Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Piglet Experiment
2.1.1. Design of Experiment
2.1.2. Sample Collection
2.1.3. Morphological Examination of Intestinal Tissue
2.1.4. Measurement of Inflammatory Mediators and Gut Permeability Markers
2.1.5. Measurements of Antioxidant Capacity
2.1.6. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
2.1.7. Protein Extraction and Western Blot
2.2. Cell Experiments
2.2.1. IPEC-J2 Cell Cultures
2.2.2. Treatments for Oxidative Stress and BAPs in IPEC-J2 Cells
2.2.3. Immunofluorescence
2.3. Statistical Analysis
3. Results
3.1. BAPs Influenced Growth Performance in Piglets
3.2. BAPs Influenced Intestinal Barrier in Piglets
3.3. BAPs Influenced Antioxidant Capacity in Piglets
3.4. BAPs Influenced Barrier Function in IPEC-J2 Cells
3.5. BAPs Influenced Antioxidant Capacity in IPEC-J2 Cells
3.6. BAPs Influenced Nrf2 Signaling Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Conway, E.; Sweeney, T.; Dowley, A.; Vigors, S.; Ryan, M.; Yadav, S.; Wilson, J.; O’Doherty, J.V. Selenium-Enriched Mushroom Powder Enhances Intestinal Health and Growth Performance in the Absence of Zinc Oxide in Post-Weaned Pig Diets. Animals 2022, 12, 1503. [Google Scholar] [CrossRef] [PubMed]
- O’Doherty, J.V.; Venardou, B.; Rattigan, R.; Sweeney, T. Feeding Marine Polysaccharides to Alleviate the Negative Effects Associated with Weaning in Pigs. Animals 2021, 11, 2644. [Google Scholar] [CrossRef]
- Sun, Z.; Li, H.; Li, Y.; Qiao, J. Lactobacillus salivarius, a Potential Probiotic to Improve the Health of LPS-Challenged Piglet Intestine by Alleviating Inflammation as Well as Oxidative Stress in a Dose-Dependent Manner During Weaning Transition. Front. Vet. Sci. 2020, 7, 547425. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, D.M.; Leclercq, C.C.; Charton, S.A.B.; Costa, M.M.; Carvalho, D.F.P.; Cocco, E.; Sergeant, K.; Renaut, J.; Freire, J.P.B.; Prates, J.A.M.; et al. Enhanced ileum function in weaned piglets via Laminaria digitata and alginate lyase dietary inclusion: A combined proteomics and metabolomics analysis. J. Proteom. 2023, 289, 105013. [Google Scholar] [CrossRef]
- Li, Q.; Zheng, T.; Ding, H.; Chen, J.; Li, B.; Zhang, Q.; Yang, S.; Zhang, S.; Guan, W. Exploring the Benefits of Probiotics in Gut Inflammation and Diarrhea—From an Antioxidant Perspective. Antioxidants 2023, 12, 1342. [Google Scholar] [CrossRef]
- Soldado, D.; Bessa, R.J.B.; Jerónimo, E. Condensed Tannins as Antioxidants in Ruminants—Effectiveness and Action Mechanisms to Improve Animal Antioxidant Status and Oxidative Stability of Products. Animals 2021, 11, 3243. [Google Scholar] [CrossRef]
- Wang, L.; Li, W.; Xin, S.; Wu, S.; Peng, C.; Ding, H.; Feng, S.; Zhao, C.; Wu, J.; Wang, X. Soybean glycinin and β-conglycinin damage the intestinal barrier by triggering oxidative stress and inflammatory response in weaned piglets. Eur. J. Nutr. 2023, 62, 2841–2854. [Google Scholar] [CrossRef]
- Tian, J.; Jiang, Q.; Bao, X.; Yang, F.; Li, Y.; Sun, H.; Yao, K.; Yin, Y. Plant-derived squalene supplementation improves growth performance and alleviates acute oxidative stress-induced growth retardation and intestinal damage in piglets. Anim. Nutr. 2023, 15, 386–398. [Google Scholar] [CrossRef]
- Zha, A.; Tu, R.; Qi, M.; Wang, J.; Tan, B.; Liao, P.; Wu, C.; Yin, Y. Mannan oligosaccharides selenium ameliorates intestinal mucosal barrier, and regulate intestinal microbiota to prevent Enterotoxigenic Escherichia coli -induced diarrhea in weaned piglets. Ecotoxicol. Environ. Safe. 2023, 264, 115448. [Google Scholar] [CrossRef]
- Huang, P.; Cui, X.; Wang, Z.; Xiao, C.; Ji, Q.; Wei, Q.; Huang, Y.; Bao, G.; Liu, Y. Effects of clostridium butyricum and a bacteriophage cocktail on growth performance, serum biochemistry, digestive enzyme activities, intestinal morphology, immune responses, and the intestinal microbiota in rabbits. Antibiotics 2021, 10, 1347. [Google Scholar] [CrossRef]
- Silva, M.; Avni, D.; Varela, J.; Barreira, L. The ocean’s pharmacy: Health discoveries in marine algae. Molecules 2024, 29, 1900. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Liang, M.; Ouyang, D.; Tong, H.; Wu, M.; Su, L. Research Progress on the Protective Effect of Brown Algae-Derived Polysaccharides on Metabolic Diseases and Intestinal Barrier Injury. Int. J. Mol. Sci. 2022, 23, 10784. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Wang, F.; Yan, Y.; Jin, J.; Quan, Z.; Tong, H.; Du, J. Fucoidan derived from Sargassum pallidum alleviates metabolism disorders associated with improvement of cardiac injury and oxidative stress in diabetic mice. Phytother. Res. 2023, 37, 4210–4223. [Google Scholar] [CrossRef] [PubMed]
- Zargari, A.; Nejatian, M.; Abbaszadeh, S.; Jahanbin, K.; Bagheri, T.; Hedayati, A.; Sheykhi, M. Modulation of toxicity effects of CuSO4 by sulfated polysaccharides extracted from brown algae (Sargassum tenerrimum) in Danio rerio as a model. Sci. Rep. 2023, 13, 11429. [Google Scholar] [CrossRef]
- Oladejo, E.O.; Hasan, M.S.; Sotak, S.C.; Htoo, J.K.; Brett, J.; Feugang, J.M.; Liao, S.F. Effects of Dietary Supplementation of DL-Methionine or DL-Methionine Hydroxyl Analogue (MHA-Ca) on Growth Performance and Blood and Liver Redox Status in Growing Pigs. Animals 2024, 14, 3397. [Google Scholar] [CrossRef]
- Zhang, P.; Jiang, G.; Ma, C.; Wang, Y.; Yan, E.; He, L.; Guo, J.; Zhang, X.; Yin, J. Dietary supplementation of laminarin improves the reproductive performance of sows and the growth of suckling piglets. J. Anim. Sci. Biotechnol. 2023, 14, 114. [Google Scholar] [CrossRef]
- Wang, Z.; Yi, Z.; Wang, Q.; Yin, L.; Li, J.; Xie, J.; Yang, H.; Yin, Y. Effect of Different Levels of Niacin on Serum Biochemical Parameters, Antioxidant Status, Cytokine Levels, Inflammatory Gene Expression and Colonic Microbial Composition in Weaned Piglets. Animals 2022, 12, 3018. [Google Scholar] [CrossRef]
- Wu, J.; Wang, J.; Lin, Z.; Liu, C.; Zhang, Y.; Zhang, S.; Zhou, M.; Zhao, J.; Liu, H.; Ma, X. Clostridium butyricum alleviates weaned stress of piglets by improving intestinal immune function and gut microbiota. Food Chem. 2023, 405, 135014. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Tanna, B.; Mishra, A. Nutraceutical Potential of Seaweed Polysaccharides: Structure, Bioactivity, Safety, and Toxicity. Compr. Rev. Food Sci. F 2019, 18, 817–831. [Google Scholar] [CrossRef]
- Gou, F.; Cai, F.; Li, X.; Lin, Q.; Zhu, J.; Yu, M.; Chen, S.; Lu, J.; Hu, C. Mitochondria-associated endoplasmic reticulum membranes involve in oxidative stress-induced intestinal barrier injury and mitochondrial dysfunction under diquat exposing. Environ. Toxicol. 2024, 39, 3906–3919. [Google Scholar] [CrossRef]
- Tan, B.; Xiao, D.; Wang, J.; Tan, B. The Roles of Polyamines in Intestinal Development and Function in Piglets. Animals 2024, 14, 1228. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Wu, H.; Wang, C.; Zhang, Q.; Jiao, L.; Lin, F.; Hu, C.H. Diquat-induced oxidative stress increases intestinal permeability, impairs mitochondrial function, and triggers mitophagy in piglets. J. Anim. Sci. 2018, 96, 1795–1805. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Wang, C.; Zhu, J.; Lin, Q.; Yu, M.; Wen, J.; Feng, J.; Hu, C. Sodium Butyrate Ameliorates Oxidative Stress-Induced Intestinal Epithelium Barrier Injury and Mitochondrial Damage through AMPK-Mitophagy Pathway. Oxid. Med. Cell. Longev. 2022, 2022, 3745135. [Google Scholar] [CrossRef]
- Zhi, Y.; Li, T.; Li, Y.; Zhang, T.; Du, M.; Zhang, Q.; Wang, X.; Hu, G. Protective role of Cecropin AD against LPS-induced intestinal mucosal injury in chickens. Front. Immunol. 2023, 14, 1290182. [Google Scholar] [CrossRef]
- Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef]
- Rahman, I.; Adcock, I.M. Oxidative stress and redox regulation of lung inflammation in COPD. Eur. Respir. J. 2006, 28, 219–242. [Google Scholar] [CrossRef]
- Kageyama, H.; Waditee-Sirisattha, R. Antioxidative, Anti-Inflammatory, and Anti-Aging Properties of Mycosporine-Like Amino Acids: Molecular and Cellular Mechanisms in the Protection of Skin-Aging. Mar. Drugs 2019, 17, 222. [Google Scholar] [CrossRef]
- Sul, O.J.; Ra, S.W. Quercetin Prevents LPS-Induced Oxidative Stress and Inflammation by Modulating NOX2/ROS/NF-kB in Lung Epithelial Cells. Molecules. 2021, 26, 6949. [Google Scholar] [CrossRef]
- Sanjeewa, K.; Jayawardena, T.; Kim, S.; Kim, H.; Ahn, G.; Kim, J.; Jeon, Y. Fucoidan isolated from invasive Sargassum horneri inhibit LPS-induced inflammation via blocking NF-κB and MAPK pathways. Algal Res. 2019, 41, 101561. [Google Scholar] [CrossRef]
- Jayawardena, T.U.; Fernando, I.P.S.; Lee, W.W.; Sanjeewa, K.K.A.; Kim, H.S.; Lee, D.S.; Jeon, Y.J. Isolation and purification of fucoidan fraction in Turbinaria ornata from the Maldives; Inflammation inhibitory potential under LPS stimulated conditions in in-vitro and in-vivo models. Int. J. Biol. Macromol. 2019, 131, 614–623. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Lu, Y.; Yue, Z.; Jin, S.; Wang, P.; Liu, C.; Wang, L.; Yin, Q.; Dang, X.; Guo, H.; et al. 6-Gingerol activates the Nrf2 signaling pathway to alleviate hydrogen peroxide induced oxidative stress on primary chicken embryo hepatocytes. J. Funct. Foods 2024, 122, 106535. [Google Scholar] [CrossRef]
- Dai, H.; Chen, X.; He, J.; Zheng, P.; Luo, Y.; Yu, B.; Chen, D.; Huang, Z. Dietary L-theanine supplementation improves antioxidant capacity and lipid metabolism in finishing pigs. J. Funct. Foods 2023, 110, 105831. [Google Scholar] [CrossRef]
- Huang, T.; Che, Q.; Chen, X.; Chen, D.; Yu, B.; He, J.; Chen, H.; Yan, H.; Zheng, P.; Luo, Y.; et al. Apple Polyphenols Improve Intestinal Antioxidant Capacity and Barrier Function by Activating the Nrf2/Keap1 Signaling Pathway in a Pig Model. J. Agric. Food Chem. 2022, 70, 7576–7585. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.H.; Yang, J.J.; Tang, P.J.; Zhu, Y.; Chen, Z.; She, C.; Chen, G.; Cao, P.; Xu, X.Y. A novel Keap1 inhibitor iKeap1 activates Nrf2 signaling and ameliorates hydrogen peroxide-induced oxidative injury and apoptosis in osteoblasts. Cell Death Dis. 2021, 12, 679. [Google Scholar] [CrossRef]





| Item | Basal Diet | BAP Diet a |
|---|---|---|
| Ingredients (%) | ||
| Corn | 65.30 | 65.17 |
| Soybean meal | 16.97 | 17.00 |
| Brown algal polysaccharides | — | 0.10 |
| Extruded full-fat soybean | 2.00 | 2.00 |
| Soy protein concentrate | 3.00 | 3.00 |
| Fish meal | 3.00 | 3.00 |
| Whey powder | 6.00 | 6.00 |
| Soybean oil | 0.40 | 0.40 |
| Limestone | 0.75 | 0.75 |
| Dicalcium phosphate | 0.80 | 0.80 |
| NaCl | 0.50 | 0.50 |
| L-lysine HCl | 0.45 | 0.45 |
| L-Threonine | 0.16 | 0.16 |
| L-Tryptophan | 0.07 | 0.07 |
| L-Methionine | 0.10 | 0.10 |
| Premix b | 0.50 | 0.50 |
| Total | 100.00 | 100.00 |
| Nutrient levels c | ||
| DM | 88.33 | 88.34 |
| Ash | 4.94 | 4.61 |
| CP | 17.30 | 17.16 |
| EE | 2.75 | 3.00 |
| NDF | 10.62 | 10.41 |
| ADF | 4.82 | 4.11 |
| GE (MJ/kg) | 15.99 | 16.03 |
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| GAPDH | CGGAGTGAACGGATTTGGC | CACCCCATTTGATGTTGGCG |
| ZO-1 | GAAATACCTGACGGTGCTGC | GAGGATGGCGTTACCCACAG |
| Occludin | CAGGTGCACCCTCCAGATTG | TATGTCGTTGCTGGGTGCAT |
| CAT | TGGCTGAGTCCGAAGTCGTC | AAGTAGCCAAAAGCCCCTGCT |
| SOD1 | AGGGCACCATCTACTTCGAG | GCACTGGTACAGCCTTGTGT |
| SOD2 | AGGCGCTGAAAAAGGGTGAT | GACGGATACAGCGGTCAACT |
| GPX1 | ACGCTCGGTGTATGCCTTC | CCCATTCTTGGCATTTTCCTGAT |
| NQO1 | GTATAAAGTAGCCGGGCGCT | AGTGCTTTTCTGACCGCCAT |
| Item | CON | DIQ | BAP | BAP+DIQ | p-Value |
|---|---|---|---|---|---|
| Initial weight (kg) | 8.03 ± 0.38 | 8.06 ± 0.44 | 8.24 ± 0.45 | 8.61 ± 0.43 | 0.753 |
| Final weight (kg) | 22.08 ± 0.125 a | 18.45 ± 0.98 b | 22.87 ± 0.83 a | 20.38 ± 1.13 ab | 0.036 |
| 21~28 d | |||||
| Average daily gain (kg) | 0.76 ± 0.07 a | 0.36 ± 0.07 b | 0.77 ± 0.04 a | 0.43 ± 0.07 b | <0.001 |
| Average daily intake (kg) | 1.27 ± 0.06 a | 0.81 ± 0.05 b | 1.27 ± 0.09 a | 0.76 ± 0.07 b | <0.001 |
| Feed: Gain | 1.71 ± 0.09 | 2.04 ± 0.16 | 1.64 ± 0.05 | 1.93 ± 0.23 | 0.228 |
| 0~28 d | |||||
| Average daily gain (kg) | 0.50 ± 0.04 ac | 0.39 ± 0.02 b | 0.52 ± 0.02 a | 0.42 ± 0.04 bc | 0.016 |
| Average daily intake (kg) | 0.87 ± 0.04 a | 0.70 ± 0.05 b | 0.89 ± 0.05 a | 0.72 ± 0.05 b | 0.021 |
| Feed: Gain | 1.75 ± 0.07 | 1.75 ± 0.07 | 1.69 ± 0.03 | 1.74 ± 0.04 | 0.855 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, C.; Yu, Z.; Shi, C.; Huang, Y.; Liu, H. Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway. Animals 2025, 15, 559. https://doi.org/10.3390/ani15040559
Hou C, Yu Z, Shi C, Huang Y, Liu H. Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway. Animals. 2025; 15(4):559. https://doi.org/10.3390/ani15040559
Chicago/Turabian StyleHou, Chunjie, Zirou Yu, Chenyu Shi, Ya Huang, and Hu Liu. 2025. "Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway" Animals 15, no. 4: 559. https://doi.org/10.3390/ani15040559
APA StyleHou, C., Yu, Z., Shi, C., Huang, Y., & Liu, H. (2025). Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway. Animals, 15(4), 559. https://doi.org/10.3390/ani15040559
