.; Zhang, G. Insight into metabolomics analysis of large yellow croaker liver (Larimichthys crocea) during packaging bag transport. Aquac. Int. 2024, 33, 58. [Google Scholar] [CrossRef]
  18. Purbosari, N.; Warsiki, E.; Syamsu, K.; Santoso, J. Natural versus synthetic anesthetic for transport of live fish: A review. Aquacult. Fish. 2019, 4, 129–133. [Google Scholar] [CrossRef]
  19. Perveen, K.; Bokhari, N.A.; Al-Rashid, S.A.I.; Al-Humaid, L.A. Chemical Composition of Essential Oil of Ocimum basilicum L. and Its Potential in Managing the Alternaria Rot of Tomato. J. Essent. Oil Bear. Plants 2020, 23, 1428–1437. [Google Scholar] [CrossRef]
  20. Fang, D.; Zhang, C.; Mei, J.; Qiu, W.; Xie, J. Effects of Ocimum basilicum essential oil and ginger extract on serum biochemistry, oxidative stress and gill tissue damage of pearl gentian grouper during simulated live transport. Vet. Res. Commun. 2024, 48, 139–152. [Google Scholar] [CrossRef] [PubMed]
  21. Ventura, A.S.; Jerônimo, G.T.; Corrêa Filho, R.A.C.; Souza, A.I.d.; Stringhetta, G.R.; Cruz, M.G.d.; Torres, G.d.S.; Gonçalves, L.U.; Povh, J.A. Ocimum basilicum essential oil as an anesthetic for tambaqui Colossoma macropomum: Hematological, biochemical, non-specific immune parameters and energy metabolism. Aquaculture 2021, 533, 736124. [Google Scholar] [CrossRef]
  22. Becker, A.G.; Luz, R.K.; Mattioli, C.C.; Nakayama, C.L.; de Souza e Silva, W.; de Oliveira Paes Leme, F.; de Mendonça Mendes, H.C.P.; Heinzmann, B.M.; Baldisserotto, B. Can the essential oil of Aloysia triphylla have anesthetic effect and improve the physiological parameters of the carnivorous freshwater catfish Lophiosilurus alexandri after transport? Aquaculture 2017, 481, 184–190. [Google Scholar] [CrossRef]
  23. Woody, C.A.; Nelson, J.; Ramstad, K. Clove oil as an anaesthetic for adult sockeye salmon: Field trials. J. Fish Biol. 2002, 60, 340–347. [Google Scholar] [CrossRef]
  24. GB/T 27638-2011; Code of Practice for Live Fish Transportation. China Standards Press: Beijing, China, 2011.
  25. Salbego, J.; Becker, A.G.; Parodi, T.V.; Zeppenfeld, C.C.; Gonçalves, J.F.; Loro, V.L.; Morsch, V.M.M.; Schetinger, M.R.C.; Maldaner, G.; Morel, A.F.; et al. Methanolic extract of Condalia buxifolia added to transport water alters biochemical parameters of the silver catfish Rhamdia quelen. Aquaculture 2015, 437, 46–50. [Google Scholar] [CrossRef]
  26. Wang, Q.; Mei, J.; Xie, J. The Effects of Lemon Balm (Melissa officinalis L.) Essential Oil on the Stress Response, Anti-Oxidative Ability, and Kidney Metabolism of Sea Bass during Live Transport. Animals 2022, 12, 339. [Google Scholar] [CrossRef] [PubMed]
  27. Cao, J.; Guo, M.J.; Qiu, W.Q.; Mei, J.; Xie, J. Effect of tea polyphenol-trehalose complex coating solutions on physiological stress and flesh quality of marine-cultured Turbot (Scophthalmus maximus) during waterless transport. J. Aquat. Anim. Health 2024, 36, 151–163. [Google Scholar] [CrossRef] [PubMed]
  28. Kamalam, B.S.; Patiyal, R.S.; Rajesh, M.; Mir, J.I.; Singh, A.K. Prolonged transport of rainbow trout fingerlings in plastic bags: Optimization of hauling conditions based on survival and water chemistry. Aquaculture 2017, 480, 103–107. [Google Scholar] [CrossRef]
  29. Mulyani, Y.; Buwono, I.D.; Grandiosa, R.; Pratiwy, F.M.; Barades, E. Gene and hormones involved in stress density and immunity response of G6 transgenic mutiara catfish (Clarias gariepinus). Discov. Appl. Sci. 2025, 7, 852. [Google Scholar] [CrossRef]
  30. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  31. Mörsky, P. Turbidimetric determination of lysozyme with Micrococcus lysodeikticus cells: Reexamination of reaction conditions. Anal. Biochem. 1983, 128, 77–85. [Google Scholar] [CrossRef]
  32. Leyva, A.; Quintana, A.; Sánchez, M.; Rodríguez, E.N.; Cremata, J.; Sánchez, J.C. Rapid and sensitive anthrone–sulfuric acid assay in microplate format to quantify carbohydrate in biopharmaceutical products: Method development and validation. Biologicals 2008, 36, 134–141. [Google Scholar] [CrossRef]
  33. Zheng, J.-L.; Zhu, Q.-L.; Shen, B.; Zeng, L.; Zhu, A.-Y.; Wu, C.-W. Effects of starvation on lipid accumulation and antioxidant response in the right and left lobes of liver in large yellow croaker Pseudosciaena crocea. Ecol. Indic. 2016, 66, 269–274. [Google Scholar] [CrossRef]
  34. Peskin, A.V.; Winterbourn, C.C. Assay of superoxide dismutase activity in a plate assay using WST-1. Free. Radic. Biol. Med. 2017, 103, 188–191. [Google Scholar] [CrossRef]
  35. Tabatabaei, M.S.; Ahmed, M. Enzyme-Linked Immunosorbent Assay (ELISA). In Cancer Cell Biology: Methods and Protocols; Christian, S.L., Ed.; Springer: New York, NY, USA, 2022; pp. 115–134. [Google Scholar]
  36. Haverinen, J.; Vornanen, M. Dual effect of metals on branchial and renal Na,K-ATPase activity in thermally acclimated crucian carp (Carassius carassius) and rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 2023, 254, 106374. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, K.; Liu, S.; Wu, C.; Wang, Y.; Zhang, Y.; Yu, J.; Liu, S.; Li, X.; Qi, X.; Su, S.; et al. Rhynchophylline relieves nonalcoholic fatty liver disease by activating lipase and increasing energy metabolism. Int. Immunopharmacol. 2023, 117, 109948. [Google Scholar] [CrossRef]
  38. Ran, Z.; Wang, X.; Zhang, L.; Yang, Y.; Shang, Z.; Chen, Q.; Ma, X.; Qian, Z.; Liu, W. Enzymatic colorimetric method for turn-on determination of l-lactic acid through indicator displacement assay. J. Biosci. Bioeng. 2023, 136, 159–165. [Google Scholar] [CrossRef]
  39. Wu, L.; Wang, L.; Cui, S.; Peng, Z.; Liu, Z.; Li, M.; Han, Y.; Ren, T. Effects of dietary compound probiotics and heat-killed compound probiotics on antioxidative capacity, plasma biochemical parameters, intestinal morphology, and microbiota of Cyprinus carpio haematopterus. Aquac. Int. 2023, 31, 2199–2219. [Google Scholar] [CrossRef]
  40. Shaker, G.; Zubair, M. Peroxidase-Coupled Glucose Method. In StatPearls; StatPearls Publishing Copyright © 2025; StatPearls Publishing LLC.: Treasure Island, FL, USA, 2025. [Google Scholar]
  41. Mahjoubian, M.; Naeemi, A.S.; Sheykhan, M. Toxicological effects of Ag2O and Ag2CO3 doped TiO2 nanoparticles and pure TiO2 particles on zebrafish (Danio rerio). Chemosphere 2021, 263, 128182. [Google Scholar] [CrossRef]
  42. Dar, R.A.; Qadiri, S.S.N.; Shah, F.A.; Dar, S.A.; Ahad, N.; Wali, A.; Kumar, A.; Rather, M.A.; Bhat, B.A. Assessment of patho-physiological responses, gill histopathology and SEM analysis in common carp (Cyprinus carpio) exposed to varied doses of chloramine-T: A potent chemotherapeutic agent. Aquaculture 2024, 587, 740864. [Google Scholar] [CrossRef]
  43. Liu, M.-J.; Guo, H.-Y.; Zhu, K.-C.; Liu, B.-S.; Liu, B.; Guo, L.; Zhang, N.; Yang, J.-W.; Jiang, S.-G.; Zhang, D.-C. Effects of acute ammonia exposure and recovery on the antioxidant response and expression of genes in the Nrf2-Keap1 signaling pathway in the juvenile golden pompano (Trachinotus ovatus). Aquat. Toxicol. 2021, 240, 105969. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, Q.; Chen, X.; Ding, Y.; Ke, Z.; Zhou, X.; Zhang, J. Diversity and succession of the microbial community and its correlation with lipid oxidation in dry-cured black carp (Mylopharyngodon piceus) during storage. Food Microbiol. 2021, 98, 103686. [Google Scholar] [CrossRef]
  45. Deng, Y.; Wang, R.; Wang, Y.; Sun, L.; Tao, S.; Li, X.; Gooneratne, R.; Zhao, J. Diversity and succession of microbial communities and chemical analysis in dried Lutianus erythropterus during storage. Int. J. Food Microbiol. 2020, 314, 108416. [Google Scholar] [CrossRef]
  46. Chen, B.; Xu, T.; Yan, Q.; Karsli, B.; Li, D.; Xie, J. Effect of temperature fluctuations on large yellow croaker fillets (Larimichthys crocea) in cold chain logistics: A microbiological and metabolomic analysis. J. Food Eng. 2025, 386, 112290. [Google Scholar] [CrossRef]
  47. Boaventura, T.P.; Souza, C.F.; Ferreira, A.L.; Favero, G.C.; Baldissera, M.D.; Heinzmann, B.M.; Baldisserotto, B.; Luz, R.K. The use of Ocimum gratissimum L. essential oil during the transport of Lophiosilurus alexandri: Water quality, hematology, blood biochemistry and oxidative stress. Aquaculture 2021, 531, 735964. [Google Scholar] [CrossRef]
  48. Chen, F.; Wang, L.; Zhang, D.; Li, S.; Zhang, X. Effect of an Established Nutritional Level of Selenium on Energy Metabolism and Gene Expression in the Liver of Rainbow Trout. Biol. Trace Elem. Res. 2022, 200, 3829–3840. [Google Scholar] [CrossRef]
  49. Dagoudo, M.; Mutebi, E.T.; Qiang, J.; Tao, Y.-F.; Zhu, H.-J.; Ngoepe, T.K.; Xu, P. Effects of acute heat stress on haemato-biochemical parameters, oxidative resistance ability, and immune responses of hybrid yellow catfish (pelteobagrus fulvidraco × P. vachelli) juveniles. Vet. Res. Commun. 2023, 47, 1217–1229. [Google Scholar] [CrossRef]
  50. Brandão, F.R.; Duncan, W.P.; Farias, C.F.S.; de Melo Souza, D.C.; de Oliveira, M.I.B.; Rocha, M.J.S.; Monteiro, P.C.; Majolo, C.; Chaves, F.C.M.; de Almeida O’Sullivan, F.L.; et al. Essential oils of Lippia sidoides and Mentha piperita as reducers of stress during the transport of Colossoma macropomum. Aquaculture 2022, 560, 738515. [Google Scholar] [CrossRef]
  51. Ariotti, K.; Marcon, J.L.; Finamor, I.A.; Bressan, C.A.; de Lima, C.L.; Souza, C.d.F.; Caron, B.O.; HeiNzmann, B.M.; Baldisserotto, B.; Pavanato, M.A. Lippia alba essential oil improves water quality during transport and accelerates the recovery of Potamotrygon wallacei from the transport-induced stress. Aquaculture 2021, 545, 737176. [Google Scholar] [CrossRef]
  52. Guo, W.L.; Gao, B.B.; Zhang, X.Q.; Ren, Q.Z.; Xie, D.Z.; Liang, J.P.; Li, H.; Wang, X.F.; Zhang, Y.R.; Liu, S.J.; et al. Distinct responses from triglyceride and cholesterol metabolism in common carp (Cyprinus carpio) upon environmental cadmium exposure. Aquat. Toxicol. 2022, 249, 106239. [Google Scholar] [CrossRef] [PubMed]
  53. Qin, H.; Long, Z.; Huang, Z.; Ma, J.; Kong, L.; Lin, Y.; Lin, H.; Zhou, S.; Li, Z. A Comparison of the Physiological Responses to Heat Stress of Two Sizes of Juvenile Spotted Seabass (Lateolabrax maculatus). Fishes 2023, 8, 340. [Google Scholar] [CrossRef]
  54. Wang, Y.; Lu, J.; Qu, H.; Cai, C.; Liu, H.; Chu, J. β-Carotene extracted from Blakeslea trispora attenuates oxidative stress, inflammatory, hepatic injury and immune damage induced by copper sulfate in zebrafish (Danio rerio). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2022, 258, 109366. [Google Scholar] [CrossRef]
  55. Zeng, X.; Dong, H.; Yang, Y.; Li, T.; Li, C.; Zhang, J. Effects of essential oil of Magnolia denudata on spotted seabass (Lateolabrax maculatus) during simulated live transportation. Aquaculture 2023, 567, 739258. [Google Scholar] [CrossRef]
  56. Yousefi, M.; Hoseinifar, S.H.; Ghelichpour, M.; Hoseini, S.M. Anesthetic efficacy and biochemical effects of citronellal and linalool in common carp (Cyprinus carpio Linnaeus, 1758) juveniles. Aquaculture 2018, 493, 107–112. [Google Scholar] [CrossRef]
  57. Ren, Y.; Men, X.; Yu, Y.; Li, B.; Zhou, Y.; Zhao, C. Effects of transportation stress on antioxidation, immunity capacity and hypoxia tolerance of rainbow trout (Oncorhynchus mykiss). Aquacult. Rep. 2022, 22, 100940. [Google Scholar] [CrossRef]
  58. Vazirzadeh, A.; Dehghan, F.; Kazemeini, R. Changes in growth, blood immune parameters and expression of immune related genes in rainbow trout (Oncorhynchus mykiss) in response to diet supplemented with Ducrosia anethifolia essential oil. Fish Shellfish Immunol. 2017, 69, 164–172. [Google Scholar] [CrossRef]
  59. Wang, Q.; Mei, J.; Cao, J.; Xie, J. Effects of Melissa officinalis L. Essential Oil in Comparison with Anaesthetics on Gill Tissue Damage, Liver Metabolism and Immune Parameters in Sea Bass (Lateolabrax maculatus) during Simulated Live Transport. Biology 2022, 11, 11. [Google Scholar] [CrossRef] [PubMed]
  60. Sampaio, F.D.F.; Freire, C.A. An overview of stress physiology of fish transport: Changes in water quality as a function of transport duration. Fish Fish. 2016, 17, 1055–1072. [Google Scholar] [CrossRef]
  61. Hong, J.; Chen, X.; Liu, S.; Fu, Z.; Han, M.; Wang, Y.; Gu, Z.; Ma, Z. Impact of fish density on water quality and physiological response of golden pompano (Trachinotus ovatus) flingerlings during transportation. Aquaculture 2019, 507, 260–265. [Google Scholar] [CrossRef]
  62. Becker, A.G.; Parodi, T.V.; Heldwein, C.G.; Zeppenfeld, C.C.; Heinzmann, B.M.; Baldisserotto, B. Transportation of silver catfish, Rhamdia quelen, in water with eugenol and the essential oil of Lippia alba. Fish Physiol. Biochem. 2012, 38, 789–796. [Google Scholar] [CrossRef] [PubMed]
  63. Feng, L.; Wu, Y.; Wang, J.; Han, Y.; Huang, J.; Xu, H. Neuroprotective Effects of a Novel Tetrapeptide SGGY from Walnut against H2O2-Stimulated Oxidative Stress in SH-SY5Y Cells: Possible Involved JNK, p38 and Nrf2 Signaling Pathways. Foods 2023, 12, 1490. [Google Scholar] [CrossRef]
  64. He, W.; Liu, Y.; Zhang, W.; Zhao, Z.; Bu, X.; Sui, C.; Pan, S.; Yao, C.; Tang, Y.; Mai, K.; et al. Effects of dietary supplementation with heat-killed Lactobacillus acidophilus on growth performance, digestive enzyme activity, antioxidant capacity, and inflammatory response of juvenile large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol. 2024, 151, 109651. [Google Scholar] [CrossRef] [PubMed]
  65. Salbego, J.; Toni, C.; Becker, A.G.; Zeppenfeld, C.C.; Menezes, C.C.; Loro, V.L.; Heinzmann, B.M.; Baldisserotto, B. Biochemical parameters of silver catfish (Rhamdia quelen) after transport with eugenol or essential oil of Lippia alba added to the water. Braz. J. Biol. 2017, 77, 696–702. [Google Scholar] [CrossRef]
  66. Ma, Y.; Yu, K.; Wang, N.; Xiao, X.; Leng, Y.; Fan, J.; Du, Y.; Wang, S. Sulfur dioxide-free wine with polyphenols promotes lipid metabolism via the Nrf2 pathway and gut microbiota modulation. Food Chem. X 2024, 21, 101079. [Google Scholar] [CrossRef]
  67. Liu, H.; Feng, J.; Bao, X.; Wang, Q.; Yu, H.; Yu, H.; Yang, Y. Astragaloside IV can mitigate heat stress-induced tissue damage through modulation of the Keap1-Nrf2 signaling pathway in grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2025, 157, 110121. [Google Scholar] [CrossRef]
  68. Wang, J.; Wang, L.; Liu, Y.; Hou, C.; Xie, Q.; Tang, D.; Liu, F.; Lou, B.; Zhu, J. The Keap1-Nrf2/ARE signaling pathway regulates redox balance and apoptosis in the small yellow croaker (Larimichthys polyactis) under hypoxic stress. Sci. Total Environ. 2024, 957, 177396. [Google Scholar] [CrossRef]
  69. Yuan, J.; Li, Y.; Miao, J.; Zhang, X.; Xiong, Y.; Ma, F.; Ding, J.; He, S. Bamboo leaf flavonoids ameliorate cyclic heat stress-induced oxidative damage in broiler liver through activation of Keap1-Nrf2 signaling pathway. Poult. Sci. 2025, 104, 104952. [Google Scholar] [CrossRef]
  70. Mohammadi, G.; Rashidian, G.; Hoseinifar, S.H.; Naserabad, S.S.; Doan, H.V. Ginger (Zingiber officinale) extract affects growth performance, body composition, haematology, serum and mucosal immune parameters in common carp (Cyprinus carpio). Fish Shellfish Immunol. 2020, 99, 267–273. [Google Scholar] [CrossRef]
  71. Chen, J.; Wu, S.; Wu, R.; Ai, H.; Lu, X.; Wang, J.; Luo, Y.; Li, L.; Cao, J. Essential oil from Artemisia argyi alleviated liver disease in zebrafish (Danio rerio) via the gut-liver axis. Fish Shellfish Immunol. 2023, 140, 108962. [Google Scholar] [CrossRef] [PubMed]
  72. Sharma, K.; Sharma, P.; Dhiman, S.K.; Chadha, P.; Saini, H.S. Biochemical, genotoxic, histological and ultrastructural effects on liver and gills of fresh water fish Channa punctatus exposed to textile industry intermediate 2 ABS. Chemosphere 2022, 287, 132103. [Google Scholar] [CrossRef]
  73. Hansen, D.A.; Williard, A.S.; Scharf, F.S. Thermal sensitivity of gill Na+/K+ ATPase activity in juvenile red drum. J. Exp. Mar. Biol. Ecol. 2022, 554, 151778. [Google Scholar] [CrossRef]
  74. Garçon, D.P.; Masui, D.C.; Mantelatto, F.L.M.; Furriel, R.P.M.; McNamara, J.C.; Leone, F.A. Hemolymph ionic regulation and adjustments in gill (Na+, K+)-ATPase activity during salinity acclimation in the swimming crab Callinectes ornatus (Decapoda, Brachyura). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2009, 154, 44–55. [Google Scholar] [CrossRef]
  75. Jerez-Cepa, I.; Fernández-Castro, M.; Alameda-López, M.; González-Manzano, G.; Mancera, J.M.; Ruiz-Jarabo, I. Transport and recovery of gilthead seabream (Sparus aurata L.) sedated with AQUI-S® and etomidate: Effects on intermediary metabolism and osmoregulation. Aquaculture 2021, 530, 735745. [Google Scholar] [CrossRef]
  76. Sun, H.; Gui, F.; Feng, D.; Wang, P.; Qu, X.; Niu, S.; Zhang, G. Insight into critical water quality factors and gill function of large yellow croaker (Larimichthys crocea) during packaging bag transport. Aquacult. Rep. 2024, 38, 102330. [Google Scholar] [CrossRef]
  77. Nie, X.; Zhang, F.; Wang, T.; Zheng, X.; Li, Y.; Huang, B.; Zhang, C. Physiological and morphological changes in Turbot (Psetta maxima) gill tissue during waterless storage. Aquaculture 2019, 508, 30–35. [Google Scholar] [CrossRef]
  78. Skår, M.W.; Haugland, G.T.; Powell, M.D.; Wergeland, H.I.; Samuelsen, O.B. Development of anaesthetic protocols for lumpfish (Cyclopterus lumpus L.): Effect of anaesthetic concentrations, sea water temperature and body weight. PLoS ONE 2017, 12, e0179344. [Google Scholar] [CrossRef]
  79. Wang, X.; Gao, X.-Q.; Wang, X.-Y.; Fang, Y.-Y.; Xu, L.; Zhao, K.-F.; Huang, B.; Liu, B.-L. Bioaccumulation of manganese and its effects on oxidative stress and immune response in juvenile groupers (Epinephelus moara ♀ × E. lanceolatus ♂). Chemosphere 2022, 297, 134235. [Google Scholar] [CrossRef]
  80. Nguyen, T.P.; Nguyen, B.T.; Nan, F.-H.; Lee, M.-C.; Lee, P.-T. TLR23, a fish-specific TLR, recruits MyD88 and TRIF to activate expression of a range of effectors in melanomacrophages in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2022, 126, 34–46. [Google Scholar] [CrossRef] [PubMed]
  81. Nguyen, T.P.; Nguyen, B.T.; Dao, T.N.L.; Ho, T.H.; Lee, P.T. Investigation of the functional role of UNC93B1 in Nile tilapia (Oreochromis niloticus): mRNA expression, subcellular localization, and physical interaction with fish-specific TLRs. Fish Shellfish Immunol. 2023, 139, 108902. [Google Scholar] [CrossRef]
  82. Zhang, C.-N.; Zhang, J.-L.; Ren, H.-T.; Zhou, B.-H.; Wu, Q.-J.; Sun, P. Effect of tributyltin on antioxidant ability and immune responses of zebrafish (Danio rerio). Ecotoxicol. Environ. Saf. 2017, 138, 1–8. [Google Scholar] [CrossRef] [PubMed]
  83. Zuo, R.; Hou, S.; Wu, F.; Song, J.; Zhang, W.; Zhao, C.; Chang, Y. Higher dietary protein increases growth performance, anti-oxidative enzymes activity and transcription of heat shock protein 70 in the juvenile sea urchin (Strongylocentrotus intermedius) under a heat stress. Aquacult. Fish 2017, 2, 18–23. [Google Scholar] [CrossRef]
  84. Wang, B.; Wang, Y.; Jia, T.; Feng, J.; Qu, C.; Wu, X.; Yang, X.; Zhang, Q. Changes in physiological responses and immunity of blunt snout bream Megalobrama amblycephala from transport stress. Fish Physiol. Biochem. 2022, 48, 1183–1192. [Google Scholar] [CrossRef] [PubMed]
  85. Guangxin, G.; Li, K.; Zhu, Q.; Zhao, C.; Li, C.; He, Z.; Hu, S.; Ren, Y. Improvements of immune genes and intestinal microbiota composition of turbot (Scophthalmus maximus) with dietary oregano oil and probiotics. Aquaculture 2022, 547, 737442. [Google Scholar] [CrossRef]
  86. Neurath, M.F.; Artis, D.; Becker, C. The intestinal barrier: A pivotal role in health, inflammation, and cancer. Lancet Gastroenterol. Hepatol. 2025, 10, 573–592. [Google Scholar] [CrossRef] [PubMed]
  87. Zhou, H.; Xu, Y.; Cui, A.; Jiang, Y.; Feng, Y.; Ma, B.; Wang, B. Stress and recovery of yellowtail kingfish (Seriola aureovittata) during Sea-land relay transportation: Biochemical, microecological and transcriptomic responses. Aquacult. Rep. 2024, 37, 102221. [Google Scholar] [CrossRef]
  88. Zheng, T.; Tao, Y.; Lu, S.; Qiang, J.; Xu, P. Integrated Transcriptome and 16S rDNA Analyses Reveal That Transport Stress Induces Oxidative Stress and Immune and Metabolic Disorders in the Intestine of Hybrid Yellow Catfish (Tachysurus fulvidraco♀ × Pseudobagrus vachellii♂). Antioxidants 2022, 11, 1737. [Google Scholar] [CrossRef]
  89. Ma, J.; Piao, X.; Mahfuz, S.; Long, S.; Wang, J. The interaction among gut microbes, the intestinal barrier and short chain fatty acids. Anim. Nutr. 2022, 9, 159–174. [Google Scholar] [CrossRef]
  90. Klemetsen, T.; Karlsen, C.; Willassen, N. Phylogenetic Revision of the Genus Aliivibrio: Intra- and Inter-Species Variance Among Clusters Suggest a Wider Diversity of Species. Front. Microbiol. 2021, 12, 626759. [Google Scholar] [CrossRef]
  91. Andersen, J.V.; Markussen, K.H.; Jakobsen, E.; Schousboe, A.; Waagepetersen, H.S.; Rosenberg, P.A.; Aldana, B.I. Glutamate metabolism and recycling at the excitatory synapse in health and neurodegeneration. Neuropharmacology 2021, 196, 108719. [Google Scholar] [CrossRef]
  92. Rodrigues, E.; Ribeiro, A.; Bacila, M. L-arginine metabolism in mitochondria isolated from the liver of antarctic fish Notothenia rossii and Notothenia neglecta. Braz. Arch. Biol. Technol. 2006, 49, 825–833. [Google Scholar] [CrossRef][Green Version]
  93. Zhang, H.; Zhao, L.J. Influence of sublethal doses of acetamiprid and halosulfuron-methyl on metabolites of zebra fish (Brachydanio rerio). Aquat. Toxicol. 2017, 191, 85–94. [Google Scholar] [CrossRef]
  94. Wang, T.; Fu, X.; Chen, Q.; Patra, J.K.; Wang, D.; Wang, Z.; Gai, Z. Arachidonic Acid Metabolism and Kidney Inflammation. Int. J. Mol. Sci. 2019, 20, 3683. [Google Scholar] [CrossRef]
  95. Nihad, M.; Abhinand, C.S.; Das, U.N.; Shenoy, P.S.; Bose, B. Arachidonic acid regulates pluripotency by modulating cellular energetics via fatty acid synthesis and mitochondrial fission. Biochem. Biophys. Res. Commun. 2024, 739, 150557. [Google Scholar] [CrossRef]
  96. Bermúdez, M.A.; Balboa, M.A.; Balsinde, J. Lipid Droplets, Phospholipase A2, Arachidonic Acid, and Atherosclerosis. Biomedicines 2021, 9, 1891. [Google Scholar] [CrossRef]
  97. Guo, Q.; Jin, Y.; Chen, X.; Ye, X.; Shen, X.; Lin, M.; Zeng, C.; Zhou, T.; Zhang, J. NF-κB in biology and targeted therapy: New insights and translational implications. Signal Transduct. Target. Ther. 2024, 9, 53. [Google Scholar] [CrossRef] [PubMed]
  98. Sewer, M.B.; Li, D. Regulation of steroid hormone biosynthesis by the cytoskeleton. Lipids 2008, 43, 1109–1115. [Google Scholar] [CrossRef] [PubMed]
  99. Kuo, T.; McQueen, A.; Chen, T.C.; Wang, J.C. Regulation of Glucose Homeostasis by Glucocorticoids. Adv. Exp. Med. Biol. 2015, 872, 99–126. [Google Scholar] [CrossRef] [PubMed]
Animals 16 00537 g001
Figure 1. Effects of adding OBEO on water quality parameters of large yellow croakers during simulated transport. (A) DO (dissolved oxygen), (B) TAN (total ammonia nitrogen), and (C) pH. Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 1. Effects of adding OBEO on water quality parameters of large yellow croakers during simulated transport. (A) DO (dissolved oxygen), (B) TAN (total ammonia nitrogen), and (C) pH. Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g001
Animals 16 00537 g002
Figure 2. Effects of adding OBEO on energy metabolism and liver tissue damage of large yellow croakers during simulated transport. (A) GLY (glycogen), (B) GLU (glucose), (C) LD (lactic acid), (D) TG (triglyceride), (E) AST (aspartate aminotransferase), and (F) ALT (alanine aminotransferase). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 2. Effects of adding OBEO on energy metabolism and liver tissue damage of large yellow croakers during simulated transport. (A) GLY (glycogen), (B) GLU (glucose), (C) LD (lactic acid), (D) TG (triglyceride), (E) AST (aspartate aminotransferase), and (F) ALT (alanine aminotransferase). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g002
Animals 16 00537 g003
Figure 3. Effects of adding OBEO on immune metabolism and serum biochemistry of large yellow croakers during simulated transport. (A) AKP (alkaline phosphatase), (B) ACP (acid phosphatase), (C) LZM (lysozyme), (D) IgM (immunoglobulin M), (E) COR (cortisol), and (F) HSP70 (heat shock protein 70). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 3. Effects of adding OBEO on immune metabolism and serum biochemistry of large yellow croakers during simulated transport. (A) AKP (alkaline phosphatase), (B) ACP (acid phosphatase), (C) LZM (lysozyme), (D) IgM (immunoglobulin M), (E) COR (cortisol), and (F) HSP70 (heat shock protein 70). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g003
Animals 16 00537 g004
Figure 4. Effects of adding OBEO on oxidative stress of large yellow croakers during simulated transport. (A) SOD (superoxide dismutase), (B) CAT (catalase), (C) GPX (glutathione peroxidase), and (D) MDA (malondialdehyde). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 4. Effects of adding OBEO on oxidative stress of large yellow croakers during simulated transport. (A) SOD (superoxide dismutase), (B) CAT (catalase), (C) GPX (glutathione peroxidase), and (D) MDA (malondialdehyde). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g004
Animals 16 00537 g005
Figure 5. Effects of adding OBEO on the gill tissue of large yellow croakers during simulated transport. (A) (a) NKA (Na+/K+-ATPase), (b) semi-quantitative assessment of gill morphology, (−) no histopathology; histopathology of (+) <20% visual field; (++) 20–60% visual field histopathology; histopathology in (+++) >60% visual field. (B) Light microscope, (a) bar = 200 um, (b) bar = 100 um, GL: gill lamellae, MC: mucus, PVC: pavement cell, MRC: mitochondria-rich cells, BC: blood cells, PL: primary lumen. (C) SEM. Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 5. Effects of adding OBEO on the gill tissue of large yellow croakers during simulated transport. (A) (a) NKA (Na+/K+-ATPase), (b) semi-quantitative assessment of gill morphology, (−) no histopathology; histopathology of (+) <20% visual field; (++) 20–60% visual field histopathology; histopathology in (+++) >60% visual field. (B) Light microscope, (a) bar = 200 um, (b) bar = 100 um, GL: gill lamellae, MC: mucus, PVC: pavement cell, MRC: mitochondria-rich cells, BC: blood cells, PL: primary lumen. (C) SEM. Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g005
Animals 16 00537 g006
Figure 6. Effects of adding OBEO on the relative expression of oxidation-related genes of large yellow croakers during simulated transport. (A) sod (superoxide dismutase), (B) cat (catalase), (C) keap1 (kelch-like ECH-associated protein 1), (D) nrf2 (nuclear factor erythroid 2-related factor 2), and (E) gpx (glutathione peroxidase). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 6. Effects of adding OBEO on the relative expression of oxidation-related genes of large yellow croakers during simulated transport. (A) sod (superoxide dismutase), (B) cat (catalase), (C) keap1 (kelch-like ECH-associated protein 1), (D) nrf2 (nuclear factor erythroid 2-related factor 2), and (E) gpx (glutathione peroxidase). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g006
Animals 16 00537 g007
Figure 7. Effects of adding OBEO on the relative expression of inflammation-related genes of large yellow croakers during simulated transport. (A) il-1β (interleukin-1β), (B) il-6 (interleukin-6), (C) tlr-3 (toll-like receptor 3), (D) tnf-α (tumor necrosis factor-α), (E) nf-κb (nuclear factor kappa-B), and (F) hsp70 (heat shock protein 70). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Figure 7. Effects of adding OBEO on the relative expression of inflammation-related genes of large yellow croakers during simulated transport. (A) il-1β (interleukin-1β), (B) il-6 (interleukin-6), (C) tlr-3 (toll-like receptor 3), (D) tnf-α (tumor necrosis factor-α), (E) nf-κb (nuclear factor kappa-B), and (F) hsp70 (heat shock protein 70). Data are presented as mean ± SD. Different letters indicate significant differences among the same treatment group (n = 3, p < 0.05). “*” indicates differences between groups, * p < 0.05, ** p < 0.01, and ns: non-significant.
Animals 16 00537 g007
Animals 16 00537 g008
Figure 8. Effects of adding OBEO on the diversity of intestinal microbiota of large yellow croakers during simulated transport. (A) The group box plot of the alpha diversity index, (B) generic level species composition heat map of a bicluster, (C) beta diversity analysis: NMDS analysis plot, and (D) graph of composition according to genus level (CK-72h vs. OBEO-72h).
Figure 8. Effects of adding OBEO on the diversity of intestinal microbiota of large yellow croakers during simulated transport. (A) The group box plot of the alpha diversity index, (B) generic level species composition heat map of a bicluster, (C) beta diversity analysis: NMDS analysis plot, and (D) graph of composition according to genus level (CK-72h vs. OBEO-72h).
Animals 16 00537 g008
Animals 16 00537 g009
Figure 9. Effects of adding OBEO on the diversity of metabolomics analysis of large yellow croakers during simulated transport. (A) PCA plot between different groups, (B) differential metabolite heat map, (C) volcanic map of differential metabolites, (D) bar plot of the top 20 KEGG pathways (OBEO-72h vs. CK-72h), and (E) metabolic pathway network diagram.
Figure 9. Effects of adding OBEO on the diversity of metabolomics analysis of large yellow croakers during simulated transport. (A) PCA plot between different groups, (B) differential metabolite heat map, (C) volcanic map of differential metabolites, (D) bar plot of the top 20 KEGG pathways (OBEO-72h vs. CK-72h), and (E) metabolic pathway network diagram.
Animals 16 00537 g009
Table 1. Primers for large yellow croaker RT-qPCR analysis.
Table 1. Primers for large yellow croaker RT-qPCR analysis.
Target GenePrimer Sequence (5′-3′)Size (bp)PCR EfficiencyAccession Number
Antioxidant-related genes
sodF: GAGACAATACAAACGGGTGC1370.97NM01303360.1
R: CAATGATGGAAATGGGGC
catF: ATTATGCCATCGGAGACTTG1150.98XM010735178.2
R: GCACCATTTTGCCCACAG
gpxF:GACTCGTTATTCTGGGTGTTCCCTGTA1031.04KY689026.1
R: CCATTCCCTGGACGGACATACTTC
nrf2F: CCCTCAAAATCCCTTTCACT900.96XM010737768.2
R: GCTACCTTGTTCTTGCCGC
keap1F: CGGGGAGTCTCACAGCATT1980.98XM019274257.2
R: CTTCCAACATAATCCAAACACC
Inflammation-related genes
nf-κbF: TGCGGCTCGTGCGGATA1171.05MW114493.1
R: GCGGCTTCAACTGGACTGC
tlr-3F: ACTTAGCCCGTTTGTGGAAG1591.02XM019274877
R: CCAGGCTTAGTTCACGGAGG
tnf-αF: TCTGTTCCCGAATGATGTGCG2211.02XM010745990
R: GGTGACAGGATTCAATCGAGCC
il-1βF: AACAAGACACTGGGCTGAACC1231.04XM010736551.3
R: TGTGGCGTCTGGCGTTCT
il-6F: AACACCAGGAGACACTGCTAGG950.98XM010734753.3
R: GTTTGAGTTGTAACCCGGAAGAT
hsp70F: ACATGAAAGGAAAGATTAGCGAGG1641.02XM010755062.2
R: GTACAACTTGGTCACAATCGGC
Internal reference gene
gapdhF: GACAACGAGTTCGGATACAGC891.04XM010743420.3
R: CAGTTGATTGGCTTGTTTGG
Abbreviations: sod: superoxide dismutase, cat: catalase, gpx: glutathione peroxidase, nrf2: nuclear factor erythroid 2-related factor 2, keap1: kelch-like ECH-associated protein 1, nf-κb: nuclear factor kappa-B, tlr-3: toll-like receptor 3, tnf-α: tumor necrosis factor-α, il-1β: interleukin-1β, il-6: interleukin-6, hsp70: heat shock protein 70, gapdh: glyceraldehyde-3-phosphate dehydrogenase.
Table 2. Reaction parameters for quantitative PCR.
Table 2. Reaction parameters for quantitative PCR.
PhaseTemperature and TimeProcess
First stage95 °C, 30 sPre-degeneration
Second stage95 °C, 15 sDenaturation
60 °C, 20 s (45 cycles)Annealing/extension
Third stage65 °C → 95 °CMelting curve: every 0.5 °C increase in temperature, fluorescence signal will be collected
Table 3. Effect of OBEO on the survival rate (%) of large yellow croakers during live transport.
Table 3. Effect of OBEO on the survival rate (%) of large yellow croakers during live transport.
GroupsLive Transport Time/h
0122436486072
CK100 aA100 aA100 aA100 aA95.55 ± 4.16 aA86.66 ± 5.44 bA83.33 ± 2.72 bA
OBEO100 aA100 aA100 aA100 aA100 aA100 aB100 aB
Different lowercase letters represent differences within groups (n = 3, p < 0.05). Different uppercase letters represent differences between groups (n = 3, p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, J.; Yuan, M.; Yang, H.; Mei, J.; Xie, J. Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport. Animals 2026, 16, 537. https://doi.org/10.3390/ani16040537

AMA Style

Wang J, Yuan M, Yang H, Mei J, Xie J. Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport. Animals. 2026; 16(4):537. https://doi.org/10.3390/ani16040537

Chicago/Turabian Style

Wang, Jingjing, Ming Yuan, Hao Yang, Jun Mei, and Jing Xie. 2026. "Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport" Animals 16, no. 4: 537. https://doi.org/10.3390/ani16040537

APA Style

Wang, J., Yuan, M., Yang, H., Mei, J., & Xie, J. (2026). Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport. Animals, 16(4), 537. https://doi.org/10.3390/ani16040537

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop