Next Article in Journal
Effects of Ocimum basilicum Essential Oil on Energy Metabolism, Oxidative Stress, Immune Response, and Metabolomics of Large Yellow Croaker (Larimichthys crocea) During Simulated Live Transport
Previous Article in Journal
Wnt/β-Catenin Activation by iCRT3 Enhanced the Pluripotency of Bovine Expanded Pluripotent Stem Cells
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 16
Issue 4
10.3390/ani16040536
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish

by
Wei Yang
1,
Yuchi Duan
2,
Tong Zhou
2,
Zhiming Zhang
3,
Ya Li
2,
Hui Huang
4,
Mantang Xiong
3 and
Qiliang Chen
2,*
1
National Engineering Research Center for Inland Waterway Regulation, Chongqing Key Laboratory of Ecological Waterway, Chongqing Jiaotong University, Chongqing 400044, China
2
Chongqing Key Laboratory of Conservation and Utilization of Freshwater Fishes, Chongqing Normal University, Chongqing 401331, China
3
Key Laboratory of Ecological Impacts of Hydraulic-Projects and Restoration of Aquatic Ecosystem of Ministry of Water Resources, Institute of Hydroecology, Ministry of Water Resources & Chinese Academy of Sciences, Wuhan 430079, China
4
Chongqing Southern Sheatfish Original Breeding Farm, Chongqing 401520, China
*
Author to whom correspondence should be addressed.
Animals 2026, 16(4), 536; https://doi.org/10.3390/ani16040536
Submission received: 27 December 2025 / Revised: 2 February 2026 / Accepted: 6 February 2026 / Published: 9 February 2026
(This article belongs to the Section Animal Physiology)
Browse Figures
Versions Notes

Simple Summary

Anthropogenic underwater noise is an emerging environmental pollutant, yet its impacts on fish remain poorly understood. This study examined the effects of continuous daytime and nighttime noise exposure on adult zebrafish. We found that noise triggered anxiety-like responses, including increased bottom-dwelling and reduced exploration, with more pronounced effects during the night. Physiological and molecular analyses revealed that these behavioral changes were linked to a dysregulated stress hormone response and altered levels of key neurotransmitters in the brain, specifically serotonin and dopamine. Our findings demonstrate that underwater noise pollution can adversely affect fish welfare by disrupting core neuroendocrine pathways. This evidence is crucial for informing environmental policies aimed at mitigating the ecological impacts of anthropogenic noise.

Abstract

Underwater noise pollution, driven by human activities, is an emerging environmental concern, yet its effects on fish behavior and physiology remain poorly understood. As a vertebrate model with conserved stress pathways, zebrafish (Danio rerio) is well-suited for investigating the mechanistic basis of such impacts. We hypothesized that daytime and nighttime noise exposure would differentially induce anxiety-like behavior and associated neuroendocrine disruptions in zebrafish, with effects varying by sex. To evaluate this hypothesis, adult zebrafish were exposed to anthropogenic noise (100–1000 Hz, 130 dB) for seven days, specifically during daytime (08:00–20:00) and nighttime (20:00–08:00) periods. Behavioral assays revealed that noise exposure delayed the first entry of females into the top zone during daytime, while both sexes exhibited prolonged bottom-dwelling and reduced exploratory behavior under nighttime noise. Physiological analyses showed elevated plasma cortisol levels in females, accompanied by up-regulated HPI-axis genes, whereas males displayed a non-significant cortisol increase. Neurotransmitter profiling indicated a sex-specific response to nighttime noise: In females, brain 5-hydroxytryptamine (5-HT) showed a non-significant increasing trend, whereas in males it was significantly elevated, while dopamine (DA) decreased in both sexes. Gene expression analysis further revealed disruptions in 5-HT and DA pathways. These findings demonstrate that underwater noise induces anxiety-like behavior in zebrafish by dysregulating endocrine and neurotransmitter systems, with nighttime noise exhibiting more pronounced effects, suggesting that chronic exposure to anthropogenic noise may impair natural behavior and stress regulation in aquatic species, particularly during nighttime periods.

1. Introduction

In recent years, accelerated global industrialization and increasingly frequent human aquatic activities have led to underwater noise pollution becoming a critical environmental concern worldwide. Anthropogenic underwater noise can be categorized into two types based on intensity: short-term, high-intensity noise and continuous, low-intensity noise. Sources of high-intensity noise include pile driving, geological exploration airguns, sonar operations, and underwater explosions, which have been shown to cause immediate physical harm to aquatic animals [1,2,3]. In contrast, low-intensity noise originates from activities such as wind farm operations and vessel traffic [4,5]. Although lower in intensity, this noise is typically chronic and spectrally confined to frequencies below 1000 Hz, which significantly overlaps the auditory range of many fishes [6,7,8]. Consequently, prolonged exposure to anthropogenic noise can mask biologically relevant acoustic signals, disrupt behavioral patterns, and ultimately threaten the health and ecological fitness of fish populations. This impact has been documented across a wide range of marine and freshwater ecosystems globally [9,10].
Anxiety response, an adaptive element of the stress response, is characterized by persistent worry and heightened vigilance toward the environment, representing a natural emotional reaction to unknown or potential threats in animals [11,12]. Fish are highly sensitive to various aquatic environmental stressors, including physical and chemical parameters such as dissolved oxygen, pH, and temperature, as well as external stimuli like noise, light, and chemical contaminants [13,14,15]. Among these stressors, anthropogenic noise has emerged as a pervasive pollutant of increasing concern, with demonstrated potential to disrupt neural function and induce system-wide physiological alterations.
In humans, chronic noise exposure is associated with anxiety and depression, adversely affecting social functioning. Parallel evidence from mammalian models indicates that sub-chronic noise exposure can alter brain serotonergic and dopaminergic neurotransmission, potentially leading to psychological disorders [16]. These findings in mammals provide a mechanistic framework for understanding how noise may disrupt conserved neural and endocrine pathways across vertebrates. In fish, underwater noise has been well-documented to trigger generalized neuroendocrine stress responses, such as a significant elevation in plasma cortisol levels, as observed in species including common carp (Cyprinus carpio), European perch (Perca fluviatilis), and gilthead sea bream (Sparus aurata) following exposure to ship noise and other anthropogenic acoustic disturbances [17,18]. Although a few studies have reported behavioral alterations indicative of anxiety-like states in fish [19,20], direct evidence remains limited and the underlying physiological and molecular mechanisms are still poorly understood.
Zebrafish (Danio rerio) is a widely used model organism in fields such as developmental biology, toxicology, drug discovery, and environmental monitoring. Due to the presence of Weberian ossicles, which connect the swim bladder to the inner ear, zebrafish exhibit high auditory sensitivity and serve as an ideal model for studying noise-induced stress [21,22]. Adult zebrafish can rapidly learn to discriminate between complex sounds [23]. This suggests that they rely on the acoustic landscape for key behavioral and ecological interactions. The acoustic parameters used in this study (continuous noise, 100–1000 Hz, 130 dB re 1 μPa) were intended to simulate common anthropogenic underwater noise. This sound pressure level falls within the typical range of near-field noise for medium and small vessels and represents a widespread source of chronic noise pollution in aquatic environments [24]. However, the fundamental justification for employing zebrafish transcends their established auditory acuity and ecological reliance on complex soundscapes. This model system uniquely bridges behaviorally relevant acoustic disruption with mechanistic resolution at the cellular and molecular levels. Moreover, zebrafish possesses a robust capacity for hair cell regeneration, which is absent in mammals and remains underexplored in other piscine models [25]. This unique attribute provides an unprecedented opportunity to dissect endogenous protective mechanisms against noise-induced trauma, thereby transcending the descriptive limitations of traditional ichthyological approaches that are confined to documenting injury phenotypes. For these reasons, studying the effect of anthropogenic noise in adult zebrafish provides key advantages over similar research conducted earlier in other vertebrate species. Anthropogenic noise acts as an unnatural and unpredictable stressor. Stress can activate the HPI-axis in fish, leading to elevated cortisol levels, which in turn trigger a series of anxiety-like behaviors, including avoidance behaviors and reduced feeding [26]. Furthermore, given the critical role of sex hormones in regulating neuroendocrine and behavioral responses, as well as the well-documented sexual dimorphism in stress responses among vertebrates [27,28], we further hypothesize that the anxiety-like behaviors induced by such noise may exhibit sex-dependent differences.
This study aims to investigate and compare the effects of daytime vs. nighttime noise exposure on anxiety-like behaviors in zebrafish and to explore potential neuroendocrine and molecular mechanisms. We exposed adult zebrafish to daytime noise (100–1000 Hz, 130 dB, from 08:00 to 20:00) or nighttime noise (100–1000 Hz, 130 dB, from 20:00 to 08:00) for 7 days. We assessed anxiety-related behavioral parameters, plasma cortisol levels, brain concentrations of 5-hydroxytryptamine (5-HT) and dopamine (DA), and the expression of genes associated with stress and anxiety. The findings are expected to contribute to a scientific basis for the management of underwater noise pollution and the conservation of aquatic living resources.

2. Materials and Methods

2.1. Chemicals

Cortisol, 5-HT and DA ELISA kits were obtained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). RNAiso Plus, PrimeScriptTM RT reagent Kit with gDNA Eraser, and TB Green® Premix EX Taq™ II were purchased from TaKaRa (Dalian, China).

2.2. Noise Exposure

Adult zebrafish of the AB strain were acquired from the National Zebrafish Resource Center (Wuhan, China). After a two-week acclimatization period in an indoor soundproof recirculating aquaculture system, a total of 540 healthy fish (270 females: 0.59 ± 0.10 g; 270 males: 0.47 ± 0.07 g) were selected for the experiment. All procedures were approved by the Animal Care and Use Committee of Key Laboratory of Animal Biology of Chongqing at Chongqing Normal University (approval No. Zhao-20231012-03).
The fish were randomly distributed into three experimental groups: (1) control group (no additional noise); (2) daytime noise group (100–1000 Hz, 130 dB, applied continuously from 08:00 to 20:00); (3) nighttime noise group (100–1000 Hz, 130 dB, applied continuously from 20:00 to 08:00). Each group consisted of three replicate tanks (50 × 40 × 30 cm), with 60 fish per tank (1:1 sex ratio) and a water volume of 50 L.
Noise exposure was conducted using specialized acoustic equipment following the methodology described in our recent studies [27,29]. The tanks were placed on polystyrene foam boards and surrounded by sound-absorbing cotton to isolate external acoustic interference. Following established methodologies [30], a signal generator (DG1022Z, RIGOL, Beijing, China) was used to generate sound signals, which were amplified and transmitted via an underwater speaker (UW-30, Burnsville, MN, USA) to simulate anthropogenic underwater noise. The emitted noise in tanks was recorded using a digital hydrophone (VST-DH series, Nanjing Haohai Ocean Technology Co., Ltd., Nanjing, China), and the sound files were analyzed using a MATLAB (version R2023b) script to calculate sound pressure levels (reference: 1 μPa underwater). In this study, the frequency range of 100–1000 Hz was selected to reflect the dominant energy distribution of human-generated underwater noise, which overlaps with the auditory sensitivity of many fish species, and the applied noise intensity (130 dB) is consistent with values reported in studies on anthropogenic underwater noise [4,31,32]. To verify the uniformity of the acoustic exposure, we quantified the power spectral density (PSD) at multiple spatial points within the experimental aquaria. Statistical analysis revealed no significant differences in PSD profiles across measurement locations. Given the free-swimming behavior of the fish, this spectral homogeneity demonstrates that the acoustic field was spatially consistent, ensuring all individuals within a given treatment experienced an identical sound environment (Supplementary Figures S1 and S2). During the experimental period, all fish were maintained under a 12 h:12 h light–dark cycle and were fed twice daily (09:00 and 17:00) with commercial feed. Each tank was equipped with filtration systems to maintain water quality. Half of the water was replaced every two days using dechlorinated and aerated tap water. Water parameters were maintained at approximately 28 °C for temperature, 7.4 for pH, and not less than 6 mg/L for dissolved oxygen.
After 7 days of exposure, sampling was conducted. Six fish per sex were randomly selected from each tank for anxiety behavior testing within a fixed daily time window to control for circadian influences. All behavioral trials were video-recorded using a high-resolution camera, and subsequent scoring was performed manually by an observer who was blinded to the treatment groups, and subsequent scoring was performed manually by an observer who was blinded to the treatment groups. The remaining fish were fasted for 24 h and then anesthetized with MS-222 (Sigma-Aldrich, St. Louis, MO, USA). Nine individual fish per sex from each tank were selected for tissue collection: the brains of three fish were pooled and homogenized in 1 mL of RNAiso Plus reagent (TaKaRa, Dalian, China) for RNA extraction and RT-qPCR analysis, and another six brains per sex were flash-frozen in liquid nitrogen and stored at −80 °C for 5-HT and DA quantification. The remaining fish were used for plasma cortisol analysis.

2.3. Anxiety-like Behavior Test

Anxiety-like behavior was assessed using the Novel Tank Diving test [33,34] in a glass tank (25 × 15 × 20 cm) filled with 4 L of water. The tank was virtually divided into two equal vertical zones (top and bottom) to quantify exploratory activity. Individual fish were gently placed into the test tank, and their behavior was immediately recorded for 5 min. Behavioral scoring was performed by an observer who was blinded to the experimental groups. The following parameters were analyzed: (1) latency to first enter the top zone, (2) total time spent in the bottom zone, and (3) frequency of entries into the top zone [35,36].

2.4. Biochemical Analyses

2.4.1. Cortisol

Blood was collected by making an incision at the posterior region of the head using sterile dissecting scissors. The blood welling up from the incision was immediately collected with heparinized capillary tubes and transferred into heparinized microcentrifuge tubes. Blood samples from approximately 15 fish of the same sex within each tank were pooled to form a single biological replicate. Thus, for cortisol measurement, the sample size (n) represents the number of independent tank replicates (n = 3 tanks per sex per treatment condition). Samples were centrifuged at 4 °C, 5000 r/min for 15 min to separate plasma. The plasma supernatant was aliquoted and stored at −80 °C until analysis. Blood samples from fish of the same sex within each tank were pooled to form a single biological replicate. Cortisol concentrations were determined using a commercial ELISA kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) strictly following the manufacturer’s protocol.

2.4.2. 5-HT and DA

Brain tissues were homogenized in normal saline (1:9 w/v) and centrifuged at 3000 r/min for 20 min. The supernatant was collected and stored at −80 °C until analysis. Levels of 5-HT and DA were quantified using ELISA kits in strict accordance with the instructions.

2.5. RNA Extraction and RT-qPCR Analysis

Total RNA was extracted from pooled brain samples (three fish per sample) using RNAiso Plus reagent. Pooling was necessary to obtain sufficient RNA yield and enabled the assessment of group-level, sex-specific responses, though it precludes analysis of individual variability. RNA concentration and purity were assessed spectrophotometrically, and integrity was confirmed via 1% agarose gel electrophoresis. cDNA was synthesized using the PrimeScript™ RT Reagent Kit (TaKaRa, Dalian, China) with gDNA Eraser and stored at –80 °C after dilution. Quantitative PCR was performed using TB Green® Premix EX Taq™ II on a CFX96 real-time PCR system. The thermal cycling conditions were: 95 °C for 30 s; 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and 72 °C for 30 s; followed by melting curve analysis. Gene-specific primers are listed in Table 1. The reference genes ef1α and β-actin were used for normalization, and relative expression was calculated using the 2−ΔΔCt method.

2.6. Statistical Analysis

All data are expressed as mean ± SEM. Data were analyzed using SPSS 26.0 software (IBM, Armonk, NY, USA). Normality of the data distribution was verified using the Shapiro–Wilk test. One-way ANOVA was employed for intergroup comparisons, with Tukey’s HSD test applied for post hoc multiple comparisons. Differences were considered statistically significant at p < 0.05. All graphs were generated using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Anxiety-like Behavior

In the novel tank test, anxiety-like behavior is indicated by delayed top entry, prolonged bottom dwelling, and reduced zone transitions. In females, both daytime and nighttime noise exposure significantly delayed the latency to first enter the top zone compared to the control group (p = 0.014, partial η2 = 0.16; Figure 1A). Although there was an increasing trend in the time spent in the bottom zone, no statistically significant difference was observed among the groups (Figure 1B). Additionally, the frequency of entries into the top zone decreased significantly following nighttime noise exposure (p = 0.03, partial η2 = 0.13; Figure 1C).
In males, nighttime noise exposure produced significant effects across all measures. It significantly increased the latency to first enter the top zone (p = 0.003, partial η2 = 0.20; Figure 1D) and the total time spent in the bottom zone (p = 0.001, partial η2 = 0.23; Figure 1E) compared to both the control and daytime noise groups. Concurrently, it significantly decreased the frequency of entries into the top zone (p = 0.002, partial η2 = 0.22; Figure 1F).

3.2. Plasma Cortisol Levels and Expression of HPI Axis-Related Genes

To investigate the impact of noise on the neuroendocrine stress axis, we measured plasma cortisol levels and the expression of key genes along the HPI axis. In females, plasma cortisol levels increased significantly after exposure to both daytime and nighttime noise compared to the control group (p = 0.005, partial η2 = 0.83; Figure 2A). crhb (p = 0.02, partial η2 = 0.75) expression was significantly up-regulated under both daytime and nighttime noise, while crhbp (p = 0.02, partial η2 = 0.645) and actha (p = 0.009, partial η2 = 0.79) expression was up-regulated only after nighttime noise. The expression levels of crha, crhr1, crhr2, and acthb showed no significant changes under either noise condition (Figure 2B).
In males, cortisol levels showed a slight increase under noise exposure, but the difference was not statistically significant (Figure 2C). Nighttime noise exposure significantly down-regulated the expression of crhr1 (p = 0.02, partial η2 = 0.72), while the expression levels of other tested genes showed no significant changes among groups (Figure 2D).

3.3. Brain 5-HT Levels and Expression of 5-HT Pathway-Related Genes

To assess serotonergic system alterations under noise stress, we measured brain 5-HT levels and key pathway gene expression. In females, 5-HT concentrations showed a slight increase after both daytime and nighttime noise exposure (Figure 3A). The expression of tph1b (p = 0.03, partial η2 = 0.71) was significantly up-regulated after nighttime noise exposure, while the expression levels of tph2, slc6a4a, htr1aa, htr1ab, htr1b, and mao showed no significant changes among groups (Figure 3B).
In males, a significant increase in 5-HT levels was observed exclusively in the nighttime noise group (p = 0.005, partial η2 = 0.83), with no significant changes detected in the daytime noise group (Figure 3C). Nighttime noise exposure significantly up-regulated the expression of tph2 (p = 0.02, partial η2 = 0.72), but down-regulated the expression of slc6a4a (p = 0.001, partial η2 = 0.89) and mao (p = 0.05, partial η2 = 0.19). The expression levels of tph1b, htr1aa, htr1ab, and htr1b showed no significant changes under both noise conditions (Figure 3D).

3.4. Brain DA Levels and Expression of DA Pathway-Related Genes

To determine dopaminergic system involvement, we measured brain dopamine (DA) levels and key pathway gene expression. In females, both daytime and nighttime noise exposure led to a significant decrease in brain DA concentrations (p = 0.004, partial η2 = 0.841) compared to the control group (Figure 4A). Daytime and nighttime noise significantly down-regulated drd2b (p = 0.007, partial η2 = 0.81) and up-regulated comta (p = 0.01, partial η2 = 0.78) and comtb (p = 0.005, partial η2 = 0.44). The expression levels of th, drd2a, slc6a3, and slc18a2 showed no significant changes under either noise condition (Figure 4B).
In males, a significant decrease in brain DA concentrations was observed after both daytime and nighttime noise exposure compared to the control group (p = 0.009, partial η2 = 0.79; Figure 4C). Nighttime noise exposure significantly down-regulated drd2b (p = 0.02, partial η2 = 0.74) and slc6a3 (p = 0.07, partial η2 = 0.81) compared to both the control and daytime groups. The expression levels of th, drd2a, comta, comtb and slc18a2 showed no significant changes under either noise condition (Figure 4D).

4. Discussion

When zebrafish are exposed to a novel environment, their instinctive response is to seek refuge at the bottom of the tank. As they acclimate and perceive the environment as safe, they gradually begin to explore the upper zone. Therefore, a longer latency to first enter the top zone, increased time spent in the bottom zone, and reduced frequency of transitions between zones are established indicators of heightened anxiety-like behavior [37]. Our behavioral assessments revealed that both daytime and nighttime noise exposure significantly delayed the latency for females to first enter the top zone. In males, however, significant increases in this latency and in the time spent in the bottom zone, alongside a decreased frequency of top-zone entries, were observed specifically after nighttime noise exposure. Furthermore, this pattern of noise-induced anxiety is consistent with the findings of Wong et al. [20], who demonstrated that exposure to various temporal patterns of noise (including continuous, fast and slow regular intermittent, and irregular intermittent regimes at 150 dB) for 24 h induced anxiety-like behavior, with all noise-exposed fish spending > 98% of the first minute in the bottom zone compared to 82% in controls. Collectively, these results robustly demonstrate that underwater noise can induce anxiety-like behavior in zebrafish, and our study further reveals that nighttime exposure elicits more pronounced effects, particularly in males. This pattern of heightened nighttime vulnerability is consistent with our recent findings that underwater noise causes more severe developmental impairments in zebrafish embryos during the night than during the day [29].
Cortisol, the primary glucocorticoid in fish, is a key physiological indicator of stress and anxiety, typically elevated in anxious states [38]. Consistent with studies in other fish species exposed to anthropogenic noise [17,18,39], we found that plasma cortisol levels were significantly elevated in female zebrafish following both daytime and nighttime noise exposure. The stress-induced secretion of cortisol is regulated by the hypothalamus–pituitary–interrenal (HPI) axis, wherein corticotropin-releasing hormone (CRH) produced by the hypothalamus plays a pivotal role in modulating physiological and behavioral stress responses in teleosts. CRH activates the endocrine stress response by stimulating the pituitary secretion of adrenocorticotropin hormone (ACTH), and its biological activity is further fine-tuned by the soluble binding protein CRH-BP [40,41]. In females, we observed significant up-regulation of crhb after daytime noise stress, and up-regulation of crhb, crhbp, and actha after nighttime noise stress, which aligned with the observed increase in plasma cortisol concentrations. Given that CRH overexpression can directly induce stress and anxiety-like responses [42], our results suggest that noise may promote anxiety behavior in females both directly via CRH signaling and indirectly by activating the HPI axis to enhance cortisol synthesis and secretion. It is important to note that the observed HPI axis activation and cortisol elevation could stem from two distinct, yet possibly interrelated, mechanisms: the direct physiological stress response to noise itself, as evidenced in prior studies [32], or the secondary effects of noise-induced sleep disruption. Unlike females, male zebrafish displayed only a slight and statistically insignificant rise in plasma cortisol after noise exposure. This attenuated cortisol response may reflect an adaptive mechanism, as prolonged stress can trigger negative feedback to downregulate HPI axis activity and prevent excessive glucocorticoid production [43]. Nevertheless, the persistence of anxiety-like behavior despite the blunted cortisol response implies that other neurochemical systems may play a more critical role in mediating noise-induced anxiety in males.
5-HT is a key inhibitory neurotransmitter that regulates anxiety, depression, and other emotional states within the central nervous system [44]. Dysregulation of 5-HT levels, whether too high or too low, has been linked to anxiety-like behavior [45]. Studies in zebrafish have reported significant increases in brain 5-HT concentration during anxiety states [44,46]. In this study, we observed a slight increase in brain 5-HT levels in females following both daytime and nighttime noise stress, whereas a significant increase was detected in males specifically after nighttime noise exposure. These neurochemical changes align with the observed enhancement of anxiety-like behaviors in both sexes following noise stress and are supported by previous findings that prolonged noise exposure elevates brain 5-HT [47]. The concentration of 5-HT in the brain is tightly controlled by its biosynthesis and metabolic pathways. Tryptophan hydroxylase (TPH) is a rate-limiting enzyme for 5-HT synthesis, and increased TPH activity can lead to higher 5-HT levels [48]. After release into the synaptic cleft, 5-HT homeostasis is maintained through reuptake by the serotonin transporter (SERT) or degradation by monoamine oxidase (MAO) [49,50]. Our molecular data revealed that nighttime noise stress significantly up-regulated the expression of tph1b in female brains. Furthermore, in the nighttime noise group, we observed significant up-regulation of tph2 and slc6a4a (which encodes SERT), alongside significant down-regulation of mao. This pattern of gene expression is consistent with the observed increase in brain 5-HT concentration and resonates with previous reports that noise can activate TPH and reduce SERT in the central auditory system [48,51]. Collectively, our results suggest that noise stress likely elevates brain 5-HT levels by modulating the expression of key genes in the 5-HT pathway, consequently promoting anxiety-like behavior in zebrafish. A comparison of daytime vs. nighttime effects on both 5-HT levels and gene expression further supports that nighttime noise inflicts more severe adverse effects on zebrafish.
DA also plays a pivotal role in the regulation of anxiety-like behavior, in addition to 5-HT. Subchronic noise exposure has been reported to reduce DA concentration in the brain of rat (Rattus norvegicus) [16]. Similarly, our study found that both daytime and nighttime noise exposure significantly decreased brain DA levels in both female and male zebrafish compared to the control group. The biosynthesis of DA, derived from tyrosine, is regulated by the rate-limiting enzyme tyrosine hydroxylase (TH) [52]. Furthermore, synaptic DA concentrations are primarily governed by its reuptake via presynaptic dopamine transporters (DAT), which are critical for maintaining DA homeostasis and signal duration [53]. Our results showed significant downregulation of drd2b expression in female brains after daytime noise and in both sexes after nighttime noise. Moreover, slc6a3 (encoding DAT) expression in male brains was significantly lower after nighttime noise than in control and daytime noise groups. These molecular changes align with the observed reduction in brain DA concentrations. Additionally, catechol-O-methyltransferase (COMT) is involved in the metabolic inactivation of DA [54]. In this study, the expression of comta and comtb was significantly upregulated in female brains after both noise regimes, consistent with the decreased DA levels. These molecular changes suggest that noise interferes with DA signaling by altering its receptor expression, reuptake, and metabolism, thereby promoting anxiety-like behavior.
It should be noted that the findings of this study are constrained by its experimental context. While the controlled laboratory conditions allowed for precise noise exposure, this simplification limits the direct extrapolation of the results to more complex and variable natural acoustic environments. Additionally, the present design does not permit a rigorous dissection of whether the observed effects are driven by noise as a direct physiological stressor or are mediated indirectly through behavioral interference such as sleep disruption. Future work incorporating targeted controls, such as continuous light exposure to isolate sleep effects, would be valuable in delineating the contributions of these potential mechanisms.

5. Conclusions

The present study demonstrated that underwater noise increased anxiety-like behavior in zebrafish by interfering with the endocrine system and neurotransmission. Specifically, noise exposure elevated plasma cortisol levels in female zebrafish through altered expression of HPI axis-related genes. Concurrently, noise affected brain neurotransmission by increasing 5-HT and decreasing DA concentrations, mediated by changes in the expression of key genes involved in the 5-HT and DA pathways. These alterations in plasma cortisol and neurotransmitter levels collectively contributed to the observed increase in anxiety-like behavior. Furthermore, compared with daytime noise, nighttime noise induced more pronounced anxiety-like responses in zebrafish, underscoring the importance of temporal factors in noise impact assessment.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani16040536/s1, Figure S1: Power spectral density (PSD) during noise playback in a representative experimental tank; Figure S2: Power spectral density (PSD) of the ambient background noise.

Author Contributions

Conceptualization, Q.C., W.Y. and Z.Z.; methodology, Q.C. and Y.D.; software, W.Y. and M.X.; validation, Y.D. and T.Z.; formal analysis, Y.D. and Y.L.; investigation, Y.D. and W.Y.; resources, Q.C. and H.H.; data curation, T.Z. and Y.D.; writing—original draft preparation, Y.D. and T.Z.; writing—review and editing, Q.C., W.Y., Z.Z. and M.X.; visualization, T.Z. and Y.L.; supervision, Q.C.; project administration, Q.C. and H.H.; funding acquisition, Q.C., W.Y. and H.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Chongqing Municipality (CSTB2023NSCQ-MSX0754, CSTB2024NSCQ-LZX0094) and the Water Ecological Compensation Project for Shituo Yangtze River Bridge of the Newly built Chongqing-Wanzhou High-speed Railway (YWGT-AH-202511-002).

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee of the Key Laboratory of Animal Biology of Chongqing at Chongqing Normal University (approval No. Zhao-20231012-03, date of approval 12 October 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors acknowledge the use of DeepSeek-V3 for grammar checking during manuscript preparation. All AI-assisted outputs were reviewed by the authors, who assume full responsibility for the final content.

Conflicts of Interest

Hui Huang is from Chongqing Southern Sheatfish Original Breeding Farm. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Popper, A.N.; Halvorsen, M.B.; Kane, A.; Miller, D.L.; Smith, M.E.; Song, J.; Stein, P.; Wysocki, L.E. The Effects of High-Intensity, Low-Frequency Active Sonar on Rainbow Trout. J. Acoust. Soc. Am. 2007, 122, 623–635. [Google Scholar] [CrossRef] [PubMed]
  2. Wardle, C.S.; Carter, T.J.; Urquhart, G.G.; Johnstone, A.D.F.; Ziolkowski, A.M.; Hampson, G.; Mackie, D. Effects of Seismic Air Guns on Marine Fish. Cont. Shelf Res. 2001, 21, 1005–1027. [Google Scholar] [CrossRef]
  3. Robinson, S.P.; Theobald, P.D.; Lepper, P.A. Underwater Noise Generated from Marine Piling. In Proceedings of the ECUA 2012 11th European Conference on Underwater Acoustics, Edinburgh, UK, 2–6 July 2012; p. 070080. [Google Scholar]
  4. Amron, A.; Hidayat, R.R.; Nur Meinita, M.D.; Trenggono, M. Underwater Noise of Traditional Fishing Boats in Cilacap Waters, Indonesia. Heliyon 2021, 7, e08364. [Google Scholar] [CrossRef]
  5. Tougaard, J.; Hermannsen, L.; Madsen, P.T. How Loud Is the Underwater Noise from Operating Offshore Wind Turbines? J. Acoust. Soc. Am. 2020, 148, 2885–2893. [Google Scholar] [CrossRef] [PubMed]
  6. Hildebrand, J. Anthropogenic and Natural Sources of Ambient Noise in the Ocean. Mar. Ecol. Prog. Ser. 2009, 395, 5–20. [Google Scholar] [CrossRef]
  7. Radford, C.A.; Montgomery, J.C.; Caiger, P.; Higgs, D.M. Pressure and Particle Motion Detection Thresholds in Fish: A Re-Examination of Salient Auditory Cues in Teleosts. J. Exp. Biol. 2012, 215, 3429–3435. [Google Scholar] [CrossRef]
  8. Ladich, F.; Fay, R.R. Auditory Evoked Potential Audiometry in Fish. Rev. Fish Biol. Fish. 2013, 23, 317–364. [Google Scholar] [CrossRef] [PubMed]
  9. Neo, Y.Y.; Seitz, J.; Kastelein, R.A.; Winter, H.V.; Ten Cate, C.; Slabbekoorn, H. Temporal Structure of Sound Affects Behavioural Recovery from Noise Impact in European Seabass. Biol. Conserv. 2014, 178, 65–73. [Google Scholar] [CrossRef]
  10. Barcellos, H.H.A.; Koakoski, G.; Chaulet, F.; Kirsten, K.S.; Kreutz, L.C.; Kalueff, A.V.; Barcellos, L.J.G. The Effects of Auditory Enrichment on Zebrafish Behavior and Physiology. PeerJ 2018, 6, e5162. [Google Scholar] [CrossRef]
  11. Perrot-Minnot, M.-J.; Banchetry, L.; Cézilly, F. Anxiety-like Behaviour Increases Safety from Fish Predation in an Amphipod Crustacea. R. Soc. Open Sci. 2017, 4, 171558. [Google Scholar] [CrossRef]
  12. Steimer, T. The Biology of Fear- and Anxiety-Related Behaviors. Dialogues Clin. Neurosci. 2002, 4, 231–249. [Google Scholar] [CrossRef] [PubMed]
  13. Bui Thi, N.H.; Nguyen Thi, N.A.; Audira, G.; Siregar, P.; Liang, S.-T.; Huang, J.-C.; Hsiao, C.-D. Chronic Exposure to Low Concentration Lead Chloride-Induced Anxiety and Loss of Aggression and Memory in Zebrafish. Int. J. Mol. Sci. 2020, 21, 1844. [Google Scholar] [CrossRef]
  14. Hang, S.; Zhao, J.; Ji, B.; Li, H.; Zhang, Y.; Peng, Z.; Zhou, F.; Ding, X.; Ye, Z. Impact of Underwater Noise on the Growth, Physiology and Behavior of Micropterus Salmoides in Industrial Recirculating Aquaculture Systems. Environ. Pollut. 2021, 291, 118152. [Google Scholar] [CrossRef]
  15. Wiles, S.C.; Bertram, M.G.; Martin, J.M.; Tan, H.; Lehtonen, T.K.; Wong, B.B.M. Long-Term Pharmaceutical Contamination and Temperature Stress Disrupt Fish Behavior. Environ. Sci. Technol. 2020, 54, 8072–8082. [Google Scholar] [CrossRef]
  16. Naqvi, F.; Haider, S.; Perveen, T.; Haleem, D.J. Sub-Chronic Exposure to Noise Affects Locomotor Activity and Produces Anxiogenic and Depressive like Behavior in Rats. Pharmacol. Rep. 2012, 64, 64–69. [Google Scholar] [CrossRef]
  17. Celi, M.; Filiciotto, F.; Maricchiolo, G.; Genovese, L.; Quinci, E.M.; Maccarrone, V.; Mazzola, S.; Vazzana, M.; Buscaino, G. Vessel Noise Pollution as a Human Threat to Fish: Assessment of the Stress Response in Gilthead Sea Bream (Sparus aurata, Linnaeus 1758). Fish Physiol. Biochem. 2016, 42, 631–641. [Google Scholar] [CrossRef] [PubMed]
  18. Wysocki, L.E.; Dittami, J.P.; Ladich, F. Ship Noise and Cortisol Secretion in European Freshwater Fishes. Biol. Conserv. 2006, 128, 501–508. [Google Scholar] [CrossRef]
  19. Vasconcelos, R.O.; Gordillo-Martinez, F.; Ramos, A.; Lau, I.H. Effects of Noise Exposure and Ageing on Anxiety and Social Behaviour in Zebrafish. Biology 2023, 12, 1165. [Google Scholar] [CrossRef] [PubMed]
  20. Wong, M.I.; Lau, I.H.; Gordillo-Martinez, F.; Vasconcelos, R.O. The Effect of Time Regime in Noise Exposure on the Auditory System and Behavioural Stress in the Zebrafish. Sci. Rep. 2022, 12, 15353. [Google Scholar] [CrossRef]
  21. Leung, L.C.; Wang, G.X.; Madelaine, R.; Skariah, G.; Kawakami, K.; Deisseroth, K.; Urban, A.E.; Mourrain, P. Neural Signatures of Sleep in Zebrafish. Nature 2019, 571, 198–204. [Google Scholar] [CrossRef]
  22. Sheets, L.; Holmgren, M.; Kindt, K.S. How Zebrafish Can Drive the Future of Genetic-Based Hearing and Balance Research. J. Assoc. Res. Otolaryngol. 2021, 22, 215–235. [Google Scholar] [CrossRef]
  23. Patel, A.; Mattapalli, S.; Kanwal, J. Complex Sound Discrimination in Zebrafish: Auditory Learning Within a Novel “Go/Go” Decision-Making Paradigm. Animals 2025, 15, 3452. [Google Scholar] [CrossRef]
  24. Sarà, G.; Dean, J.; D’Amato, D.; Buscaino, G.; Oliveri, A.; Genovese, S.; Ferro, S.; Buffa, G.; Martire, M.; Mazzola, S. Effect of Boat Noise on the Behaviour of Bluefin Tuna Thunnus Thynnus in the Mediterranean Sea. Mar. Ecol. Prog. Ser. 2007, 331, 243–253. [Google Scholar] [CrossRef]
  25. Nicolson, T. The Genetics of Hair-Cell Function in Zebrafish. J. Neurogenet. 2017, 31, 102–112. [Google Scholar] [CrossRef] [PubMed]
  26. Nedelec, S.L.; Mills, S.C.; Lecchini, D.; Nedelec, B.; Simpson, S.D.; Radford, A.N. Repeated Exposure to Noise Increases Tolerance in a Coral Reef Fish. Environ. Pollut. 2016, 216, 428–436. [Google Scholar] [CrossRef]
  27. He, R.; Yang, W.; Duan, Y.; Zhou, T.; Li, Y.; Li, Y.; Liu, Z.; Shen, Y.; Chen, Q. Underwater Noise Impairs Reproduction in Zebrafish by Disrupting the Hypothalamic-Pituitary-Gonadal Axis. Aquac. Rep. 2025, 42, 102786. [Google Scholar] [CrossRef]
  28. Tao, H.; Zhang, Y.; Shen, Y.; Chen, Q.; Liu, Z. Endogenous 17β-Estradiol Regulates Sexually Dimorphic Anxiety Responses in Zebrafish via the HPI Axis and 5-HT/DA Pathways. Front. Mar. Sci. 2025, 12, 1541351. [Google Scholar] [CrossRef]
  29. Zhou, T.; Duan, Y.; Li, Y.; Yang, W.; Chen, Q. Effects of Underwater Noise Exposure on Early Development in Zebrafish. Animals 2025, 15, 2310. [Google Scholar] [CrossRef]
  30. Lara, R.A.; Vasconcelos, R.O. Impact of Noise on Development, Physiological Stress and Behavioural Patterns in Larval Zebrafish. Sci. Rep. 2021, 11, 6615. [Google Scholar] [CrossRef]
  31. Amoser, S.; Wysocki, L.E.; Ladich, F. Noise Emission during the First Powerboat Race in an Alpine Lake and Potential Impact on Fish Communities. J. Acoust. Soc. Am. 2004, 116, 3789–3797. [Google Scholar] [CrossRef]
  32. McCloskey, K.P.; Chapman, K.E.; Chapuis, L.; McCormick, M.I.; Radford, A.N.; Simpson, S.D. Assessing and Mitigating Impacts of Motorboat Noise on Nesting Damselfish. Environ. Pollut. 2020, 266, 115376. [Google Scholar] [CrossRef]
  33. Fu, C.-W.; Horng, J.-L.; Tong, S.-K.; Cherng, B.-W.; Liao, B.-K.; Lin, L.-Y.; Chou, M.-Y. Exposure to Silver Impairs Learning and Social Behaviors in Adult Zebrafish. J. Hazard. Mater. 2021, 403, 124031. [Google Scholar] [CrossRef] [PubMed]
  34. Salahinejad, A.; Attaran, A.; Naderi, M.; Meuthen, D.; Niyogi, S.; Chivers, D.P. Chronic Exposure to Bisphenol S Induces Oxidative Stress, Abnormal Anxiety, and Fear Responses in Adult Zebrafish (Danio rerio). Sci. Total Environ. 2021, 750, 141633. [Google Scholar] [CrossRef]
  35. Liu, S.; Yu, M.; Xie, X.; Ru, Y.; Ru, S. Carbofuran Induces Increased Anxiety-like Behaviors in Female Zebrafish (Danio rerio) through Disturbing Dopaminergic/Norepinephrinergic System. Chemosphere 2020, 253, 126635. [Google Scholar] [CrossRef]
  36. Zhang, J.; Liu, M.; Cui, W.; Yang, L.; Zhang, C. Quercetin Affects Shoaling and Anxiety Behaviors in Zebrafish: Involvement of Neuroinflammation and Neuron Apoptosis. Fish Shellfish Immunol. 2020, 105, 359–368. [Google Scholar] [CrossRef]
  37. Valcarce, D.G.; Martínez-Vázquez, J.M.; Riesco, M.F.; Robles, V. Probiotics Reduce Anxiety-Related Behavior in Zebrafish. Heliyon 2020, 6, e03973. [Google Scholar] [CrossRef]
  38. De Abreu, M.S.; Giacomini, A.C.V.V.; Genario, R.; Dos Santos, B.E.; Marcon, L.; Demin, K.A.; Kalueff, A.V. The Impact of Housing Environment Color on Zebrafish Anxiety-like Behavioral and Physiological (Cortisol) Responses. Gen. Comp. Endocrinol. 2020, 294, 113499. [Google Scholar] [CrossRef]
  39. Smith, M.E.; Kane, A.S.; Popper, A.N. Noise-Induced Stress Response and Hearing Loss in Goldfish (Carassius auratus). J. Exp. Biol. 2004, 207, 427–435. [Google Scholar] [CrossRef]
  40. Hosono, K.; Kikuchi, Y.; Miyanishi, H.; Hiraki-Kajiyama, T.; Takeuchi, A.; Nakasone, K.; Maehiro, S.; Okubo, K. Teleocortin: A Novel Member of the CRH Family in Teleost Fish. Endocrinology 2015, 156, 2949–2957. [Google Scholar] [CrossRef] [PubMed]
  41. Wunderink, Y.S.; Engels, S.; Halm, S.; Yúfera, M.; Martínez-Rodríguez, G.; Flik, G.; Klaren, P.H.M.; Mancera, J.M. Chronic and Acute Stress Responses in Senegalese Sole (Solea senegalensis): The Involvement of Cortisol, CRH and CRH-BP. Gen. Comp. Endocrinol. 2011, 171, 203–210. [Google Scholar] [CrossRef] [PubMed]
  42. Inda, C.; Armando, N.G.; Dos Santos Claro, P.A.; Silberstein, S. Endocrinology and the Brain: Corticotropin-Releasing Hormone Signaling. Endocr. Connect. 2017, 6, R99–R120. [Google Scholar] [CrossRef] [PubMed]
  43. DeMorrow, S. Role of the Hypothalamic–Pituitary–Adrenal Axis in Health and Disease. Int. J. Mol. Sci. 2018, 19, 986. [Google Scholar] [CrossRef]
  44. Maximino, C.; Puty, B.; Benzecry, R.; Araújo, J.; Lima, M.G.; De Jesus Oliveira Batista, E.; Renata De Matos Oliveira, K.; Crespo-Lopez, M.E.; Herculano, A.M. Role of Serotonin in Zebrafish (Danio rerio) Anxiety: Relationship with Serotonin Levels and Effect of Buspirone, WAY 100635, SB 224289, Fluoxetine and Para-Chlorophenylalanine (pCPA) in Two Behavioral Models. Neuropharmacology 2013, 71, 83–97. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, K.; Holschneider, D.P.; Wu, W.; Rebrin, I.; Shih, J.C. A Spontaneous Point Mutation Produces Monoamine Oxidase A/B Knock-out Mice with Greatly Elevated Monoamines and Anxiety-like Behavior. J. Biol. Chem. 2004, 279, 39645–39652. [Google Scholar] [CrossRef]
  46. Faria, M.; Bedrossiantz, J.; Ramírez, J.R.R.; Mayol, M.; García, G.H.; Bellot, M.; Prats, E.; Garcia-Reyero, N.; Gómez-Canela, C.; Gómez-Oliván, L.M.; et al. Glyphosate Targets Fish Monoaminergic Systems Leading to Oxidative Stress and Anxiety. Environ. Int. 2021, 146, 106253. [Google Scholar] [CrossRef]
  47. Ravindran, R.; Devi, R.S.; Samson, J.; Senthilvelan, M. Noise-Stress-Induced Brain Neurotransmitter Changes and the Effect of Ocimum sanctum (Linn) Treatment in Albino Rats. J. Pharmacol. Sci. 2005, 98, 354–360. [Google Scholar] [CrossRef]
  48. Singh, V.B.; Onaivi, E.S.; Phan, T.-H.; Boadle-Biber, M.C. The Increases in Rat Cortical and Midbrain Tryptophan Hydroxylase Activity in Response to Acute or Repeated Sound Stress Are Blocked by Bilateral Lesions to the Central Nucleus of the Amygdala. Brain Res. 1990, 530, 49–53. [Google Scholar] [CrossRef]
  49. Tang, Y.-Q.; Li, Z.-R.; Zhang, S.-Z.; Mi, P.; Chen, D.-Y.; Feng, X.-Z. Venlafaxine plus Melatonin Ameliorate Reserpine-Induced Depression-like Behavior in Zebrafish. Neurotoxicol. Teratol. 2019, 76, 106835. [Google Scholar] [CrossRef]
  50. Lillesaar, C. The Serotonergic System in Fish. J. Chem. Neuroanat. 2011, 41, 294–308. [Google Scholar] [CrossRef] [PubMed]
  51. Cheng, L.-Q.; Shu, F.-Q.; Zhang, M.; Kai, Y.-Z.; Tang, Z.-Q. Resveratrol Prevents Hearing Loss and a Subregion Specific- Reduction of Serotonin Reuptake Transporter Induced by Noise Exposure in the Central Auditory System. Front. Neurosci. 2023, 17, 1134153. [Google Scholar] [CrossRef]
  52. Yamamoto, K.; Ruuskanen, J.O.; Wullimann, M.F.; Vernier, P. Two Tyrosine Hydroxylase Genes in Vertebrates. Mol. Cell. Neurosci. 2010, 43, 394–402. [Google Scholar] [CrossRef] [PubMed]
  53. Kahlig, K.M.; Galli, A. Regulation of Dopamine Transporter Function and Plasma Membrane Expression by Dopamine, Amphetamine, and Cocaine. Eur. J. Pharmacol. 2003, 479, 153–158. [Google Scholar] [CrossRef] [PubMed]
  54. Sallinen, V.; Sundvik, M.; Reenilä, I.; Peitsaro, N.; Khrustalyov, D.; Anichtchik, O.; Toleikyte, G.; Kaslin, J.; Panula, P. Hyperserotonergic Phenotype after Monoamine Oxidase Inhibition in Larval Zebrafish. J. Neurochem. 2009, 109, 403–415. [Google Scholar] [CrossRef] [PubMed]
Animals 16 00536 g001
Figure 1. Effects of daytime and nighttime noise on anxiety-like behavior in zebrafish. (A,D) Latency to first enter the top zone, (B,E) total time spent in the bottom zone, and (C,F) frequency of entries into the top zone in female (A–C) and male (D–F) zebrafish. Data represent mean ± SEM (n = 18). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Figure 1. Effects of daytime and nighttime noise on anxiety-like behavior in zebrafish. (A,D) Latency to first enter the top zone, (B,E) total time spent in the bottom zone, and (C,F) frequency of entries into the top zone in female (A–C) and male (D–F) zebrafish. Data represent mean ± SEM (n = 18). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Animals 16 00536 g001
Animals 16 00536 g002
Figure 2. Plasma cortisol levels and HPI axis gene expression in zebrafish. (A,C) Plasma cortisol concentrations and (B,D) relative mRNA expression levels of HPI axis-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included approximately 15 fish for cortisol, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Figure 2. Plasma cortisol levels and HPI axis gene expression in zebrafish. (A,C) Plasma cortisol concentrations and (B,D) relative mRNA expression levels of HPI axis-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included approximately 15 fish for cortisol, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Animals 16 00536 g002
Animals 16 00536 g003
Figure 3. Brain serotonin (5-HT) levels and related gene expression in zebrafish. (A,C) Brain 5-HT concentrations and (B,D) relative mRNA expression levels of 5-HT pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for 5-HT, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Figure 3. Brain serotonin (5-HT) levels and related gene expression in zebrafish. (A,C) Brain 5-HT concentrations and (B,D) relative mRNA expression levels of 5-HT pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for 5-HT, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Animals 16 00536 g003
Animals 16 00536 g004
Figure 4. Brain dopamine (DA) levels and related gene expression in zebrafish. (A,C) Brain DA concentrations and (B,D) relative mRNA expression levels of DA pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for DA, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Figure 4. Brain dopamine (DA) levels and related gene expression in zebrafish. (A,C) Brain DA concentrations and (B,D) relative mRNA expression levels of DA pathway-related genes in female (A,B) and male (C,D) zebrafish. Data represent mean ± SEM (n = 3 replicates. Each replicate included 6 fish for DA, 3 fish for gene expression). Different lowercase letters indicate significant differences between groups by Tukey’s HSD post hoc test (p < 0.05).
Animals 16 00536 g004
Table 1. Primers sequences for RT-qPCR of genes associated with stress response and anxiety-like behavior in zebrafish.
Table 1. Primers sequences for RT-qPCR of genes associated with stress response and anxiety-like behavior in zebrafish.
GeneSequence (5′ to 3′)Size (bp)Accession NO.
crhaF 1: AGACAGCAGACTCTCACCGACA
R 2: GGACACCGCAACGACAACCA		100XM009298729.3
crhbF: GGAGCCGCCGATTTCCCTAGAT
R: GCTGATGGGTTCGCTTGTGGTT		147NM001007379.1
crhbpF: ACAGCAGAGCGACCGCAGTTA
R: ACCCTTCATCACCCAGCCATCA		144NM001003459.1
crhr1F: GTGGCATCGCTGGCAAGACAA
R: ACGGCTGACGACTGCTTGATAC		114XM691254.6
crhr2F: GGCGACCTCAACTGTACTCTCC
R: TTCATCCGTGGTGGCGTTACAA		111NM001113644.1
acthaF: CGAGCAAACGCAAAGACAACCA
R: CCAAGAGCCAAGCAGGACACAA		127NM181438.3
acthbF: GCACCACCAGACAAACGATACG
R: GAACTGCTGTCCATTGCCGATG		108NM001083051.1
tph1bF: TCGGAGGACTTGTCAAGGCATT
R: TGTCACAATCCACCAGCACTTC		120NM001001843.2
tph2F: GTGCTACCAGGAGTGCCTCATT
R: ATGCTCTGCGTGTAAGGGTTGT		147NM214795.2
slc6a4aF: TCAGTGCAAGAGGACCACCATC
R: CACAACCAGCCTGCCGTTCT		139NM001039972.1
htr1aaF: GCGACGAGTGTCAGCGAAGTTG
R: TCCAAGGCGATAGCAGCGATGA		119NM001123321.1
htr1abF: GCGTGTGTTGTGGCGGCTAT
R: AGCACGAGCACCGACACCAT		107NM001145766.1
htr1bF: TGCGTTTGTCATTGCCACCATT
R: CACGAGCACCGACACCAGAA		106NM001128709.1
maoF: ACACGGACGGACAGCACCAT
R: TCTTCCACCAACACGGCTTCTG		147NM212827.3
thF: GACTGAGCGAGCAGATCGTGTT
R: TTCGGCTGGGTCTGGTTTCAAG		162NM131149.1
drd2aF: CCAAGAGGAGAGTCACCGTCAT
R: AAGGCAGGATTCGCAATCACAC		133NM183068.1
drd2bF: TGCCATGCTCCTGACTCTCCTC
R: GCCACCGCCAAGCTGACAAT		126NM197936.1
slc6a3F: TTCAGTTCACCTCCTCCAGCCT
R: ATCCACAGCGAAGCCGATGAC		146NM131755.1
comtaF: TGGTGGTGGTGTTGGCATCTG
R: CGCTGTGGTCGTGATAGTCCTG		127NM001030157.2
comtbF: TGTTGGAGATGAGAAAGGCTGT
R: CGAGCGATGCGAACTGTAGA		111NM001083843.1
slc18a2F: CACAGATGACGAGGAACGAGGA
R: TGCCAGCACTGCCAGGATAAG		145NM001256225.2
ef1αF: GATCACTGGTACTTCTCAGGCTGA
R: GGTGAAAGCCAGGAGGGC		121FJ915061
β-actinF: CGAGCTGTCTTCCCATCCA
R: TCACCAACGTAGCTGTCTTTCTG		86AF025305.1
1 F: forward primer; 2 R: reverse primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, W.; Duan, Y.; Zhou, T.; Zhang, Z.; Li, Y.; Huang, H.; Xiong, M.; Chen, Q. Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish. Animals 2026, 16, 536. https://doi.org/10.3390/ani16040536

AMA Style

Yang W, Duan Y, Zhou T, Zhang Z, Li Y, Huang H, Xiong M, Chen Q. Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish. Animals. 2026; 16(4):536. https://doi.org/10.3390/ani16040536

Chicago/Turabian Style

Yang, Wei, Yuchi Duan, Tong Zhou, Zhiming Zhang, Ya Li, Hui Huang, Mantang Xiong, and Qiliang Chen. 2026. "Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish" Animals 16, no. 4: 536. https://doi.org/10.3390/ani16040536

APA Style

Yang, W., Duan, Y., Zhou, T., Zhang, Z., Li, Y., Huang, H., Xiong, M., & Chen, Q. (2026). Anthropogenic Underwater Noise Induces Anxiety-like Behavior in Zebrafish. Animals, 16(4), 536. https://doi.org/10.3390/ani16040536

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop