Next Article in Journal
Variability in Morphological Traits and Nutritional Profiles of Adult Eriocheir sinensis in Different Aquacultural Regions
Next Article in Special Issue
Pro-Angiogenic Effects of Canine Platelet-Rich Plasma: In Vitro and In Vivo Evidence
Previous Article in Journal
Vertical Movement of Head, Withers, and Pelvis of High-Level Dressage Horses Trotting in Hand vs. Being Ridden
Previous Article in Special Issue
Evaluation of the Effects of Autologous Leukocyte- and Platelet-Rich Fibrin Membranes for Treating Chronic Wounds: A Prospective Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD)

1
Reproduction Laboratory, Department of Veterinary Medicine and Animal Science, Università degli Studi di Milano, 26900 Lodi, Italy
2
Department of Veterinary Medicine and Animal Science, Università degli Studi di Milano, 26900 Lodi, Italy
3
Laboratorio di Malattie Infettive degli Animali (MiLab), Department of Veterinary Medicine and Animal Science, Università degli Studi di Milano, 26900 Lodi, Italy
*
Author to whom correspondence should be addressed.
Animals 2025, 15(2), 242; https://doi.org/10.3390/ani15020242
Submission received: 4 December 2024 / Revised: 2 January 2025 / Accepted: 10 January 2025 / Published: 16 January 2025

Simple Summary

Mesenchymal stromal cells are used for their regenerative properties both in human and veterinary medicine. Usually, these cells are collected from bone marrow or adipose tissue, but methods that allow a simple, economical, and non-invasive collection of cells would encourage their use. One easily accessible alternative source would be urine. In 2008, urine mesenchymal stromal cells were isolated for the first time from human urine. These cells come from the kidney and would, therefore, be ideal for use in the treatment of kidney/genitourinary diseases. In this paper, urine mesenchymal stromal cells were isolated from healthy dogs and dogs affected by chronic kidney disease. Three collection methods (spontaneous micturition, bladder catheterization, and cystocentesis) were compared and cells were analyzed for their mesenchymal properties. The isolated cells met the criteria set by the international society of stem cell therapy to be defined as stem cells. Cells isolated from sick dogs proliferated more readily than those isolated from healthy dogs and may provide a therapeutic option for the treatment of chronic kidney disease. However, in this study, cells could only be isolated from urine samples collected through cystocentesis.

Abstract

Urine-derived mesenchymal stromal/stem cells (USCs) could be a valuable source of cells in regenerative medicine because urine can be easily collected non-invasively. In this paper, USCs were isolated from both healthy dogs and dogs affected by chronic kidney disease (CKD), and the efficacy of collection methods (spontaneous micturition, bladder catheterization, and cystocentesis) were compared. Isolated cells were cultured in the presence of platelet-rich plasma and studied for their proliferative capacity (growth curve, doubling time, and colony forming unit), differentiation properties, expression of mesenchymal markers, and Klotho protein. Morphologically, all cells were elongated and fibroblast-like. USCs isolated from samples collected by spontaneous micturition and bladder catheterization failed to proliferate, whilst USCs obtained by cystocentesis showed a doubling time of 2.04 days in healthy dogs and 1.7 days in dogs with CKD (p < 0.05). Cells were able to differentiate into osteogenic, chondrogenic, and adipogenic lines, showed positive expression to mesenchymal/stem markers, negative expression to hematopoietic markers, and major histocompatibility complex (MHCII) antigen. Klotho protein expression was confirmed. This study confirmed that USCs from healthy and CKD dogs can act as stem cells, with those from sick dogs having greater proliferative ability with the potential for use as autologous therapies.

1. Introduction

Mesenchymal stromal/stem cells (MSCs) can be derived from different tissues but are predominantly sourced from adipose tissue and bone marrow. These two sources have long been studied and have been used in many experimental and preclinical studies. However, these MSCs are obtained through invasive procedures and have prolonged in vitro proliferation times, as studied in equine and canine species [1,2]. Therefore, in recent decades, other sources of MSCs have been studied, such as extra-fetal adnexa in equine species [3] and urine-derived stem cells (USCs) in human medicine [4]. These are considered waste biological material, and cells can be isolated and amplified using simple, non-invasive, painless, and cheap procedures.
The presence of cells with stem cell properties in urine was described in human species by Zhang et al. [4].
Urine-derived stem cells show the classic features of MSCs, expressing some markers related to stemness and pluripotency, high telomerase activity, and do not form teratomas when injected into immunodeficient mice [5]. They have been reported to be able to differentiate into a huge variety of cell types in addition to osteogenic, chondrogenic, and adipogenic lineages [5], as required by the definitions of the international society of stem cell therapy (ISCT) [6]. Indeed, these USCs can differentiate into cardiomyocytes, motor neurons, alveolar epithelial cells, hepatocytes, retinal organoids, renal organoids and, moreover, they can be transformed into induced pluripotent stem cells (iPSCs) [5]. Some authors have described the differentiation of USCs into endothelial, neuronal, skeletal myogenic, renal cells, podocytes, and tubular epithelial cells, which is of great importance considering USC’s potential as renal repair cells [7,8]. Given their characteristics, USCs have been assessed for potential applications in regenerative medicine. They have been used for the first time in urinary tissue engineering [9]: human USC were seeded in bacterial cellulose scaffolds and induced to differentiate into urothelial and smooth muscle cells into athymic mice. In vivo, the cells appeared to differentiate and express urothelial and smooth muscle cell markers. Urine-derived cells have subsequently been employed in other experimental studies to understand their therapeutic potential in various pathologies, as reported in Yu’s review [10]. Stress urinary incontinence was tested on rats; erectile dysfunction was studied in a rat model, in which these cells promote the growth of new blood vessels and nerve cells in the penis, improving erectile function [11]. Also, acute kidney injury was studied [12]: this is an extremely dangerous syndrome in the human species with high morbidity and mortality, which makes it necessary for the wide use of rat models to be uses to test the differentiation, anti-inflammatory, antioxidative stress, and antifibrotic response of human urine-derived cell treatment. Finally, diabetic nephropathy [13] remains one of the most severe complications linked to diabetes mellitus, with damage to glomerular podocytes: in a rat model, the use of human urine-derived exosomal microRNA-16 promoted the proliferation of podocytes and inhibited their apoptosis, alleviating the damage inflicted by diabetic nephropathy and protecting against podocyte injury.
They have also been used in pathologies affecting organs evolutionarily distant from the kidney, such as myocardial cells in a rat model [14], inflammatory bowel disease in a murine model [15], bone and cartilage regeneration in rats [8,16], and wound healing in a mouse model [17].
The potential of USCs for renal/genitourinary repair is particularly attractive as these cells directly originate from this district. Therefore, they might have some specific intrinsic properties that distinguish them from other types of stem cells. According to Kim et al. [18], USCs used in kidney disease could have an enhanced homing effect due to their renal origin; moreover, the same authors demonstrated that these cells express more Klotho protein than other cells. This protein has an important anti-fibrotic effect, and its serum concentration decreases with the progression of chronic kidney disease. Doi et al. [19] demonstrated the reno-protective effects of Klotho on a mouse model of induced renal fibrosis, mediated by the binding of this protein to the TGF-B receptor. Recently, USCs were shown to attenuate renal fibrosis via Klotho activation [20].
The specific origin of USCs and their anti-fibrotic effect, due to the Klotho protein, make these cells an interesting source for kidney regeneration, and thus in the treatment of CKD. Chronic kidney disease is a long-term condition characterized by structural and/or functional kidney abnormalities lasting more than three months. CKD in dogs may occasionally have a familial origin but is more commonly acquired. Potential causes include glomerular diseases, but also infections, nephrotoxicity, previous acute kidney injury (AKI), ischemia, and urinary obstructions. In many cases CKD progresses to interstitial fibrosis which, regardless of the initial cause, determines prognosis.
Since the kidneys have limited regenerative capacity, kidney fibrosis usually proceeds irreversibly leading to the “end stage” condition [21,22].
Potential treatments for this pathology are often aimed at delaying and suppressing fibrosis or inducing the reconstruction of damaged kidney tissue. In a rat model, Zhang et al. [14] demonstrated the protective effect of USCs on the nephron by injecting these cells into the kidney parenchyma, where they showed antioxidant, anti-inflammatory, and antifibrotic activity in CKD. Extracellular vesicles (EVs) present in urine, administered in an experimental murine model of acute kidney injury, also stimulated tubule cell proliferation and reduced inflammation through the transfer of miRNAs and Klotho to resident kidney cells [23].
USCs can be considered as a potential new player for future cell therapy. Urine is a convenient substrate for autologous cell therapy and USCs can be isolated from urine collected through spontaneous micturition, which is a non-invasive and inexpensive method. This suggests the potential for generating a donor biobank without ethical problems.
The literature suggests that the characteristics of USCs could be linked to different isolation techniques or to different donors, as has been shown for other stem cell types [24]. The aim of this study was to compare three different techniques for the collection of urine-derived cells (spontaneous micturition, bladder catheterization and cystocentesis) from healthy dogs and dogs affected by CKD and to compare the proliferative and differentiative potential of these cells.
The results show that it is possible to isolate canine USCs from healthy animals using a variety of urine collection methods, while in CKD dogs this is only possible by cystocentesis. However, this MSC source could represent a useful starting point for future autologous therapy.

2. Materials and Methods

2.1. Reagent

All reagents were purchased from Sigma-Aldrich (Milan, Italy), while test tubes and culture plates were purchased from Euroclone (Milan, Italy). Blood agar plates were purchased from Microbiol srl (Cagliari, Italy).

2.2. Ethics

Urine samples were collected from client-owned dogs referred to the internal medicine unit of the Veterinary Teaching Hospital (VTH) of Università degli Studi di Milano as a part of routine health screening. Written informed consent was provided by the owners for the use of residual aliquots of clinical samples for research purposes. Established internationally recognized ‘best practice’ standards for individual veterinary patient care were followed to collect biological samples. Consequently, according to the guidelines of the institutional Ethics Committee (protocol number 2/2016), no further approval from the Institutional Animal Care and Use Committee was required.

2.3. Experimental Design

The study comprised: a selection of animals, the isolation and culture of urine cells, study of their proliferative potential, differentiating capacity, analysis of mesenchymal markers and Klotho expression. All analyzes were performed on pooled urine-derived cells from both healthy and sick dogs.

2.4. Animals

Urine samples were collected from nine healthy dogs that were scheduled to undergo ovariohysterectomy or orchiectomy during routine bladder emptying prior to surgery. The samples were collected by either spontaneous micturition, bladder catheterization, or cystocentesis and were transported to the laboratory in sterile syringes or containers without preservatives.
Urine samples from 11 dogs of different breeds, sex, and age affected by CKD were also included in the study. The diagnosis and staging of CKD were made in accordance with the current guidelines of the International Renal Interest Society (IRIS). Each dog met at least one the following criteria: persistent sCr levels above 1.4 mg/dL, and/or persistent renal proteinuria (UPC ratio > 0.5), and/or inadequate urine concentrating ability without identifiable renal cause and/or ultrasonographic abnormalities suggestive of CKD. All the samples were collected by cystocentesis during routine follow-up visits for the monitoring of disease progression.

2.5. Bacteriological Analysis

After collection, each sample was immediately transported to the Laboratory of Animal Infectious Diseases (MiLab), University of Milan, Lodi for bacteriological analysis. Briefly, 10 mL of each urine sample was plated onto blood agar plates (5% defibrinated sheep blood (Microbiol, Cagliari, Italy). Plates were incubated aerobically at 37 °C and evaluated after 24 and 48 h. In case of bacterial growth, the isolates were subjected to identification by MALDI-TOF-MS (Matrix-assisted laser desorption ionization-time of flight mass spectrometry) using the Bruker MALDI Biotyper System (Bruker Scientific, Billerica, MA, USA).

2.6. Cell Isolation and Culture

The collection of urine by catheterization and cystocentesis was performed in healthy dogs undergoing ovariohysterectomy or orchiectomy after premedication with intramuscular dexmedetomidine 0.004–0.006 mg/kg and butorphanol 0.2–0.4 mg/kg followed by induction with intravenous propofol 2–3 mg/kg with isoflurane 1.0–1.5%. Postoperative pain management consisted of meloxicam 0.2 mg/kg subcutis immediately after recovery from anesthesia followed by meloxicam 0.1 mg/kg orally once daily for 2–4 days.
Catheterization was carried out with sterile catheters.
Cystocentesis samples were collected from three healthy dogs and from all sick dogs using a sterile needle and syringe.
Urine samples were maintained at 4 °C, transported to the laboratory within 2 h, and immediately processed as described by Xu et al. [2] with some modifications, in brief:
Urine samples were transferred into sterile tubes and centrifuged for 10 min at 400× g at room temperature (RT). The pellet (not always visible) was gently resuspended with 10 mL phosphate-buffered saline solution (PBS; Euroclone, Milan, Italy) containing 100 U/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/mL amphotericin B (Euroclone). The mixture was centrifuged at 200× g for 10 min, and the supernatant was discarded. A culture medium, “complete urine medium”, i.e., Dulbecco’s Modified Eagle’s Medium high glucose (HG-DMEM, Euroclone) supplemented with 20% of fetal bovine serum (FBS), 10 ng/mL epidermal growth factor (EGF), 100 U/mL penicillin, 100 μg/mL streptomycin, 0.25 μg/mL amphotericin B, 2 mM L-glutamine, 10% platelet rich plasma (PRP, homemade), 1% insulin, transferrin and selenium selenite (ITS), and 10% non-essential amino acids was added to the pellet. Cells detected after centrifugation were counted with Burker’s chamber and stained with Trypan blue 0.4% to detect viable or dead cells. These were cultured in six-well plates in an incubator at 5% CO2 and 90% humidity at 38.5 °C at the density of seeding of 10,000 cells/cm2. After 48 h, 1 mL of new complete urine culture medium was added to each well followed 48 h later by a 1 mL replacement of fresh complete urine culture medium again. The whole medium was changed after 96 h from the seeding with new culture medium and refreshed every 3 days. The cells were detached by 0.05% trypsin/0.02% EDTA in PBS at 80–90% confluence.
Cells at P0 (when available) and at P1 were studied for morphology. After cryopreservation, at passage 1 and 5 (P1 and P5), pools of cells from healthy and diseased animals were used for the proliferation study (growth curve, doubling time and colony forming unit) and at P3 for differentiation and characterization studies.

2.7. Cytological Staining and Immunocytochemical Analysis

At P0, if there was a visible pellet, and at P1, 10,000 cells were plated on a slide placed on the bottom of the well of a six-well polystyrene plate covered with 3 mL of complete urine medium. Cytological analysis was performed after approximately 7 days of culture and after having verified through a microscope that cell proliferation had occurred (by identification of adherence to the slide). These cells were morphologically characterized through the May-Grünwald Giemsa staining and visualized under the microscope at 40× of magnification.
In addition to this staining, the expression of vimentin (with mouse monoclonal, clone Vim V9; Dako, Glostrup, Denmark) and PanCytokeratin (mouse monoclonal, clone A1E; Santa Cruz Biotechnology, Santa Cruz, CA, USA) were analyzed after blocking of endogenous peroxidase by immersion in 3% hydrogen peroxide for 30 min and incubation in normal horse serum diluted 1:10 in PBS. Then, incubation with primary antibodies for 1 h at 37 °C was carried out and primary antibodies were diluted in a blocking solution (anti-vimentin in mouse, m7020, Dako, 1:1000; anti-cytokeratin in mouse, m3515, Dako, 1:1000). After 3 washes in PBS, incubation with biotinylated secondary antibody anti-mouse in horse (Vector) for 30 min was performed, and slides were incubated with ABC (Avidin/Biotin complex, Vector) and then with diaminobenzidine (Vector) for 2 min. At last, slides were contrasted by incubation in hemalum for 2 min, activated by bathing in running water for 5 min and mounted in glycerin for microscope observation.

2.8. Cell Proliferation

Each analysis was performed in triplicate.
To obtain cell-proliferation growth curves at P1 and P5, 9 × 103 urine cells were plated into six-well tissue culture polystyrene dishes. Every 2 days, through 13 days of culture, one well of each plate was trypsinized. The total number of live cells was obtained at each time point by staining with the trypan blue dye exclusion method.
Doubling time (DT) of the urine cells, at P1 and P5, was determined by seeding 9 × 103 cells into six-well tissue culture dishes. Cells were trypsinized every 3/4 days, and counted and replated at the same density. The mean doubling time was calculated from day 0 to day 4 for the three replicates. The mean of population doublings (PD) was obtained for each passage according to the formula
CD = log (Nc/No)/log2 and PD = CT/CD
where CD represents cell doubling, Nc represents the number of cells at confluence, No represents seeded cells, and CT represents the culture time [25].

2.9. Colony-Forming Unit (CFU) Assays

Colony-forming unit assays were performed to evaluate the clonogenicity of the isolated canine urine-derived cells. At P1, cells were plated at different densities (100, 250, 500, and 1000 cells/cm2) in six-well plates and cultured in 5% CO2 and 90% humidity at 38.5 °C for 2 weeks in HG-DMEM culture medium enriched with 10% of PRP. Then, colonies were fixed with 4% formalin and stained with 1% methylene blue (Serva, Heidelberg, Germany) in 10 mM borate buffer, pH 8.8 (Fluka BioChemika, Buchs, Swizerland) at room temperature, and washed twice. Colonies formed by 16–20 nucleated cells were counted under a BX71 microscope (Olympus, Tokyo, Japan). The CFU assay was performed independently in each dog in triplicate.

2.10. Differentiation Assay

Cells at P3 were seeded at a density of 3 × 103/cm2 for all differentiation studies.
Osteogenic differentiation was assessed by incubating cells for up to 3 weeks at 38.5 °C under 5% CO2 in modified Romanov et al. medium [26] composed of HG-DMEM medium supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin, 0.25 mg/mL amphotericin B, 200 mM-glutamine, 10 mM b-glycerophosphate (Sigma), 0.1 mM dexamethasone (Sigma), and 250 mM ascorbic acid (Sigma) [26]. Non-induced control cells were cultured for the same time in standard control medium (HG-DMEM supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin, 0.25 mg/mL amphotericin B, 200 mM-glutamine). Osteogenesis was assessed by conventional von Kossa staining, using 1% silver nitrate and 5% sodium thiosulphate, which allowed the detection of calcium deposits.
For adipogenic differentiation, near-confluent cells were cultured through three cycles of induction/maintenance to stimulate adipogenic differentiation. Each cycle consisted of feeding the urine-derived cells with supplemented adipogenesis induction medium, followed by culture for 3 days (38.5 °C, 5% CO2) and subsequent culture for another 3 days in a supplemented adipogenic maintenance medium. The induction medium consisted of modified Romanov et al. [26] medium, composed of HG-DMEM supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin, 0.25 mg/mL amphotericin B, 200 mM-glutamine, 10 mg/mL insulin (Sigma), 150 mM indomethacin (Sigma), 1 mM dexamethasone, and 500 mM 3-isobuty-l-methyl-xanthine (Sigma). The maintenance medium consisted of HG-DMEM supplemented with 10% FBS and 10 mg/mL insulin [26]. Noninduced control cells were cultured for the same time in standard control medium. Adipogenesis was assessed using conventional oil red O staining (0.1% in 60% isopropanol) to visualize lipid droplets.
Chondrogenic differentiation was assessed in monolayer culture by incubating cells for 3 weeks in Soncini et al. [27] modified medium, composed of DMEM low-glucose containing 100 nM dexamethasone, 50 mg/mL L-ascorbic acid 2-phosphate, 1 mM sodium pyruvate (BDH Chemicals, Poole, UK), 40 mg/mL proline, ITS (5 mg/mL insulin, 5 mg/mL transferrin, 5 mg/mL sodium selenite; Sigma) and 5 ng/mL TGF-b3 (Peprovet, DBA, Milan, Italy). Noninduced control cells were cultured for the same time in standard control medium. The presence of metachromatic matrix was demonstrated by Alcian blue staining, pH 2.5.

2.11. RNA Extraction and RT–PCR Analysis

Expression of specific markers included (CD44, CD29, CD166, CD184), hematopoietic lineage marker (CD34 and CD45), pluripotency markers (OCTOct-4 and Nanog), and immunogenic antigen (MHC I and MHC II) were investigated by RT–PCR analysis on undifferentiated cells. Total RNA was extracted at P3 from both kinds of USCs, using TrizolW reagent (Invitrogen, Waltham, MA, USA), followed by DNase treatment according to the manufacturer’s specifications. RNA concentration and purity were measured using a NanoDrop spectrophotometer (NanoDropW ND1000). cDNA was synthesized from 200 ng total RNA, using the iScript retrotranscription kit (Bio-Rad Laboratories, Hercules, CA, USA). Conventional PCR was performed in a 25 mL final volume with DreamTaq DNA Polymerase (Fermentas, St. Leon Rot, Germany). Canine-specific oligonucleotide primers were designed using open source PerlPrimer software v. 1.1.17, based on available NCBI Canis lupus familiaris sequences or on mammal multi-aligned sequences. Primers were designed across an exon–exon junction to avoid DNA amplification. Primers were used at 200 nM final concentration and their sequences are shown in Table 1. GAPDH was employed as a reference gene. For differentiation experiments, total RNA was extracted from undifferentiated (control cells) and from induced urine-derived cells, and RT–PCR analysis was performed as described above. To detect the positive osteogenic differentiation, the expression of runt-related transcription factor 2 (RUNX2) and bone g-carboxyglutamate protein (BGLAP) was evaluated; for chondrogenesis differentiation, collagen type II-a1 (COL2A1) and aggrecan (ACAN); for adipogenesis differentiation, peroxisome proliferator- activated receptor gamma (PPARy) and lipoprotein lipase (LPL) were studied, respectively. Primer sequences are listed in Table 1.

2.12. Western Blotting for Klotho Protein

Total protein content of urine-derived cells was determined by Bio-Rad Protein Assay (Bio-Rad laboratories, Milano, Italy) and subsequent measurement at 595 nm with Beckman DU 640 spectrophotometer (Beckman, Indianapolis, IN, USA).
For evaluation of Klotho expression, samples containing 40 μg of proteins were mixed with 4× XT Sample Buffer (Bio-Rad laboratories, Milano, Italy), heated for 10 min at 95 °C, and run into parallel lanes into 4–20% CriterionTM TGX Stain-free Precast acrylamide gel (Bio-Rad laboratories, Milano, Italy) for SDSPAGE together with a molecular weight size marker (prestained dual color Protein Ladder; (Bio-Rad laboratories, Milano, Italy). For Western blotting analysis, proteins were electro-transferred by Trans Blot SD semi-dry apparatus (Bio-Rad laboratories, Milano, Italy) to an immobilon-P membrane (Millipore, Bedford, MA, USA) and stained with Coomassie blue to verify the efficacy of the transfer. The membrane was cut into two pieces: one was hybridized with 1 µg of mouse monoclonal primary antibody against Klotho protein (sc-515942 Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and the other with 1 µg of anti GAPDH (sc-47724 Santa Cruz Biotechnology, Inc., Dallas, TX, USA) by the SNAP i.d. Protein Detection System (Millipore, Bedford, MA, USA). The hybridization signal was evidenced by the Vectastain elite system (Vector-Laboratories, Burlingame, CA, USA) that uses a biotinylated universal antibody, the ABC reagent, and the diaminobenzidine (DAB) peroxidase substrate solution, according to the procedure suggested by the company. In the negative control test, the hybridization procedure was performed omitting the primary antibodies. Membranes were imaged with a Coolpix P5100 (Nikon, Osaka, Japan). The optical density of each protein band was quantified using Quantity one 1-D Analysis software (BioRad, Milano, Italy). The values expressed as arbitrary units (A.U.) are presented as the ratio of the specific protein to the corresponding GAPDH optical density.

2.13. Statistical Analysis

Statistical analysis was performed using GraphPad Instat 3.00 for Windows (GraphPad Software, La Jolla, CA, USA). Three replicates for each experiment (growth curve, DT and CFU) were performed and the results are reported as mean ± standard deviation (SD).
One-way analysis of variance (ANOVA) for multiple comparisons by Student–Newman–Keuls multiple comparison tests was used. CFU comparison among different cell plating densities inside each group and between groups of the same cell density were analyzed. p < 0.05 was considered as significant.

3. Results

3.1. Animals

Table 2 shows the characteristics of each healthy dog. Table 3 shows the characteristics of each sick animal.

3.2. Bacteriological Results

All urine samples were sterile after bacteriological analysis.

3.3. Isolation of Urine-Derived Cells

The average number of cells collected from each technique of urine collection in healthy and sick dogs is shown in Table 4.
In healthy dogs, cells were always obtained through all collection methods.
In sick dogs, only cystocentesis was performed, and cells were always found.

3.4. Cytological Staining and Immunocytochemical Analysis

At passage 0 (P0), urine-derived cells from both sick and healthy dogs can assume intermediate phenotypes with less elongated and more polygonal shapes (Figure 1A). At passage 1, cells showed an elongated, fibroblast-like shape (Figure 1B).
At P0, immunocytochemical characterization highlighted the co-existence of mesenchymal and epithelial expression markers (vimentin and cytokeratin, respectively), as shown in Figure 2.

3.5. Cell Proliferation Analysis

3.5.1. Healthy Dogs

Urine-derived cells obtained by cystocentesis (animals B, E and G) reached a confluence of 80% after 15 days of culture at P0, and this primary culture was expanded and studied until P5.
Cells obtained by bladder catheterization and spontaneous micturition reached the same confluence, but after 25 days and after the first passage it was no longer possible to detach them, despite the use of trypsin or scrapers; therefore, they could not be characterized (Table 5).
Urine-derived cells showed a growth curve with a lag phase of 48 h and a subsequent log phase between 4 and 9 days at P1, while the growth curve always remained in lag phase at P5 (Figure 3). The DT for urine-derived cells was constant up to P3, then decreased statistically significantly (p < 0.05) at P4. The mean DT value was 2.04 ± 0.19 days (Figure 4).

3.5.2. Sick Dogs

Urine was collected from 11 CKD dogs, but cells were isolated and expanded from only three of these. These cells reached a confluence of 80% after 8 days of culture at P0 and were expanded and studied until P5.
Urine-derived cells at P1 and P5 demonstrated a growth curve with an initial lag phase of 48 h and subsequent log phase that was more intense at P1. At P5, these cells showed a slight minor proliferation compared to those at P1 (Figure 5).
In CKD dogs, the DT for urine-derived cells decreased in a statistically significant manner (p < 0.05) until P3, then remained constant until P5. The mean DT value was 1.7 ± 0.2 days (Figure 6).
The mean DT in sick dogs was lower than that of healthy dogs and the difference was statistically significant with a p value of 0.0219. This result highlights a greater proliferative capacity of the urine-derived cells from CKD dogs.

3.6. CFU Assays

The number of cell colonies formed was counted at P1 after seeding cells at different densities/cm2. For each cell population (healthy and sick derived cells), there was a statistically significant increase in CFU frequency with increasing cell seeding densities for both kinds of samples (Table 6 and Figure 7). There were no statistical differences between the number of CFUs between healthy and sick urine-derived cells.

3.7. In Vitro Differentiation

The multi-differentiative potential of urine-derived cells in healthy and CKD dogs was evaluated at P3. After positive results of osteogenic, adipogenic, and chondrogenic differentiation, urine-derived cells are called “urine mesenchymal stromal/stem cells (USCs)”.

3.7.1. Osteogenic Differentiation

After 21 days of induction, the osteogenic differentiation of urine-derived cells from healthy and sick dogs was confirmed by von Kossa stain, which highlighted calcium deposits. The cells changed their morphology. Microscopic images show no apparent differences in staining intensity between healthy and sick dogs. The control was negative in staining, showing no mineralized matrix. Analysis of the expression of osteogenic markers BGLAP and OPN by RT-PCR confirmed osteogenic induction (Figure 8A,B and Figure 9A,B).

3.7.2. Adipogenic Differentiation

Urine-derived cells from both healthy and sick dogs showed the ability to differentiate into the adipogenic lineage, as demonstrated by the positive result of Red Oil O staining after 3 weeks of culture in the adipogenic medium. Microscopic images show no apparent differences in staining intensity between healthy and sick dogs. Cells maintained in the standard medium showed no lipid deposits and, therefore, staining was negative. The cells induced to differentiate revealed an increased expression of PPAR-γ and adiponectin compared to the control that was negative (Figure 8C,D and Figure 9C,D).

3.7.3. Chondrogenic Differentiation

Urine-derived cells derived both from healthy and sick dogs had the ability to differentiate into the chondrogenic lineage, as reflected by Alcian Blue staining. Urine-derived cells derived from sick dogs exhibited more intense staining than those from healthy dogs. The control failed to stain as expected. Analysis of the expression of the chondrogenic markers, COL2A1 and ACAN by RT-PCR confirmed the induction compared to the control, which did not show expression of the markers (Figure 8E,F and Figure 9E,F).

3.8. RNA Extraction and RT-PCR Analysis

To characterize urine-derived cells, a multi-step RT-PCR was set up. All cells from healthy and sick dogs expressed MSCs-specific markers (CD166, CD117, CD29, CD90, CD73), embryonic marker (Nanog, Oct4, Sox2), hematopoietic marker (CD34), histocompatibility complex MHC I but not MHC II marker (Figure 10).
GAPDH was used as a housekeeping gene.

3.9. Western Blotting for Klotho Protein

Klotho protein expression was confirmed by Western blotting (Figure 11).

4. Discussion

Cell therapy could be a useful treatment for genito-urinary pathologies in domestic animals. Since Italian law requires autologous treatments, USCs have ethical advantages over other MSCs, as they can be repeatedly obtained from urine without causing any pain or side effects in the patients [28]. However, the isolation of urine-derived cells is only apparently simple: these cells can survive only for a few hours in urine, that indeed represent a hostile environment for cell survival due to lack of nutrients, presence of toxic metabolic waste, high osmotic pressure, and non-physiological pH value. This toxic environment alters the cell membrane and causes cell lysis. Different strategies can be used for their preservation: the addition of a preservation medium or the storage of urine samples at 4 °C to maintain cell membrane stability by slowing metabolism and preventing cell lysis [29].
In our study, it appeared to be a correlation between donor age and the number of cells cultured. Studies have shown that cells isolated from young children (non-newborns) have better proliferation and differentiation abilities [30]. The clinical condition of the subject also influences the success of isolation of these cells. For example, cells obtained from diabetic donors have never been successfully isolated and cultured [4,31,32]. There are no studies reporting the isolation of urine-derived cells from dogs affected by kidney diseases. Our study evaluated the biological characteristics of USCs isolated from different urine collection methods in healthy dogs. We compared these cells with USCs isolated from CKD affected dogs, to understand if they show the same characteristics. Indeed, it would be advantageous to perform autologous cell therapy and prevent immune rejection risk in dogs with CKD.
The isolation of urine-derived cells from healthy dogs was carried out in samples from spontaneous micturition, bladder catheterization, and cystocentesis. The isolation in CKD dogs was performed only by cystocentesis.
Urine samples were stored at 4 °C immediately after collection and processed within 2 h from their arrival in the laboratory to minimize the exposure of the cells to the toxic environment of urine. In healthy dogs, cells were isolated from all samples (regardless of the collection technique), but those obtained by spontaneous micturition and bladder catheterization underwent senescence at P1, making it impossible to proceed with the study. Thus, in healthy dogs only cells obtained by cystocentesis were studied. In CKD dogs, cells were isolated only from three of eleven animals belonging to this group and, even in these cases, the urine collection was performed by cystocentesis.
We cannot provide explanations for these problems, as the only study concerning the isolation of USCs from dog species [2] was performed on healthy beagle dogs, where urine was collected by a sterile catheter, and the sex and age of these animals were not reported. In our study, no cells were able to proliferate when obtained by bladder catheterization or spontaneous micturition.
We have analyzed different parameters to understand this aspect; for example, the age of the animals was not an influencing factor for the culturing of these cells. Indeed, cells were easily obtained by cystocentesis from older dogs (including a 12-year-old) and were able to proliferate.
Another critical issue encountered in our study was the isolation of urine-derived cells only in three of the 11 CKD dogs from which urine was collected through cystocentesis. We did not find any correlation with age, breed, severity of the disease and urinary parameters but only a correlation with sex. Indeed, all three of these dogs were spayed females. Comparably, also among the healthy dogs, urine-derived cells were successfully isolated and cultured only from three young females (animal B, E, and G of 1–2 years old). In the literature, there are no data about the outcome of isolation of USCs correlated with the sex of the donor.
Initially, to try to culture all kinds of cells (from spontaneous micturition, bladder catheterization, and cystocentesis), a basic culture medium with HG-DMEM, 20% of fetal calf serum (FCS), and antibiotic and antimycotic, was enriched by 1% of ITS, or 1% of non-essential amino acid, or 2% of renal epithelial cell growth medium (Lonza, Milan, Italy), as described in dog species by Xu et al. [2], or 10 ng/mL of EGF, adding one supplement at a time. Despite this, cells from spontaneous micturition and bladder catheterization died compared to cells obtained from cystocentesis.
The idea of adding 10% of platelet-rich plasma (PRP) to the culture medium after a dose response curve was suggested to promote the survival of these cells. Indeed, PRP is a source of cytokines, chemokines, and growth factors involved in stimulating cell proliferation, inducing tissue regeneration. This product is used by our research team for in vitro and in vivo studies [33,34,35,36,37]. Then, the final complete urine medium used in our study was composed by HG-DMEM enriched of 20% of FCS, 100 U/mL penicillin, 100 μg/mL streptomycin, 10 ng/mL epidermal growth factor, 0.25 μg/mL amphotericin B, 2 mM L-glutamine, 1% insulin, transferrin and selenium, 10% non-essential amino acids and 10% PRP (homemade). This medium did not alter the growth curve of cells obtained by cystocentesis in healthy or sick dogs but did not promote the survival of cells obtained by spontaneous micturition and bladder catheterization, which were therefore abandoned in our experiment.
Cells obtained by cystocentesis in the three CKD dogs, and by cystocentesis in the three healthy dogs were studied for cell proliferation, differentiation, and marker expression analyzes.
Studies on the proliferative capacity of urine-derived cells have shown a greater proliferative capacity of these cells in diseased animals compared to healthy animals. In sick dogs, the confluence is reached in about 7–8 days (compared to 15 days in healthy dogs) and the mean DT is statistically lower than that of healthy dogs. These data are not in agreement with those obtained in human studies by Guan et al. and Chen et al. [8,17], who reported 80% of confluence reached in 3 and 5 days. Also with canine USCs, it was reported that cells reached 70–80% of confluency after 5 days [2]. Instead, the DT obtained in sick dogs was similar to that obtained in human USCs from Zhang et al. [4]. Of course, there are many variables related to the different laboratory procedures that can explain these differences of a few days.
At passage 1, all isolated cells began to show a fibroblast-like morphology, typical of mesenchymal stem/stromal cells and, indeed, the isolated cells (both in healthy and sick dogs) showed expression of MSC markers (CD166, CD117, CD29, CD90 and CD73) and embryonic markers (Nanog, Oct-4 and Sox). Furthermore, all cells expressed MHC I at passage 1 and 5, but not MHC II. This suggests the possible therapeutic use of these cells not only for autologous therapy but also for allogenic treatment. Furthermore, urine-derived cells express Klotho protein [18], but in sick dogs this expression was significantly greater compared to healthy dogs. This result is very interesting considering that the use of USCs, and hence Klotho protein, in experimental models of CKD has been shown to have a protective effect on the nephron. At renal level, Klotho protein blocks various signaling pathways that lead to the development and maintenance of renal fibrosis after kidney damage in a mouse model [18].
The analysis that confirmed the stem cell property of isolated cells (making characterization of USCs) was the differentiation study. All cells demonstrated osteogenic, adipogenic, and chondrogenic differentiation capacities. Data deriving from the literature suggest their differentiation into many other cell types, in addition to those described [5].
The morphology, phenotype, proliferation and multipotency of isolated cells in our study is consistent with currently accepted biological characteristics of MSCs.
The focus of regenerative medicine is the possibility to collect cells in a noninvasive way, and the availability of highly proliferative cells that can differentiate. Comparison of proliferation data of MSCs is difficult among different laboratories. In our experience, we worked with equine cells isolated from bone marrow and amniotic membrane and we highlighted a notable proliferative difference between the two cell lines [38]. The average DT of amniotic MSCs was 2 days shorter than that observed in bone marrow MSCs (1.17 vs. 3.27 days), confirming the data of Guest et al. [39] on bone marrow derived cells. In addition, as extra-fetal mesenchymal/stromal cells, USCs had the ability to give rise in vitro to clones with frequency that increased with cell-seeding densities up to 1000 cells/cm2, indicating some paracrine signaling between urine-derived cells, which may potentiate CFU formation during cell culture [40,41].
More satisfactory results have been achieved in vitro with mature adipose tissue-derived cells capable of differentiation into several mesenchymal derivatives [42], but the collection of bone marrow and adipose tissue is still invasive. Stromal cells from urine could overcome these limitations and potentially offer new approaches in regenerative medicine for autologous cell therapy. Indeed, USCs were present and were isolated, with minimal differences, both in healthy and in sick dogs. Despite their successful isolation resulting only in a small percentage of dogs, USCs could represent a valid starting point for the future autologous therapy. CKD prevalence varies widely, affecting 0.05–3.74% of the general dog population [43,44]. However, prevalence varies across different geographical areas. In fact, more recent observations evidenced the high prevalence of proteinuria in dogs of the Mediterranean area due to the spread of infectious diseases that often cause immune-complex glomerulonephritis [45,46]. The results of this study, in the context of a degenerative and irreversible disease, lay the foundation for promising applications of USCs in the field of canine regenerative medicine.

5. Conclusions

Deriving from a convenient source and being theoretically very simple to obtain, canine USCs are considered very promising. However, issues remain with cell isolation and culture. It is very important to preserve the viability of the few cells present in the samples immediately after collection by addition of supplements such glucose, serum, and other sources of nutrition. Despite the difficulty in working with these cells, they could be considered a new source to be used in regenerative medicine for the treatment of CKD in dogs.

Author Contributions

Conceptualization, A.L.-C. and F.C.; methodology, A.L.-C. and G.G.; collection of healthy urine samples, F.C.; collection and anamnesis of urine of CKD animals, F.T. and P.S.; bacteriological analysis, C.G. and C.P.; cytological analysis, P.R.; formal analysis and investigation, A.L.-C. and G.G.; data curation, A.L.-C.; writing—original draft preparation, A.L.-C.; writing—review and editing, all coauthors. All authors have read and agreed to the published version of the manuscript.

Funding

This research received funding by “Piano di Sostegno alla Ricerca: Linea 2—Azione A of Department of Veterinary Medicine and Animal Science of Università degli Studi di Milano, Lodi, Italy. Funding number: PSR2022_DIP_035_RICCABONI”.

Institutional Review Board Statement

Ethical review and approval were waived for this study according to the guidelines of the Institutional Ethics Committee (protocol number 2/2016). No further approval from the Institutuional Animal Care and Use Committee was required.

Informed Consent Statement

Informed consent was obtained from the owners of the animals involved in the study.

Data Availability Statement

There is no new data than that presented in this manuscript.

Acknowledgments

The authors want to acknowledge Mario Caniatti of DIVAS for his support in the cytological staining.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Paris, D.B.; Stout, T.A. Equine embryos and embryonic stem cells: Defining reliable markers of pluripotency. Theriogenology 2010, 74, 516–524. [Google Scholar] [CrossRef]
  2. Xu, Y.; Zhang, T.; Chen, Y.; Qiang, S.; Muzhi, L.; Tian, Q.; Jianzhong, H.; Hongbin, L.; Jun, L.; Can, C. Isolation and Characterization of Multipotent Canine Urine-Derived Stem Cells. Stem Cells Int. 2020, 2020, 8894449. [Google Scholar] [CrossRef] [PubMed]
  3. Cremonesi, F.; Corradetti, B.; Lange-Consiglio, A. Fetal adnexa derived stem cells from domestic animal: Progress and perspectives. Theriogenology 2011, 75, 1400–1415. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Y.; McNeill, E.; Tian, H.; Soker, S.; Andersson, K.E.; Yoo, J.J.; Atala, A. Urine derived cells are a potential source for urological tissue reconstruction. J. Urol. 2008, 180, 2226–2233. [Google Scholar] [CrossRef] [PubMed]
  5. Burdeyron, P.; Giraud, S.; Hauet, T.; Steichen, C. Urine-derived stem/progenitor cells: A focus on their characterization and potential. World J. Stem Cells 2020, 12, 1080–1096. [Google Scholar] [CrossRef] [PubMed]
  6. Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.C.; Krause, D.S.; Deans, R.J.; Keating, A.; Prockop, D.J.; Horwitz, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
  7. Ji, X.; Wang, M.; Chen, F.; Zhou, J. Urine-derived stem cells: The present and the future. Stem Cells Int. 2017, 2017, 4378947. [Google Scholar] [CrossRef]
  8. Chen, L.; Li, L.; Xing, F.; Peng, J.; Peng, K.; Wang, Y.; Xiang, Z. Human urine-derived stem cells: Potential for cell-based therapy of cartilage defects. Stem Cells Int. 2018, 2018, 1–14. [Google Scholar] [CrossRef] [PubMed]
  9. Bodin, A.; Bharadwaj, S.; Wu, S.; Gatenholm, P.; Atala, A.; Zhang, Y. Tissue-engineered conduit using urine-derived stem cells seeded bacterial cellulose polymer in urinary reconstruction and diversion. Biomaterials 2010, 31, 8889–8901. [Google Scholar] [CrossRef] [PubMed]
  10. Yu, P.; Opara, E.C.; Zhang, Y. Power of pee: Urine-derived stem cells in urological disorders. UroPrecision 2023, 1, 38–44. [Google Scholar] [CrossRef]
  11. Ouyang, B.; Sun, X.; Han, D.; Chen, S.; Yao, B.; Gao, Y.; Bian, I.; Huang, Y.; Zhang, Y.; Wan, Z.; et al. Human urine-derived stem cells alone or genetically-modified with FGF2 improve type 2 diabetic erectile dysfunction in a rat model. PLoS ONE 2014, 9, e92825. [Google Scholar] [CrossRef] [PubMed]
  12. Sun, B.; Luo, X.; Yang, C.; Liu, P.; Yang, Y.; Dong, X.; Yang, Z.; Xu, J.; Zhang, Y.; Li, L. Therapeutic effects of human urine-derived stem cells in a rat model of cisplatin-induced acute kidney injury in vivo and in vitro. Stem Cells Int. 2019, 2019, 8035076. [Google Scholar] [CrossRef]
  13. Duan, Y.R.; Chen, B.P.; Chen, F.; Yang, S.X.; Zhu, C.Y.; Ma, Y.L.; Li, Y.; Shi, J. Exosomal microRNA-16-5p from human urine-derived stem cells ameliorates diabetic nephropathy through protection of podocyte. J. Cell Mol. Med. 2019, 25, 10798–10813. [Google Scholar] [CrossRef] [PubMed]
  14. Dong, X.; Zhang, T.; Liu, Q.; Zhu, J.; Zhao, J.; Li, J.; Sun, B.; Ding, G.; Hu, X.; Yang, Z.; et al. Beneficial effects of urine-derived stem cells on fibrosis and apoptosis of myocardial, glomerular and bladder cells. Mol. Cell Endocrinol. 2016, 427, 21–32. [Google Scholar] [CrossRef] [PubMed]
  15. Zhou, C.; Wu, X.R.; Liu, H.S.; Liu, X.H.; Liu, G.H.; Zheng, X.B.; Hu, T.; Liang, Z.-X.; He, X.-W.; Wu, X.-J.; et al. Immunomodulatory effect of urine-derived stem cells on inflammatory bowel diseases via downregulating Th1/Th17 immune responses in a PGE2-dependent manner. J. Crohns Colitis. 2020, 14, 654–668. [Google Scholar] [CrossRef]
  16. Guan, J.; Zhang, J.; Li, H.; Zhu, Z.; Guo, S.; Niu, X.; Wang, Y.; Zhang, C. Human urine derived stem cells in combination with β-TCP can be applied for bone regeneration. PLoS ONE 2015, 10, e0125253. [Google Scholar] [CrossRef]
  17. Zhang, X.R.; Huang, Y.Z.; Gao, H.W.; Jiang, Y.-L.; Hu, J.-G.; Pi, J.-Q.; Chen, A.-J.; Zhang, Y.; Zhou, L.; Xieet, H.-Q. Hypoxic preconditioning of human urine-derived stem cell-laden small intestinal submucosa enhances wound healing potential. Stem Cell Res. Ther. 2020, 11, 150. [Google Scholar] [CrossRef] [PubMed]
  18. Kim, S.H.; Jin, J.A.; So, H.J.; Lee, S.H.; Kang, T.W.; Lee, J.U.; Choi, D.E.; Jeong, J.Y.; Chang, Y.K.; Choi, H.; et al. Urine-Derived Stem Cell-Secreted Klotho Plays a Crucial Role in the HK-2 Fibrosis Model by Inhibiting the TGF-β Signaling Pathway. Int. J. Mol. Sci. 2022, 23, 5012. [Google Scholar] [CrossRef]
  19. Doi, S.; Zou, Y.; Togao, O.; Pastor, J.V.; John, G.B.; Wang, L.; Shiizaki, K.; Gotschall, R.; Schiavi, S.; Yorioka, N.; et al. Klotho inhibits transforming growth factor-beta1 (TGF-beta1) signaling and suppresses renal fibrosis and cancer metastasis in mice. J. Biol. Chem. 2011, 286, 8655–8665. [Google Scholar] [CrossRef] [PubMed]
  20. Choi, D.E.; Hwang, Y.; Park, H.; Han, S.; Shin, J.A.; Park, H.; Jeong, J.Y.; Na, K.R.; Lee, K.W.; Chang, Y.K. Urine-Derived Stem Cell attenuated renal fibrosis via Klotho activation. Kidney Int. Rep. 2023, 8, S226. [Google Scholar]
  21. Benigni, A.; Morigi, M.; Remuzzi, G. Kidney regeneration. Lancet 2010, 375, 1310–1317. [Google Scholar] [CrossRef] [PubMed]
  22. Menn-Josephy, H.; Lee, C.S.; Nolin, A.; Christov, M.; Rybin, D.V.; Weinberg, J.M.; Henderson, J.; Bonegio, R.; Havasi, A. Renal Interstitial Fibrosis: An Imperfect Predictor of Kidney Disease Progression in Some Patient Cohorts. Am. J. Nephrol. 2016, 44, 289–299. [Google Scholar] [CrossRef]
  23. Grange, C.; Papadimitriou, E.; Dimuccio, V.; Pastorino, C.; Molina, J.; O’Kelly, R.; Niedernhofer, L.J.; Robbins, P.D.; Camussi, G.; Bussolati, B. Urinary Extracellular Vesicles Carrying Klotho Improve the Recovery of Renal Function in an Acute Tubular Injury Model. Mol. Ther. 2020, 28, 490–502. [Google Scholar] [CrossRef] [PubMed]
  24. Cahan, P.; Daley, G.Q. Origins and implications of pluripotent stem cell variability and heterogeneity. Nat. Rev. Mol. Cell Biol. 2013, 14, 357–368. [Google Scholar] [CrossRef] [PubMed]
  25. Korzyńska, A.; Zychowicz, M. A method of estimation of the cell doubling time on basis of the cell culture monitoring data. Biocybern. Biomed. Eng. 2008, 28, 75–82. [Google Scholar]
  26. Romanov, Y.A.; Svintsitskaya, V.A.; Smirnov, V.N. Searching for alternative sources of postnatal human mesenchymal stem cells: Candidate MSC-like cells from umbilical cord. Stem Cells 2003, 21, 105–110. [Google Scholar] [CrossRef] [PubMed]
  27. Soncini, M.; Vertua, E.; Gibelli, L.; Zorzi, F.; Denegri, M.; Albertini, A.; Wengler, G.S.; Parolini, O. Isolation and characterization of mesenchymal cells from human fetal membranes. J. Tissue Eng. Regen. Med. 2007, 1, 296–305. [Google Scholar] [CrossRef] [PubMed]
  28. Qin, D.; Long, T.; Deng, J.; Zhang, Y. Urine-derived stem cells for potential use in bladder repair. Stem Cell Res. Ther. 2014, 5, 69. [Google Scholar] [CrossRef] [PubMed]
  29. Lang, R.; Liu, G.; Shi, Y.; Bharadwaj, S.; Leng, X.; Zhou, X.; Liu, H.; Atala, A.; Zhang, Y. Self-renewal and differentiation capacity of urine-derived stem cells after urine preservation for 24 hours. PLoS ONE 2013, 8, e53980. [Google Scholar] [CrossRef]
  30. Gao, P.; Han, P.; Jiang, D.; Yang, S.; Cui, Q.; Li, Z. Effects of the donor age on proliferation, senescence and osteogenic capacity of human urine-derived stem cells. Cytotechnology 2017, 69, 751–763. [Google Scholar] [CrossRef] [PubMed]
  31. Wu, S.; Liu, Y.; Bharadwaj, S.; Atala, A.; Zhang, Y. Human urine-derived stem cells seeded in a modified 3D porous small intestinal submucosa scaffold for urethral tissue engineering. Biomaterials 2011, 32, 1317–1326. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, G.; Pareta, R.A.; Wu, R.; Shi, Y.; Zhou, X.; Liu, H.; Deng, C.; Sun, X.; Atala, A.; Opara, E.C.; et al. Affiliations expand skeletal myogenic differentiation of urine-derived stem cells and angiogenesis using microbeads loaded with growth factors. Biomaterials 2013, 34, 1311–1326. [Google Scholar] [CrossRef] [PubMed]
  33. Lange-Consiglio, A.; Spelta, C.; Garlappi, R.; Luini, M.V.; Cremonesi, F. Intramammary administration of platelet concentrate as an unconventional therapy in bovine mastitis: First clinical application. J. Dairy Sci. 2014, 97, 6223–6230. [Google Scholar] [CrossRef]
  34. Lange-Consiglio, A.; Cazzaniga, N.; Garlappi, R.; Spelta, C.; Pollera, C.; Perrini, C.; Cremonesi, F. Platelet concentrate in bovine reproduction: Effects on in vitro embryo production and after intrauterine administration in repeat breeder cows. Reprod. Biol. Endocrinol. 2015, 13, 65. [Google Scholar] [CrossRef] [PubMed]
  35. Marini, M.G.; Perrini, C.; Esposti, P.; Corradetti, B.; Bizzaro, D.; Riccaboni, P.; Fantinato, E.; Urbani, G.; Gelati, G.; Cremonesi, F.; et al. Effects of platelet-rich plasma in a model of bovine endometrial inflammation in vitro. Reprod. Biol. Endocrinol. 2016, 14, 58. [Google Scholar] [CrossRef] [PubMed]
  36. Cremonesi, F.; Bonfanti, S.; Idda, A.; Anna, L.C. Improvement of embryo recovery in Holstein cows treated by intra-ovarian platelet rich plasma before superovulation. Vet. Sci. 2020, 7, 16. [Google Scholar] [CrossRef]
  37. Lange-Consiglio, A.; Gaspari, G.; Riccaboni, P.; Canesi, S.; Bosi, G.; Vigo, D.; Cremonesi, F. Platelet-rich plasma and ovarian quiescence: A bovine in vitro model for regeneration of the ovary. Reprod. Fertil. Dev. 2023, 35, 433–444. [Google Scholar] [CrossRef] [PubMed]
  38. Lange-Consiglio, A.; Corradetti, B.; Meucci, A.; Perego, R.; Bizzaro, D.; Cremonesi, F. Characteristics of equine mesenchymal stem cells derived from amnion and bone marrow: In vitro proliferative and multilineage potential assessment. Equine Vet. J. 2013, 45, 737–744. [Google Scholar] [CrossRef]
  39. Guest, D.J.; Smith, M.R.; Allen, W.R. Equine embryonic stem-like cells and mesenchymal stromal cells have different survival rates and migration patterns following their injection into damaged superficial digital flexor tendon. Equine Vet. J. 2010, 42, 636–642. [Google Scholar] [CrossRef]
  40. Sarugaser, R.; Lickorish, D.; Baksh, D.; Hosseini, M.M.; Davies, J.E. Human umbilical cord perivascular (HUCPV) cells: A source of mesenchymal progenitors. Stem Cells 2005, 23, 220–229. [Google Scholar] [CrossRef]
  41. Lange-Consiglio, A.; Corradetti, B.; Bizzaro, D.; Magatti, M.; Ressel, L.; Tassan, S.; Parolini, O.; Cremonesi, F. Characterization and potential applications of progenitor-like cells isolated from horse amniotic membrane. J. Tissue Eng. Regen. Med. 2012, 6, 622–635. [Google Scholar] [CrossRef] [PubMed]
  42. Vidal, M.A.; Kilroy, G.E.; Lopez, M.J.; Johnson, J.R.; Moore, R.M.; Gimble, J.M. Characterization of equine adipose tissue-derived stromal cells: Adipogenic and osteogenic capacity and comparison with bone marrow-derived mesenchymal stromal cells. Vet. Surg. 2007, 36, 613–622. [Google Scholar] [CrossRef] [PubMed]
  43. Barteges, J.W. Chronic kidney disease in dogs and cats. Vet. Clin. Small Anim. 2012, 42, 669–692. [Google Scholar] [CrossRef] [PubMed]
  44. Sosnar, M. Retrospective study of renal failure in dogs and cats admitted to University of Veterinary and Pharmaceutical Sciences Brno during 1999–2020. Acta Vet. Brno 2003, 72, 593–598. [Google Scholar] [CrossRef]
  45. Gizzarelli, M.; Roura, X.; Scarpa, P.; D’Ippolito, P.; Foglia Manzillo, V.; Oliva, G.; Tarducci, A.; Borrelli, A.; Melis, G.; Quintavalla, F.; et al. Prevalence of Proteinuria in Owned Dogs from Italy: A Multicentric Study. Vet. Med. Int. 2019, 2019, 6073624. [Google Scholar] [CrossRef]
  46. Le Rutte, E.A.; van der Wilt, L.; Bulstra, C.A.; Nieboer, D.; Kontoroupis, P.; de Vlas, S.J.; Richardus, J.H. Incidence and geographical distribution of canine leishmaniosis in 2016–2017 in Spain and France. Vet. Parasitol. Reg. Stud. Rep. 2021, 2021, 100613. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Morphology of urine cells. (A) May-Grünwald Giemsa with different cellular morphology at P0. Scale bar 15 µm. (B) Fibroblastoid-like morphology of urine-derived cells at P1. Scale bar 10 µm.
Figure 1. Morphology of urine cells. (A) May-Grünwald Giemsa with different cellular morphology at P0. Scale bar 15 µm. (B) Fibroblastoid-like morphology of urine-derived cells at P1. Scale bar 10 µm.
Animals 15 00242 g001
Figure 2. Cytokeratin (CK; scale bar = 20 µm) and Vimentin (VIM; scale bar 15 µm) expression.
Figure 2. Cytokeratin (CK; scale bar = 20 µm) and Vimentin (VIM; scale bar 15 µm) expression.
Animals 15 00242 g002
Figure 3. Growth curve in healthy dogs.
Figure 3. Growth curve in healthy dogs.
Animals 15 00242 g003
Figure 4. Doubling time in healthy dogs.
Figure 4. Doubling time in healthy dogs.
Animals 15 00242 g004
Figure 5. Growth curve in CKD dogs.
Figure 5. Growth curve in CKD dogs.
Animals 15 00242 g005
Figure 6. Doubling time in sick dogs.
Figure 6. Doubling time in sick dogs.
Animals 15 00242 g006
Figure 7. Colony forming unit obtained with different seeding density: (A) 100 cells/cm2; (B) 250 cells/cm2; (C) 500 cells/cm2; (D) 1000 cells/cm2. Magnification 20×. Scale bar 10 µm.
Figure 7. Colony forming unit obtained with different seeding density: (A) 100 cells/cm2; (B) 250 cells/cm2; (C) 500 cells/cm2; (D) 1000 cells/cm2. Magnification 20×. Scale bar 10 µm.
Animals 15 00242 g007
Figure 8. Staining of differentiated and control undifferentiated USCs derived from healthy dogs and respective molecular expression. (A,B) von Kossa staining after osteogenic induction and RT-PCR analysis of osteopontin (OPN) and osteocalcin (BGLAP). (C,D) Oil red O cytoplasmic neutral lipids after adipogenic induction and RT-PCR of leptin and adiponectin. (E,F) Alcian blue staining after chondrogenic induction and RT-PCR of collagenase (COL2A1) and aggrecan (ACAN). Magnification 20×; scale bar = 20 µm. GAPDH was employed as a reference gene.
Figure 8. Staining of differentiated and control undifferentiated USCs derived from healthy dogs and respective molecular expression. (A,B) von Kossa staining after osteogenic induction and RT-PCR analysis of osteopontin (OPN) and osteocalcin (BGLAP). (C,D) Oil red O cytoplasmic neutral lipids after adipogenic induction and RT-PCR of leptin and adiponectin. (E,F) Alcian blue staining after chondrogenic induction and RT-PCR of collagenase (COL2A1) and aggrecan (ACAN). Magnification 20×; scale bar = 20 µm. GAPDH was employed as a reference gene.
Animals 15 00242 g008
Figure 9. Staining of differentiated and control undifferentiated USCs derived from sick dogs and respective molecular expression. (A,B) von Kossa staining after osteogenic induction and RT-PCR analysis of osteopontin (OPN) and osteocalcin (BGLAP). (C,D) Oil red O cytoplasmic neutral lipids after adipogenic induction and RT-PCR of leptin and adiponectin. (E,F) Alcian blue staining after chondrogenic induction and RT-PCR of collagenase (COL2A1) and aggrecan (ACAN) Magnification 20×; scale bar = 20 µm. GAPDH was employed as reference gene.
Figure 9. Staining of differentiated and control undifferentiated USCs derived from sick dogs and respective molecular expression. (A,B) von Kossa staining after osteogenic induction and RT-PCR analysis of osteopontin (OPN) and osteocalcin (BGLAP). (C,D) Oil red O cytoplasmic neutral lipids after adipogenic induction and RT-PCR of leptin and adiponectin. (E,F) Alcian blue staining after chondrogenic induction and RT-PCR of collagenase (COL2A1) and aggrecan (ACAN) Magnification 20×; scale bar = 20 µm. GAPDH was employed as reference gene.
Animals 15 00242 g009
Figure 10. RT-PCR analysis of mesenchymal, embryonic, hematopoietic and histocompatibility complex gene expression on USCs of healthy (hUSCs) and sick (sUSCs) dogs. GAPDH was used as reference gene.
Figure 10. RT-PCR analysis of mesenchymal, embryonic, hematopoietic and histocompatibility complex gene expression on USCs of healthy (hUSCs) and sick (sUSCs) dogs. GAPDH was used as reference gene.
Animals 15 00242 g010
Figure 11. Klotho protein expression was confirmed by Western blotting. Results are shown as the mean  ±  SEM. * p < 0.05. Legend: hUSCs = USCs from healthy dogs; sUSCs: = USCs from sick dogs.
Figure 11. Klotho protein expression was confirmed by Western blotting. Results are shown as the mean  ±  SEM. * p < 0.05. Legend: hUSCs = USCs from healthy dogs; sUSCs: = USCs from sick dogs.
Animals 15 00242 g011
Table 1. Primer sequences used for qRT-PCR analysis.
Table 1. Primer sequences used for qRT-PCR analysis.
MarkersSequence (5′ → 3′)Product Size (bp)Annealing
Temperature
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)F: GCAAAGTGGACATTGTCGCCATC
R: AGCTTCCCATTCTCAGCCTTGACT
124 bp64.4 °C
CD34 molecule (CD34)F: ACCAGAGCTACTCCCGAAAG
R: TAAGGGTCTTCGCCCAGC
139 bp59 °C
Integrin β-1 (CD29)F: TAAGAGTGCCGTGACAACCG
R: TTCAGAACCTGCCCATAGCG
154 bp60 °C
CD73 enzyme (CD73)F: ATTCGAGCAAGTGCGTCAAC
R: TCGTAACCCAAGGCGTTCAT
193 bp59.5 °C
Thy-1 Antigen (CD90)F: GCTAACAGTCTTGCAGGTGG
R: AGAAGTTGGTTCGAGAGCGG
212 bp59.5 °C
Tyrosine-protein kinase Kit (CD117)F: GGACCGAAGGAGGCACTTAC
R: AACGGAACATCTCTGCTCGG
206 bp60 °C
ALCAM (CD166)F: TGGTCACAGAGGACAACGT
R: CCACGTGATGTTGCCATCTG
167 bp59.5 °C
Endoglin (CD105)F: AGTTCTCCCGAAGCCTGGTC
R: GTGCGAGTGGATGTACCAGAG
104 bp61 °C
Major histocompatibility complex I (MHC I)F: TGGAGAGGAGCAGAGCTACAC
R: CTGTCACTGCCTGCAGCCT
225 bp61 °C
SLA-DRA1 (MHC II)F: TCTACACCTGCCAAGTG
R: CCACCATGCCCTTTCTG
178 bp55 °C
Transcription factor Oct-4 (Oct4)F: GTTCAGCCAAACGACCATCTG
R: TCTCTGCCTTGCATATCTCCTG
140 bp59.8 °C
Transcription factor Nanog (Nanog)F: AACTTCACCAATGCCTGAG
R: CTGATCTTCTGCTTCTTGACTG
234 bp56 °C
Osteocalcin (BGLAP)F: TCAACCCCGACTGCGACG
R: TTGGAGCAGCTGGGATGATGG
204 bp62.4 °C
Osteopontin (OPN)F: TTGCTAAAGCCTGACCCATCT
R: CGTCGTCCACATCGTCTGT
145 bp59.4 °C
LeptinF: AGCCTTTCGACCATCAAGCA
R: CAACTTGTGTTGCGTGGGAG
100 bp59.9 °C
Adiponectin (ADIPQ)F: TATGATGTCACCACTGGCAAATT
R: TAGAGGAGCACAGAGCCAGAG
185 bp59 °C
Collagen type 2 alpha 1 (COL2A1)F: ATCGAGATCGCCACCTACAG
R: CAGGCTGGTTTCTCGGATCT
102 bp59 °C
Aggrecan (ACAN)F: CAGGAGAAACAGGGCCTACA
R: GCTCCAACTTAGGGTCCAAGA
193 bp59 °C
Table 2. Healthy dogs: signalment and urine collection method.
Table 2. Healthy dogs: signalment and urine collection method.
Sample NumberBreedGenderAgeCollection Method
AGerman ShepherdM7 yearsBladder catheterization
BPitbull terrierF2 yearsCystocentesis
CLabrador retrieverM1 yearBladder catheterization
DLabrador retrieverM5 yearsSpontaneous micturition
EBorder CollieF2 yearsCystocentesis
FBelgian Shepherd MalinoisM6 monthsSpontaneous micturition
GLabrador retrieverF1 yearCystocentesis
HLabrador retrieverF1 yearBladder catheterization
IMixed BreedF4 yearsSpontaneous micturition
Table 3. CKD dogs, signalment, urinalysis, and IRIS staging.
Table 3. CKD dogs, signalment, urinalysis, and IRIS staging.
Sample NumberBreedGenderAgeIRIS StagingCollection MethodNotes
1Mixed breedM5 years and 7 monthsStage 1Cystocentesis
2English bulldogFS1 year and 2 monthsStage 3Cystocentesis
3German houndMN7 years and 7 monthsStage 3Cystocentesis
4Mixed breedM15 yearsStage 2CystocentesisSuspected HC
5Mixed breedFS8 years and 9 monthsStage 3Cystocentesis
6Nova scotia duck tolling retrieverF1 year and 8 monthsStage 1Cystocentesis
7Epagenul BretonFS8 yearsStage 1CystocentesisMicrohematuria; amyloidosis; leishmaniosis
8Mixed breedFS15 years and 8 monthsStage 1CystocentesisHC Dead
9DachshundM9 yearsStage 1CystocentesisCrystalluria
10Mixed breedFS10 years and 4 monthsStage 1CystocentesisDiabetes
11Dogue de BordeauxFS9 years and 8 monthsStage 1CystocentesisUTI
Legend; HC = hyperadrenocorticism; UTI = urinary tract infection.
Table 4. Method of collection and number of cells collected.
Table 4. Method of collection and number of cells collected.
Healthy DogsSick Dogs
N° SamplesCollection MethodN° CellsN° SamplesCollection MethodN° Cells
3Spontaneous micturition57,000 ± 8300---
3Bladder catheterization33,000 ± 2500---
3Cystocentesis93,000 ± 11,32711Cystocentesis122,500 ± 10,584
Table 5. Number of cells at P1 and P2 in healthy dogs.
Table 5. Number of cells at P1 and P2 in healthy dogs.
Method of CollectionN° Cells at P1N° Cells at P2
Spontaneous micturition10,000 ± 840No cells
Bladder catheterization10,000 ± 1023No cells
Cystocentesis250,000 ± 12,538300,000 ± 17,024
Table 6. CFU assay in healthy urine-derived cells.
Table 6. CFU assay in healthy urine-derived cells.
Density Cells/cm2Total CellsCFU1 CFU EachCFU1 CFU Each
Healthy DogsSick Dogs
100 cells/cm295020 ± 1.76 a47.522 ± 1.9 a43.18
250 cells/cm2237530 ± 2.54 b79.1635 ± 2.84 b67.86
500 cells/cm2475060 ± 3.18 c79.1657 ± 2.31 c83.33
1000 cells/cm2950082 ± 5.82 d115.8579 ± 3.73 d120.25
Different small letters superscripts (a, b, c, d) indicate statistically different comparison (p < 0.05) between cell density.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lange-Consiglio, A.; Tagliasacchi, F.; Cremonesi, F.; Gusmara, C.; Pollera, C.; Scarpa, P.; Gaspari, G.; Riccaboni, P. Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals 2025, 15, 242. https://doi.org/10.3390/ani15020242

AMA Style

Lange-Consiglio A, Tagliasacchi F, Cremonesi F, Gusmara C, Pollera C, Scarpa P, Gaspari G, Riccaboni P. Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals. 2025; 15(2):242. https://doi.org/10.3390/ani15020242

Chicago/Turabian Style

Lange-Consiglio, Anna, Filippo Tagliasacchi, Fausto Cremonesi, Claudia Gusmara, Claudia Pollera, Paola Scarpa, Giulia Gaspari, and Pietro Riccaboni. 2025. "Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD)" Animals 15, no. 2: 242. https://doi.org/10.3390/ani15020242

APA Style

Lange-Consiglio, A., Tagliasacchi, F., Cremonesi, F., Gusmara, C., Pollera, C., Scarpa, P., Gaspari, G., & Riccaboni, P. (2025). Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals, 15(2), 242. https://doi.org/10.3390/ani15020242

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop