Protease and Bacillus coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Diets and Diet Analysis
2.3. Animal and Experimental Design
2.4. Growth Performance
2.5. Serum Biochemical Indices and Free AA Concentration
2.6. Collection of Small Intestine Tissue and Cecal Digesta
2.7. Intestinal Morphological Characteristics
2.8. Expression of AA Transporters and Tight Junction Proteins
2.9. Microbiome Analysis of Cecal Digesta
2.10. Statistical Analysis
3. Results
3.1. Growth Performance and Serum Parameters
3.2. Expression of AA Transporters
3.3. Intestinal Morphology
3.4. Expression of Intestinal Barrier Genes
3.5. Cecum Microbiome Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hou, Y.; Wu, Z.; Dai, Z.; Wang, G.; Wu, G. Protein hydrolysates in animal nutrition: Industrial production, bioactive peptides, and functional significance. J. Anim. Sci. Biotechnol. 2017, 8, 24. [Google Scholar] [CrossRef]
- Kidd, M.T.; Maynard, C.W.; Mullenix, G.J. Progress of amino acid nutrition for diet protein reduction in poultry. J. Anim. Sci. Biotechnol. 2021, 12, 45. [Google Scholar] [CrossRef] [PubMed]
- Fraps, G.S. Relation of the protein, fat, and energy of the ration to the composition of chickens. Poult. Sci. 1943, 22, 421–424. [Google Scholar] [CrossRef]
- Kitada, M.; Ogura, Y.; Monno, I.; Koya, D. The impact of dietary protein intake on longevity and metabolic health. EBioMedicine 2019, 43, 632–640. [Google Scholar] [CrossRef] [PubMed]
- van Emous, R.A.; Winkel, A.; Aarnink, A.J.A. Effects of dietary crude protein levels on ammonia emission, litter and manure composition, n losses, and water intake in broiler breeders. Poult. Sci. 2019, 98, 6618–6625. [Google Scholar] [CrossRef] [PubMed]
- Parenteau, I.A.; Stevenson, M.; Kiarie, E.G. Egg production and quality responses to increasing isoleucine supplementation in shaver white hens fed a low crude protein corn-soybean meal diet fortified with synthetic amino acids between 20 and 46 weeks of age. Poult. Sci. 2020, 99, 1444–1453. [Google Scholar] [CrossRef] [PubMed]
- Ajao, A.M.; White, D.; Kim, W.K.; Olukosi, O.A. Partial replacement of soybean meal with canola meal or corn ddgs in low-protein diets supplemented with crystalline amino acids-effect on growth performance, whole-body composition, and litter characteristics. Animals 2022, 12, 2662. [Google Scholar] [CrossRef]
- Cowieson, A.J.; Roos, F.F. Toward optimal value creation through the application of exogenous mono-component protease in the diets of non-ruminants. Anim. Feed. Sci. Technol. 2016, 221, 331–340. [Google Scholar] [CrossRef]
- Borda-Molina, D.; Zuber, T.; Siegert, W.; Camarinha-Silva, A.; Feuerstein, D.; Rodehutscord, M. Effects of protease and phytase supplements on small intestinal microbiota and amino acid digestibility in broiler chickens. Poult. Sci. 2019, 98, 2906–2918. [Google Scholar] [CrossRef] [PubMed]
- Konuray, G.; Erginkaya, Z. Potential use of bacillus coagulans in the food industry. Foods 2018, 7, 92. [Google Scholar] [CrossRef] [PubMed]
- Mu, Y.; Cong, Y. Bacillus coagulans and its applications in medicine. Benef. Microbes 2019, 10, 679–688. [Google Scholar] [CrossRef]
- Jäger, R.; Purpura, M.; Farmer, S.; Cash, H.A.; Keller, D. Probiotic bacillus coagulans gbi-30, 6086 improves protein absorption and utilization. Probiotics Antimicrob. Proteins 2018, 10, 611–615. [Google Scholar] [CrossRef]
- National Research Council (NRC). Nutrient Requirements of Poultry, 11th revised ed.; National Academies Press: Washington, DC, USA, 1994. [Google Scholar]
- Directive, C. Establishing community methods for 434 the determination of amino acids, crude oils and fats, and olan-quindox in feeding stuff and amending directive. Off. J. Eur. Communities L 1998. [Google Scholar]
- Llames, C.R.; Fontaine, J. Determination of amino acids in feeds collaborative study. J. AOAC Int. 1994, 77, 1362–1402. [Google Scholar] [CrossRef]
- Directive, C. Establishing community methods for the determination of vitamin a, vitamin e and tryptophan, annex part c. Offic. J. 2000, 174, 45–50. [Google Scholar]
- Cheng, Q.; Xia, Y.; Yi, D.; Hou, Y.; Duan, R.; Guo, S.; Ding, B. The intestinal cinnamaldehyde release and antioxidative capacity of broiler chickens fed diets supplemented with coated oleum cinnamomi. J. Appl. Poult. Res. 2019, 28, 1058–1068. [Google Scholar] [CrossRef]
- Morales, A.; Buenabad, L.; Castillo, G.; Vázquez, L.; Espinoza, S.; Htoo, J.K.; Cervantes, M. Dietary levels of protein and free amino acids affect pancreatic proteases activities, amino acids transporters expression and serum amino acid concentrations in starter pigs. J. Anim. Physiol. Anim. Nutr. 2016, 101, 723–732. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.W.; Zhang, J.Y.; Zhou, H.B.; Guo, Y.P.; Ma, Q.G.; Ji, C.; Zhao, L.H. Effects of dietary pyrroloquinoline quinone disodium supplementation on inflammatory responses, oxidative stress, and intestinal morphology in broiler chickens challenged with lipopolysaccharide. Poult. Sci. 2020, 99, 5389–5398. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: Bestkeeper--excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Zhang, X.; Xu, H.; Gong, L.; Wang, J.; Fu, J.; Lv, Z.; Zhou, L.; Li, X.; Liu, Q.; Xia, P.; et al. Mannanase improves the growth performance of broilers by alleviating inflammation of the intestinal epithelium and improving intestinal microbiota. Anim. Nutr. 2024, 16, 376–394. [Google Scholar] [CrossRef]
- Dwivedi-Yu, J.A.; Oppler, Z.J.; Mitchell, M.W.; Song, Y.S.; Brisson, D. A fast machine-learning-guided primer design pipeline for selective whole genome amplification. PLoS Comput. Biol. 2023, 19, e1010137. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Xu, M.; Li, Q.; Wang, T.; Zhang, B.; Zhao, H.; Fu, J. The beneficial effects of polysaccharide obtained from persimmon (diospyros kaki l.) on the proliferation of lactobacillus and gut microbiota. Int. J. Biol. Macromol. 2021, 182, 1874–1882. [Google Scholar] [CrossRef]
- Edgar, R.C. Uparse: Highly accurate otu sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive bayesian classifier for rapid assignment of rrna sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef]
- Jabbar, A.; Tahir, M.; Alhidary, I.A.; Abdelrahman, M.A.; Albadani, H.; Khan, R.U.; Selvaggi, M.; Laudadio, V.; Tufarelli, V. Impact of microbial protease enzyme and dietary crude protein levels on growth and nutrients digestibility in broilers over 15–28 days. Animals 2021, 11, 2499. [Google Scholar] [CrossRef]
- Amer, S.A.; Beheiry, R.R.; Abdel Fattah, D.M.; Roushdy, E.M.; Hassan, F.A.M.; Ismail, T.A.; Zaitoun, N.M.A.; Abo-Elmaaty, A.M.A.; Metwally, A.E. Effects of different feeding regimens with protease supplementation on growth, amino acid digestibility, economic efficiency, blood biochemical parameters, and intestinal histology in broiler chickens. BMC Vet. Res. 2021, 17, 283. [Google Scholar] [CrossRef]
- Elleithy, E.M.M.; Bawish, B.M.; Kamel, S.; Ismael, E.; Bashir, D.W.; Hamza, D.; Fahmy, K.N.E. Influence of dietary bacillus coagulans and/or bacillus licheniformis-based probiotics on performance, gut health, gene expression, and litter quality of broiler chickens. Trop. Anim. Health Prod. 2023, 55, 38. [Google Scholar] [CrossRef]
- Zhang, B.; Zhang, H.; Yu, Y.; Zhang, R.; Wu, Y.; Yue, M.; Yang, C. Effects of bacillus coagulans on growth performance, antioxidant capacity, immunity function, and gut health in broilers. Poult. Sci. 2021, 100, 101168. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Ling, H.; Zhang, W.; Zhou, Y.; Li, Y.; Hu, Y.; Peng, N.; Zhao, S. Protease or clostridium butyricum addition to a low-protein diet improves broiler growth performance. Appl. Microbiol. Biotechnol. 2022, 106, 7917–7931. [Google Scholar] [CrossRef] [PubMed]
- Danilova, I.; Sharipova, M. The practical potential of bacilli and their enzymes for industrial production. Front. Microbiol. 2020, 11, 1782. [Google Scholar] [CrossRef]
- Zhou, Y.; Zeng, Z.; Xu, Y.; Ying, J.; Wang, B.; Majeed, M.; Majeed, S.; Pande, A.; Li, W. Application of bacillus coagulans in animal husbandry and its underlying mechanisms. Animals 2020, 10, 454. [Google Scholar] [CrossRef]
- Batavani, R.A.; Ansari, M.H.; Asri, S. Concentrations of serum total protein and protein fractions during diestrus and pregnancy in makuii ewes. Comp. Clin. Pathol. 2006, 15, 227–230. [Google Scholar] [CrossRef]
- Saleh, A.A.; Amber, K.A.; Soliman, M.M.; Soliman, M.Y.; Morsy, W.A.; Shukry, M.; Alzawqari, M.H. Effect of low protein diets with amino acids supplementation on growth performance, carcass traits, blood parameters and muscle amino acids profile in broiler chickens under high ambient temperature. Agriculture 2021, 11, 185. [Google Scholar] [CrossRef]
- Lin Law, F.; Idrus, Z.; Soleimani Farjam, A.; Juan Boo, L.; Awad, E.A. Effects of protease supplementation of low protein and/or energy diets on growth performance and blood parameters in broiler chickens under heat stress condition. Ital. J. Anim. Sci. 2019, 18, 679–689. [Google Scholar] [CrossRef]
- Namroud, N.F.; Shivazad, M.; Zaghari, M. Effects of fortifying low crude protein diet with crystalline amino acids on performance, blood ammonia level, and excreta characteristics of broiler chicks. Poult. Sci. 2008, 87, 2250–2258. [Google Scholar] [CrossRef] [PubMed]
- Rubio, L.A.; Brenes, A.; Centeno, C. Effects of feeding growing broiler chickens with practical diets containing sweet lupin (lupinus angustifolius) seed meal. Br. Poult. Sci. 2003, 44, 391–397. [Google Scholar] [CrossRef] [PubMed]
- Truong, H.H.; Chrystal, P.V.; Moss, A.F.; Selle, P.H.; Liu, S.Y. Rapid protein disappearance rates along the small intestine advantage poultry performance and influence the post-enteral availability of amino acids. Br. J. Nutr. 2017, 118, 1031–1042. [Google Scholar] [CrossRef]
- Chrystal, P.V.; Moss, A.F.; Khoddami, A.; Naranjo, V.D.; Selle, P.H.; Liu, S.Y. Impacts of reduced-crude protein diets on key parameters in male broiler chickens offered maize-based diets. Poult. Sci. 2020, 99, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Safari, H.; Mohit, A.; Mohiti-Asli, M. Feather meal processing methods impact the production parameters, blood biochemical indices, gut function, and hepatic enzyme activity in broilers. J. Anim. Sci. 2024, 102, skae068. [Google Scholar] [CrossRef] [PubMed]
- D’Mello, J.P.; Lewis, D. Amino acid interactions in chick nutrition. 2. Interrelationships between leucine, isoleucine and valine. Br. Poult. Sci. 1970, 11, 313–323. [Google Scholar] [CrossRef]
- Li, C.L.; Wang, J.; Zhang, H.J.; Wu, S.G.; Hui, Q.R.; Yang, C.B.; Fang, R.J.; Qi, G.H. Intestinal morphologic and microbiota responses to dietary bacillus spp. In a broiler chicken model. Front. Physiol. 2018, 9, 1968. [Google Scholar] [CrossRef] [PubMed]
- Sen, S.; Ingale, S.L.; Kim, Y.W.; Kim, J.S.; Kim, K.H.; Lohakare, J.D.; Kim, E.K.; Kim, H.S.; Ryu, M.H.; Kwon, I.K.; et al. Effect of supplementation of bacillus subtilis ls 1-2 to broiler diets on growth performance, nutrient retention, caecal microbiology and small intestinal morphology. Res. Vet. Sci. 2012, 93, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Kriseldi, R.; Tillman, P.B.; Jiang, Z.; Dozier, W.A., 3rd. Effects of feeding reduced crude protein diets on growth performance, nitrogen excretion, and plasma uric acid concentration of broiler chicks during the starter period. Poult. Sci. 2018, 97, 1614–1626. [Google Scholar] [CrossRef]
- Fotiadis, D.; Kanai, Y.; Palacín, M. The slc3 and slc7 families of amino acid transporters. Mol. Asp. Med. 2013, 34, 139–158. [Google Scholar] [CrossRef]
- Pineda, M.; Wagner, C.A.; Bröer, A.; Stehberger, P.A.; Kaltenbach, S.; Gelpí, J.L.; Martín Del Río, R.; Zorzano, A.; Palacín, M.; Lang, F.; et al. Cystinuria-specific rbat(r365w) mutation reveals two translocation pathways in the amino acid transporter rbat-b0,+at. Biochem. J. 2004, 377, 665–674. [Google Scholar] [CrossRef]
- García-Villalobos, H.; Morales-Trejo, A.; Araiza-Piña, B.A.; Htoo, J.K.; Cervantes-Ramírez, M. Effects of dietary protein and amino acid levels on the expression of selected cationic amino acid transporters and serum amino acid concentration in growing pigs. Arch. Anim. Nutr. 2012, 66, 257–270. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Yang, H.; Hou, Y.; Li, T.; Fang, J.; Zhou, X.; Yin, Y.; Wu, L.; Nyachoti, M.; Wu, G. Effects of dietary l-lysine intake on the intestinal mucosa and expression of cat genes in weaned piglets. Amino Acids 2013, 45, 383–391. [Google Scholar] [CrossRef]
- Morales, A.; Barrera, M.A.; Araiza, A.B.; Zijlstra, R.T.; Bernal, H.; Cervantes, M. Effect of excess levels of lysine and leucine in wheat-based, amino acid-fortified diets on the mrna expression of two selected cationic amino acid transporters in pigs. J. Anim. Physiol. Anim. Nutr. 2013, 97, 263–270. [Google Scholar] [CrossRef] [PubMed]
- Fagundes, N.S.; Milfort, M.C.; Williams, S.M.; Da Costa, M.J.; Fuller, A.L.; Menten, J.F.; Rekaya, R.; Aggrey, S.E. Dietary methionine level alters growth, digestibility, and gene expression of amino acid transporters in meat-type chickens. Poult. Sci. 2020, 99, 67–75. [Google Scholar] [CrossRef] [PubMed]
- Visigalli, R.; Barilli, A.; Parolari, A.; Sala, R.; Rotoli, B.M.; Bussolati, O.; Gazzola, G.C.; Dall’Asta, V. Regulation of arginine transport and metabolism by protein kinase calpha in endothelial cells: Stimulation of cat2 transporters and arginase activity. J. Mol. Cell Cardiol. 2010, 49, 260–270. [Google Scholar] [CrossRef]
- Hatanaka, T.; Huang, W.; Nakanishi, T.; Bridges, C.C.; Smith, S.B.; Prasad, P.D.; Ganapathy, M.E.; Ganapathy, V. Transport of d-serine via the amino acid transporter atb(0,+) expressed in the colon. Biochem. Biophys. Res. Commun. 2002, 291, 291–295. [Google Scholar] [CrossRef] [PubMed]
- Hatanaka, T.; Haramura, M.; Fei, Y.J.; Miyauchi, S.; Bridges, C.C.; Ganapathy, P.S.; Smith, S.B.; Ganapathy, V.; Ganapathy, M.E. Transport of amino acid-based prodrugs by the na+- and cl(-) -coupled amino acid transporter atb0,+ and expression of the transporter in tissues amenable for drug delivery. J. Pharmacol. Exp. Ther. 2004, 308, 1138–1147. [Google Scholar] [CrossRef]
- Sivaprakasam, S.; Sikder, M.O.F.; Ramalingam, L.; Kaur, G.; Dufour, J.M.; Moustaid-Moussa, N.; Wachtel, M.S.; Ganapathy, V. Slc6a14 deficiency is linked to obesity, fatty liver, and metabolic syndrome but only under conditions of a high-fat diet. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166087. [Google Scholar] [CrossRef]
- Lu, P.; Choi, J.; Yang, C.; Mogire, M.; Liu, S.; Lahaye, L.; Adewole, D.; Rodas-Gonzalez, A.; Yang, C. Effects of antibiotic growth promoter and dietary protease on growth performance, apparent ileal digestibility, intestinal morphology, meat quality, and intestinal gene expression in broiler chickens: A comparison. J. Anim. Sci. 2020, 98, skaa254. [Google Scholar] [CrossRef] [PubMed]
- Incharoen, T.; Yamauchi, K.-e.; Erikawa, T.; Gotoh, H. Histology of intestinal villi and epithelial cells in chickens fed low-crude protein or low-crude fat diets. Ital. J. Anim. Sci. 2010, 9, e82. [Google Scholar] [CrossRef]
- Liu, C.; Radebe, S.M.; Zhang, H.; Jia, J.; Xie, S.; Shi, M.; Yu, Q. Effect of bacillus coagulans on maintaining the integrity intestinal mucosal barrier in broilers. Vet. Microbiol. 2022, 266, 109357. [Google Scholar] [CrossRef] [PubMed]
- Allameh, S.; Toghyani, M. Effect of dietary valine supplementation to low protein diets on performance, intestinal morphology and immune responses in broiler chickens. Livest. Sci. 2019, 229, 137–144. [Google Scholar] [CrossRef]
- Otani, T.; Furuse, M. Tight junction structure and function revisited. Trends Cell Biol. 2020, 30, 805–817. [Google Scholar] [CrossRef]
- Cox, K.E.; Liu, S.; Lwin, T.M.; Hoffman, R.M.; Batra, S.K.; Bouvet, M. The mucin family of proteins: Candidates as potential biomarkers for colon cancer. Cancers 2023, 15, 1491. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Wang, P.; Liu, Z.H.; Ye, P. Analysis of differential expression of tight junction proteins in cultured oral epithelial cells altered by porphyromonas gingivalis, porphyromonas gingivalis lipopolysaccharide, and extracellular adenosine triphosphate. Int. J. Oral Sci. 2018, 10, e8. [Google Scholar] [CrossRef]
- Findley, M.K.; Koval, M. Regulation and roles for claudin-family tight junction proteins. IUBMB Life 2009, 61, 431–437. [Google Scholar] [CrossRef] [PubMed]
- Barekatain, R.; Nattrass, G.; Tilbrook, A.J.; Chousalkar, K.; Gilani, S. Reduced protein diet and amino acid concentration alter intestinal barrier function and performance of broiler chickens with or without synthetic glucocorticoid. Poult. Sci. 2019, 98, 3662–3675. [Google Scholar] [CrossRef] [PubMed]
- Forder, R.E.; Nattrass, G.S.; Geier, M.S.; Hughes, R.J.; Hynd, P.I. Quantitative analyses of genes associated with mucin synthesis of broiler chickens with induced necrotic enteritis. Poult. Sci. 2012, 91, 1335–1341. [Google Scholar] [CrossRef]
- Cowieson, A.J.; Lu, H.; Ajuwon, K.M.; Knap, I.; Adeola, O. Interactive effects of dietary protein source and exogenous protease on growth performance, immune competence and jejunal health of broiler chickens. Anim. Prod. Sci. 2017, 57, 252–261. [Google Scholar] [CrossRef]
- Beam, A.; Clinger, E.; Hao, L. Effect of diet and dietary components on the composition of the gut microbiota. Nutrients 2021, 13, 2795. [Google Scholar] [CrossRef] [PubMed]
- Dong, T.S.; Luu, K.; Lagishetty, V.; Sedighian, F.; Woo, S.L.; Dreskin, B.W.; Katzka, W.; Chang, C.; Zhou, Y.; Arias-Jayo, N.; et al. A high protein calorie restriction diet alters the gut microbiome in obesity. Nutrients 2020, 12, 3221. [Google Scholar] [CrossRef] [PubMed]
- Masuoka, H.; Suda, W.; Tomitsuka, E.; Shindo, C.; Takayasu, L.; Horwood, P.; Greenhill, A.R.; Hattori, M.; Umezaki, M.; Hirayama, K. The influences of low protein diet on the intestinal microbiota of mice. Sci. Rep. 2020, 10, 17077. [Google Scholar] [CrossRef]
- Cho, S.; Hwang, O.; Park, S. Effect of dietary protein levels on composition of odorous compounds and bacterial ecology in pig manure. Asian-Australas. J. Anim. Sci. 2015, 28, 1362–1370. [Google Scholar] [CrossRef] [PubMed]
- Lamendella, R.; Domingo, J.W.; Ghosh, S.; Martinson, J.; Oerther, D.B. Comparative fecal metagenomics unveils unique functional capacity of the swine gut. BMC Microbiol. 2011, 11, 103. [Google Scholar] [CrossRef] [PubMed]
- Ziemer, C.J. Broad diversity and newly cultured bacterial isolates from enrichment of pig feces on complex polysaccharides. Microb. Ecol. 2013, 66, 448–461. [Google Scholar] [CrossRef]
- Song, M.; Kim, B.; Cho, J.H.; Kyoung, H.; Choe, J.; Cho, J.Y.; Kim, Y.; Kim, H.B.; Lee, J.J. Modification of gut microbiota and immune responses via dietary protease in soybean meal-based protein diets. J. Microbiol. Biotechnol. 2022, 32, 885–891. [Google Scholar] [CrossRef]
- Dempsey, E.; Corr, S.C. Lactobacillus spp. For gastrointestinal health: Current and future perspectives. Front. Immunol. 2022, 13, 840245. [Google Scholar] [CrossRef] [PubMed]
- Schaus, S.R.; Vasconcelos Pereira, G.; Luis, A.S.; Madlambayan, E.; Terrapon, N.; Ostrowski, M.P.; Jin, C.; Henrissat, B.; Hansson, G.C.; Martens, E.C. Ruminococcus torques is a keystone degrader of intestinal mucin glycoprotein, releasing oligosaccharides used by bacteroides thetaiotaomicron. mBio 2024, 15, e0003924. [Google Scholar] [CrossRef]
- Liu, H.; Wang, S.; Chen, M.; Ji, H.; Zhang, D. Effects of lactobacillus-fermented low-protein diets on the growth performance, nitrogen excretion, fecal microbiota and metabolomic profiles of finishing pigs. Sci. Rep. 2024, 14, 8612. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Ouyang, Y.; Li, H.; Shen, L.; Ni, Y.; Fang, Q.; Wu, G.; Qian, L.; Xiao, Y.; Zhang, J.; et al. Metabolic phenotypes and the gut microbiota in response to dietary resistant starch type 2 in normal-weight subjects: A randomized crossover trial. Sci. Rep. 2019, 9, 4736. [Google Scholar] [CrossRef] [PubMed]
- Sharma, M.; Wasan, A.; Sharma, R.K. Recent developments in probiotics: An emphasis on bifidobacterium. Food Biosci. 2021, 41, 100993. [Google Scholar] [CrossRef]
Items 1 (%, Unless Otherwise Indicated) | Starter Diets (Days 0 to 21) | Grower Diets (Days 22 to 42) | ||
---|---|---|---|---|
CON | LPRO | CON | LPRO | |
Corn | 54.54 | 60.85 | 59.52 | 65.73 |
Soybean meal 46% | 33.80 | 27.80 | 26.30 | 20.40 |
Corn gluten meal | 5.00 | 5.00 | 5.00 | 5.00 |
Dicalcium phosphate | 1.00 | 1.00 | 0.80 | 0.80 |
Limestone | 1.50 | 1.50 | 1.30 | 1.40 |
Sodium chloride | 0.30 | 0.30 | 0.30 | 0.30 |
Premix 2 | 0.60 | 0.60 | 0.60 | 0.60 |
Soybean oil | 2.80 | 2.10 | 5.60 | 4.80 |
L-Lysine monohydrochloride 70% | 0.16 | 0.44 | 0.34 | 0.61 |
DL-Methionine 99% | 0.15 | 0.18 | 0.09 | 0.12 |
Threonine 98% | 0.08 | 0.09 | ||
Sodium bicarbonate | 0.15 | 0.15 | 0.15 | 0.15 |
100.00 | 100.00 | 100.00 | 100.00 | |
Calculated nutrient levels | ||||
ME (MJ/kg) | 12.52 | 12.54 | 13.43 | 13.40 |
Ca | 0.91 | 0.89 | 0.78 | 0.80 |
Available phosphorus | 0.70 | 0.68 | 0.62 | 0.60 |
Items 1 | Starter Diets (Days 0 to 21) | Grower Diets (Days 22 to 42) | ||
---|---|---|---|---|
CON | LPRO | CON | LPRO | |
Calculated nutrient levels | ||||
CP | 23.02 | 20.88 | 20.04 | 18.12 |
Total Lys% | 1.21 | 1.26 | 1.15 | 1.19 |
Total Met + Cys% | 0.89 | 0.87 | 0.75 | 0.73 |
Total Met% | 0.52 | 0.53 | 0.43 | 0.43 |
Total Thr% | 0.84 | 0.84 | 0.73 | 0.74 |
Total Val% | 1.05 | 0.94 | 0.91 | 0.81 |
Total Ile% | 0.97 | 0.87 | 0.83 | 0.73 |
Total Arg% | 1.45 | 1.27 | 1.21 | 1.04 |
Total Trp% | 0.24 | 0.21 | 0.20 | 0.17 |
Total His% | 0.59 | 0.53 | 0.51 | 0.46 |
Total Leu% | 2.19 | 2.05 | 1.99 | 1.85 |
Total Phe% | 1.15 | 1.04 | 1.00 | 0.89 |
Total Tyr% | 0.83 | 0.76 | 0.73 | 0.66 |
SID 2 Lys% | 1.01 | 1.06 | 0.94 | 0.98 |
SID Met + Cys% | 0.75 | 0.73 | 0.62 | 0.61 |
SID Met% | 0.46 | 0.46 | 0.36 | 0.37 |
SID Thr% | 0.68 | 0.68 | 0.58 | 0.59 |
SID Val% | 0.91 | 0.82 | 0.77 | 0.69 |
SID Ile% | 0.84 | 0.76 | 0.71 | 0.63 |
SID Arg% | 1.22 | 1.07 | 0.99 | 0.85 |
SID Trp% | 0.19 | 0.17 | 0.15 | 0.13 |
SID His% | 0.51 | 0.47 | 0.44 | 0.39 |
SID Leu% | 1.86 | 1.76 | 1.65 | 1.55 |
SID Phe% | 0.98 | 0.89 | 0.83 | 0.75 |
Analyzed nutrient levels | ||||
CP | 23.01 | 20.83 | 20.11 | 18.01 |
Total Lys% | 1.19 | 1.23 | 1.13 | 1.15 |
Total Met + Cys% | 0.87 | 0.88 | 0.78 | 0.74 |
Total Met% | 0.49 | 0.51 | 0.41 | 0.41 |
Total Thr% | 0.85 | 0.85 | 0.73 | 0.72 |
Total Val% | 1.17 | 1.04 | 0.93 | 0.88 |
Total Ile% | 0.95 | 0.86 | 0.87 | 0.77 |
Total Arg% | 1.43 | 1.29 | 1.18 | 1.05 |
Total Trp% | 0.25 | 0.22 | 0.20 | 0.17 |
Total His% | 0.56 | 0.51 | 0.51 | 0.47 |
Total Leu% | 2.10 | 2.00 | 1.94 | 1.80 |
Total Phe% | 1.05 | 0.94 | 0.87 | 0.78 |
Total Tyr% | 0.82 | 0.75 | 0.71 | 0.65 |
Gene Symbol 1 | Accession Number | Primer 5′-3′ | |
---|---|---|---|
ACT | NM_205518.2 | F 2 | CCAGCCATGTATGTAGCCATCCAG |
R 3 | GGTAACACCATCACCAGAGTCCATC | ||
SLC7A1 | NM_001398060.1 | F | CAAGAGGAAAACTCCAGTAATTGCA |
R | AAGTCGAAGAGGAAGGCCATAA | ||
SLC7A2 | XM_046916231.1 | F | TGCTCGCGTTCCCAAGA |
R | GGCCCACAGTTCACCAACAG | ||
SLC7A9 | XM_046925532.1 | F | TGGCTCAGGCATCTTTGTTTCCC |
R | ACAGGCTGCCCAGATGGTTAAAC | ||
SLC6A14 | XM_040670974.2 | F | TTGATGGAGGCAGAGGTTTGGAAAG |
R | AGCATCCGAGTAGCAGTTGTTGTG | ||
ZO1 | XM_040680630.1 | F | GCCTACTGCTGCTCCTTACAACTC |
R | GCTGGATCTATATGCGGCGGTAAG | ||
CLDN1 | NM_001013611.2 | F | ACACCCGTTAACACCAGATTT |
R | GCATTTTTGGGGTAGCCTCG | ||
OCLDN | NM_205128.1 | F | GATGGACAGCATCAACGACC |
R | CTTGCTTTGGTAGTCTGGGC | ||
MUC2 | XM_040673077.1 | F | ATTGAAGCCAGCAATGGTGT |
R | TGACATCAGGGCACACAGAT |
Items 1 | CON | LPRO | PRO | PAB | SEM | p-Value |
---|---|---|---|---|---|---|
1 to 21 d | ||||||
ADG | 28.57 | 29.11 | 28.97 | 28.84 | 1.032 | 0.851 |
ADFI | 37.97 | 37.58 | 37.38 | 36.78 | 1.351 | 0.511 |
FCR | 1.33 | 1.29 | 1.29 | 1.28 | 0.035 | 0.051 |
22 to 42 | ||||||
ADG | 69.72 a | 62.84 b | 70.90 a | 71.07 a | 4.089 | <0.001 |
ADFI | 108.09 b | 108.28 b | 113.55 a | 112.11 ab | 3.976 | 0.023 |
FCR | 1.55 b | 1.72 a | 1.60 b | 1.58 b | 0.077 | <0.001 |
1 to 42 d | ||||||
ADG | 49.15 a | 45.97 b | 49.93 a | 49.95 a | 2.209 | 0.001 |
ADFI | 73.03 | 73.29 | 75.85 | 74.61 | 2.339 | 0.129 |
FCR | 1.49 b | 1.59 a | 1.52 b | 1.49 b | 0.052 | <0.001 |
Item 1 | CON | LPRO | PRO | PAB | SEM | p-Value |
---|---|---|---|---|---|---|
TP | 36.28 b | 36.76 b | 42.82 a | 34.43 b | 0.870 | 0.001 |
ALB | 14.54 b | 15.37 ab | 16.03 a | 14.30 b | 0.252 | 0.047 |
GLO | 22.25 bc | 23.02 b | 26.52 a | 20.45 c | 0.596 | <0.001 |
BUN | 0.66 a | 0.53 b | 0.62 a | 0.54 b | 0.015 | 0.001 |
UA | 232.84 a | 138.16 c | 156.77 b | 248.91 a | 10.331 | <0.001 |
Items 1 | CON | LPRO | PRO | PAB | SEM | p-Value |
---|---|---|---|---|---|---|
Indispensable | ||||||
Thr | 1.78 b | 1.96 b | 2.26 a | 1.89 b | 0.048 | <0.001 |
Val | 2.08 b | 2.35 a | 2.38 a | 2.16 b | 0.039 | 0.005 |
Ile | 1.77 a | 1.31 c | 1.54 b | 1.36 c | 0.044 | <0.001 |
Leu | 3.05 c | 4.72 b | 5.50 a | 4.75 b | 0.201 | <0.001 |
Phe | 1.28 c | 1.78 b | 1.97 a | 1.77 b | 0.057 | <0.001 |
Dispensable | ||||||
Asp | 3.21 | 3.22 | 3.56 | 3.30 | 0.061 | 0.137 |
Glu | 5.01 b | 5.17 b | 6.00 a | 5.25 b | 0.110 | 0.002 |
Ser | 2.26 b | 2.44 b | 2.66 a | 2.23 b | 0.049 | 0.001 |
Arg | 2.30 b | 2.38 b | 2.67 a | 2.24 b | 0.053 | 0.011 |
Gly | 1.30 b | 1.34 b | 1.51a | 1.25 b | 0.029 | 0.002 |
Pro | 1.80 b | 1.90 b | 2.32 a | 1.95 b | 0.051 | <0.001 |
Ala | 1.83 b | 1.85 b | 2.19 a | 1.89 b | 0.044 | 0.004 |
Cys | 0.90 a | 0.62 b | 0.64 b | 0.56 c | 0.028 | <0.001 |
His | 4.22 b | 4.30 b | 4.73 a | 4.03 b | 0.078 | 0.004 |
Tyr | 1.43 b | 1.59 a | 1.70 a | 1.44 b | 0.031 | 0.001 |
Items 1 | CON | LPRO | PRO | PAB | SEM | p-Value |
---|---|---|---|---|---|---|
Duodenum | ||||||
VH | 1675.73 a | 1291.00 b | 1450.60 ab | 1591.17 a | 49.291 | 0.020 |
CD | 181.37 a | 186.97 a | 169.90 a | 127.68 b | 5.812 | <0.001 |
VH:CD | 9.30 b | 6.93 c | 8.74 bc | 12.53 a | 0.530 | <0.001 |
Jejunum | ||||||
VH | 1224.05 | 1206.61 | 1234.30 | 1268.73 | 33.219 | 0.936 |
CD | 151.31 | 167.63 | 165.15 | 144.83 | 3.892 | 0.106 |
VH:CD | 8.18 | 7.27 | 7.51 | 8.84 | 0.276 | 0.178 |
Ileum | ||||||
VH | 968.82 | 884.44 | 949.80 | 935.80 | 13.998 | 0.170 |
CD | 127.84 | 137.35 | 128.85 | 122.62 | 2.404 | 0.185 |
VH:CD | 7.59 | 6.47 | 7.40 | 7.75 | 0.189 | 0.067 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niu, J.; Qiao, Y.; Yang, X.; Chen, X.; Li, H.; Guo, Y.; Zhang, W.; Wang, Z. Protease and Bacillus coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition. Animals 2025, 15, 170. https://doi.org/10.3390/ani15020170
Niu J, Qiao Y, Yang X, Chen X, Li H, Guo Y, Zhang W, Wang Z. Protease and Bacillus coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition. Animals. 2025; 15(2):170. https://doi.org/10.3390/ani15020170
Chicago/Turabian StyleNiu, Junlong, Yingying Qiao, Xiaopeng Yang, Xiaoshuang Chen, Hongfei Li, Yongpeng Guo, Wei Zhang, and Zhixiang Wang. 2025. "Protease and Bacillus coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition" Animals 15, no. 2: 170. https://doi.org/10.3390/ani15020170
APA StyleNiu, J., Qiao, Y., Yang, X., Chen, X., Li, H., Guo, Y., Zhang, W., & Wang, Z. (2025). Protease and Bacillus coagulans Supplementation in a Low-Protein Diet Improves Broiler Growth, Promotes Amino Acid Transport Gene Activity, Strengthens Intestinal Barriers, and Alters the Cecal Microbial Composition. Animals, 15(2), 170. https://doi.org/10.3390/ani15020170