Effects of Dietary Coated Folic Acid and Folic Acid Addition on Lactation Performance, Rumen Fermentation, and Hepatic Lipid Content in Early Lactation Dairy Cows
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cows and Treatments
2.2. Data Collection, Sampling, and Determination
2.3. Statistical Analyses
3. Results
3.1. DMI, BW, and Lactation Performance
3.2. Nutrient Apparent Digestibility
3.3. Ruminal Fermentation and Microbial Population
3.4. Blood Metabolites and Hepatic Lipid Content
4. Discussion
4.1. Effect of CFA Addition
4.2. Effect of FA Addition
4.3. Comparison of CFA and FA Addition
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ceciliani, F.; Lecchi, C.; Urh, C.; Sauerwein, H. Proteomics and metabolomics characterizing the pathophysiology of adaptive reactions to the metabolic challenges during the transition from late pregnancy to early lactation in dairy cows. J. Proteom. 2018, 178, 92–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Girard, C.L.; Duplessis, M. Review: State of the knowledge on the importance of folates and cobalamin for dairy cow metabolism. Animal 2023, 17, 100834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duplessis, M.; Ritz, K.E.; Socha, M.T.; Girard, C.L. Cross-sectional study of the effect of diet composition on plasma folate and vitamin B12 concentrations in Holstein cows in the United States and Canada. J. Dairy Sci. 2019, 103, 2883–2895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duplessis, M.; Chorfi, Y.; Girard, C.L. Longitudinal data to assess relationships among plasma folate, vitamin B12, non-esterified fatty acid, and β-hydroxybutyrate concentrations of Holstein cows during the transition period. Metabolites 2023, 13, 547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, P.H. Vitamin B requirements and duodenal deliveries in lactating dairy cows: Organization of a limited literature. Livest. Sci. 2019, 226, 48–60. [Google Scholar] [CrossRef] [Scilit]
- Santschi, D.E.; Berthiaume, R.; Matte, J.J.; Mustafa, A.F.; Girard, C.L. Fate of supplementary B-vitamins in the gastrointestinal tract of dairy cows. J. Dairy Sci. 2005, 88, 2043–2054. [Google Scholar] [CrossRef] [Scilit]
- Girard, C.L.; Lapierre, H.; Desrochers, A.; Benchaar, C.; Matte, J.J.; Remond, D. Net flux of folates and vitamin B12 through the gastrointestinal tract and the liver of lactating dairy cows. Brit. J. Nutr. 2001, 86, 707–715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graulet, B.; Matte, J.J.; Desrochers, A.; Doepel, L.; Palin, M.F.; Girard, C.L. Effects of dietary supplements of folic acid and vitamin B12 on metabolism of dairy cows in early lactation. J. Dairy Sci. 2007, 90, 3442–3455. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; La, S.K.; Zhang, G.W.; Du, H.S.; Wu, Z.Z.; Wang, C.; Liu, Q.; Guo, G.; Huo, W.J.; Zhang, J.; et al. Diet supplementation of palm fat powder and coated folic acid on performance, energy balance, nutrient digestion, ruminal fermentation and blood metabolites of early lactation dairy cows. Anim. Feed Sci. Tech. 2020, 265, 114520. [Google Scholar] [CrossRef] [Scilit]
- Khan, M.Z.; Liu, L.; Zhang, Z.; Khan, A.; Wang, D.; Mi, S.; Usman, T.; Liu, G.; Guo, G.; Li, X.; et al. Folic acid supplementation regulates milk production variables, metabolic associated genes and pathways in perinatal Holsteins. J. Anim. Physiol. Anim. Nutr. 2020, 104, 483–492. [Google Scholar] [CrossRef] [Scilit]
- Baumgard, L.H.; Collier, R.J.; Bauman, D.E. A 100-year review: Regulation of nutrient partitioning to support lactation. J. Dairy Sci. 2017, 100, 10353–10366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stroes, E.S.; van Faassen, E.E.; Yo, M.; Martasek, P.; Boer, P.; Govers, R.; Rabelink, T.J. Folic acid reverts dysfunction of endothelial nitric oxide synthase. Circ. Res. 2000, 86, 1129–1134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ronco, A.M.; Garrido, A.; Llanos, M.N.; Guerrero-Bosagna, C.; Tamayo, D.; Hirsch, S. Effect of homocysteine, folates, and cobalamin on endothelial cell- and copper-induced LDL oxidation. Lipids 2005, 40, 259–264. [Google Scholar] [CrossRef] [Scilit]
- El-Tarabany, M.S.; Atta, M.A.; Emara, S.S.; Mostafa, M.M. Folic acid and flaxseed oil supplements in Ossimi ewes: Effect on body weight changes, progesterone profile, blood chemistry, and litter traits. Trop. Anim. Health Prod. 2020, 52, 301–308. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Mi, S.; Li, W.; Zhang, J.; Augustino, S.M.A.; Zhang, Z.; Zhang, R.; Xiao, W.; Yu, Y. Molecular regulatory mechanism of key LncRNAs in subclinical mastitic cows with folic acid supplementation. BMC Genom. 2023, 24, 464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopreiato, V.; Alharthi, A.S.; Liang, Y.; Elolimy, A.A.; Bucktrout, R.; Socha, M.T.; Trevisi, E.; Loor, J.J. Influence of cobalt source, folic acid, and rumen-protected methionine on performance, metabolism, and liver tissue one-carbon metabolism biomarkers in peripartal Holstein cows. Animals 2023, 13, 2107. [Google Scholar] [CrossRef] [Scilit]
- Slyter, L.L.; Weaver, J.M. Tetrahydrofolate and other growth requirements of certain strains of Ruminococcus flavefaciens. Appl. Environ. Microb. 1977, 33, 363–369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parnian-Khajehdizaj, F.; Taghizadeh, A.; Hosseinkhani, A.; Mesgaran, M.D. Evaluation of dietary supplementation of B vitamins and HMBi on fermentation kinetics, ruminal or post-ruminal diet digestibility using modified in vitro. Tech. J. BioSci. Biotech. 2018, 7, 125–133. [Google Scholar]
- Wang, L.; Li, Z.J.; Lei, X.J.; Yao, J.H. Effect of folic acid supplementation on lactation performance of Holstein dairy cows: A meta-analysis. Anim. Feed Sci. Tech. 2023, 296, 115551. [Google Scholar] [CrossRef] [Scilit]
- National Academies of Sciences Engineering and Medicine (NASEM). Nutrient Requirements of Dairy Cattle, 8th ed.; National Academies Press: Washington, DC, USA, 2021.
- Shingfield, K.J.; Ahvenjärvi, S.; Toivonen, V.; Ärölä, A.; Nurmela, K.V.V.; Huhtanen, P.; Griinari, J.M. Effect of dietary fish oil on biohydrogenation of fatty acids and milk fatty acid content in cows. Anim. Sci. 2003, 77, 165–179. [Google Scholar] [CrossRef] [Scilit]
- AOAC International. Official Methods of Analysis, 18th ed.; AOAC International: Gaithersburg, MD, USA, 2006. [Google Scholar]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [Scilit]
- Furuichi, Y.; Takahashi, T. Evaluation of acid-insoluble ash as a marker in digestion studies. Agric. Biol. Chem. 1981, 45, 2219–2224. [Google Scholar]
- Kongmun, P.; Wanapat, M.; Pakdee, P.; Navanukraw, C. Effect of coconut oil and garlic powder on in vitro fermentation using gas production technique. Livest. Sci. 2010, 127, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Metzler-Zebeli, B.U.; Schmitz-Esser, S.; Klevenhusen, F.; Podstatzky-Lichtenstein, L.; Wagner, M.; Zebeli, Q. Grain-rich diets differently alter ruminal and colonic abundance of microbial populations and lipopolysaccharide in goats. Anaerobe 2013, 20, 65–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gross, J.; Dorland, H.A.; Schwarz, F.J.; Bruckmaier, R.M. Endocrine changes and liver mRNA abundance of somatotropic axis and insulin system constituents during negative energy balance at different stages of lactation in dairy cows. J. Dairy Sci. 2011, 94, 3484–3494. [Google Scholar] [CrossRef] [Scilit]
- Drackley, J.K.; Veenhuizen, J.J.; Richard, M.J.; Young, J.W. Metabolic changes in blood and liver of dairy cows during either feed restriction or administration of 1,3-butanediol. J. Dairy Sci. 1991, 74, 4254–4264. [Google Scholar] [CrossRef] [Scilit]
- Menzies, K.K.; Lefevre, C.; Sharp, J.A.; Macmillan, K.L.; Sheehy, P.A.; Nicholas, K.R. A novel approach identified the FOLR1 gene, a putative regulator of milk protein synthesis. Mamm. Genome 2009, 20, 498–503. [Google Scholar]
- Piantoni, P.; VandeHaar, M.J. Symposium review: The impact of absorbed nutrients on energy partitioning throughout lactation. J. Dairy Sci. 2023, 106, 2167–2180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woolpert, M.E.; Dann, H.M.; Cotanch, K.W.; Melilli, C.; Chase, L.E.; Grant, R.J.; Barbano, D.M. Management practices, physically effective fiber, and ether extract are related to bulk tank milk de novo fatty acid concentration on Holstein dairy farms. J. Dairy Sci. 2017, 100, 5097–5106. [Google Scholar] [CrossRef] [Scilit]
- Billa, P.A.; Faulconnier, Y.; Larsen, T.; Leroux, C.; Pires, J.A.A. Milk metabolites as noninvasive indicators of nutritional status of mid-lactation Holstein and Montbéliarde cows. J. Dairy Sci. 2020, 103, 3133–3146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urrutia, N.L.; Harvatine, K.J. Acetate dose-dependently stimulates milk fat synthesis in lactating dairy cows. J. Nutr. 2017, 147, 763–769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.B.; Chen, D.W.; Xiang, B.M. Effects of maternal folic acid supplementation on morphology and apoptosis related gene expression in jejunum of newborn intrauterine growth retarded piglets. Arch. Anim. Nutr. 2011, 65, 376–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Liu, Q.; Guo, G.; Huo, W.J.; Ma, L.; Zhang, Y.L.; Pei, C.X.; Zhang, S.L.; Wang, H. Effects of rumen-protected folic acid on ruminal fermentation, microbial enzyme activity, cellulolytic bacteria and urinary excretion of purine derivatives in growing beef steers. Anim. Feed Sci. Technol. 2016, 221, 185–194. [Google Scholar] [CrossRef] [Scilit]
- Dijkstra, J.; Ellis, J.L.; Kebreab, E.; Strathe, A.B.; Lopezc, S.; France, J.; Bannink, A. Ruminal pH regulation and nutritional consequences of low pH. Anim. Feed Sci. Technol. 2012, 172, 22–33. [Google Scholar] [CrossRef] [Scilit]
- Russell, J.B.; Rychlik, J.L. Factors that alter rumen ecology. Science 2001, 292, 1119–1122. [Google Scholar] [CrossRef] [Scilit]
- Beauchemin, K.A.; Colombatto, D.; Morgavi, D.P.; Yang, W.Z.; Rode, L.M. Mode of action of exogenous cell wall degrading enzymes for ruminants. Can. J. Anim. Sci. 2004, 84, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.L.; Yang, J.T.; Liu, X.Y.; Liu, R.; Wang, Y.B.; Huang, X.H.; Li, Y.G.; Liu, R.F.; Yang, X.J. Dietary folic acid addition reduces abdominal fat deposition mediated by alterations in gut microbiota and SCFA production in broilers. Anim. Nutr. 2023, 12, 54–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Ao, X.; Lei, Y.; Ji, C.; Ma, Q. Bacillus subtilis ANSB01G culture alleviates oxidative stress and cell apoptosis induced by dietary zearalenone in first parity gestation sows. Anim. Nutr. 2020, 6, 372–378. [Google Scholar] [CrossRef] [Scilit]
- Herdt, T.H. Ruminant adaptation to negative energy balance: Influences on the etiology of ketosis and fatty liver. Vet. Clin. North Am. Food Anim. Pract. 2000, 16, 215–230. [Google Scholar] [CrossRef] [Scilit]
- Rico, J.E.; Barrientos-Blanco, M.A. Invited Review: Ketone biology: The shifting paradigm of ketones and ketosis in the dairy cow. J. Dairy Sci. 2023, 107, 3367–3388. [Google Scholar] [CrossRef] [Scilit]
- Sarna, L.K.; Wu, N.; Wang, P.; Hwang, S.Y.; Siow, Y.L.; Karmin, O. Folic acid supplementation attenuates high fat diet induced hepatic oxidative stress via regulation of NADPH oxidase. Can. J. Physiol. Pharmacol. 2012, 90, 155–165. [Google Scholar] [CrossRef] [Scilit]
- Sid, V.; Wu, N.; Sarna, L.K.; Siow, Y.L.; House, J.D.; Karmin, O. Folic acid supplementation during high-fat diet feeding restores AMPK activation via an AMP-LKB1-dependent mechanism. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2015, 309, R1215–R1225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Preynat, A.; Lapierre, H.; Thivierge, M.C.; Palin, M.F.; Cardinault, N.; Matte, J.J.; Desrochers, A.; Girard, C.L. Effects of supplementary folic acid and vitamin B12 on hepatic metabolism of dairy cows according to methionine supply. J. Dairy Sci. 2010, 93, 2130–2142. [Google Scholar] [CrossRef] [Scilit]
| Ingredients | Prepartum Diet | Postpartum Diet |
|---|---|---|
| Corn silage | 36.0 | 26.0 |
| Alfalfa hay | 13.0 | |
| Oat hay | 24.0 | 11.0 |
| Corn grain, ground | 15.1 | 24.0 |
| Wheat bran | 6.0 | 6.0 |
| Soybean meal | 10.0 | 10.6 |
| Rapeseed meal | 2.4 | 2.5 |
| Cottonseed cake | 5.2 | 5.0 |
| Calcium carbonate | 0.7 | 0.6 |
| Salt | 0.6 | 0.5 |
| Dicalcium phosphate | 0.4 | 0.3 |
| Mineral and vitamin premix 1 | 0.6 | 0.5 |
| Chemical composition | ||
| Organic matter | 94.5 | 94.5 |
| Crude protein | 16.0 | 17.2 |
| Ether extract | 3.2 | 3.2 |
| Neutral detergent fibre | 35.3 | 31.1 |
| Acid detergent fibre | 21.5 | 19.3 |
| Calcium | 0.72 | 0.73 |
| Phosphorus | 0.47 | 0.48 |
| Folate, mg/kg | 0.31 | 0.33 |
| Net energy for lactation 2, MJ/kg | 6.41 | 6.63 |
| Target Species | Primer Sequence (5′-3′) | GenBank Accession No. | Annealing Temperature (°C) | Size (bp) |
|---|---|---|---|---|
| Total bacteria | F: CGGCAACGAGCGCAACCC R: CCATTGTAGCACGTGTGTAGCC | CP058023.1 | 60 | 147 |
| Total fungi | F: GAGGAAGTAAAAGTCGTAACAAGGTTTC R: CAAATTCACAAAGGGTAGGATGATT | GQ355327.1 | 57.5 | 120 |
| Total protozoa | F: GCTTTCGWTGGTAGTGTATT R: CTTGCCCTCYAATCGTWCT | HM212038.1 | 59 | 234 |
| R. albus | F: CCCTAAAAGCAGTCTTAGTTCG R: CCTCCTTGCGGTTAGAACA | CP002403.1 | 60 | 176 |
| R. flavefaciens | F: ATTGTCCCAGTTCAGATTGC R: GGCGTCCTCATTGCTGTTAG | AB849343.1 | 60 | 173 |
| B.fibrisolvens | F: ACCGCATAAGCGCACGGA R: CGGGTCCATCTTGTACCGATAAAT | HQ404372.1 | 61 | 65 |
| F. succinogenes | F: GTTCGGAATTACTGGGCGTAAA R: CGCCTGCCCCTGAACTATC | AB275512.1 | 61 | 121 |
| Rb. amylophilus | F: CTGGGGAGCTGCCTGAATG R: GCATCTGAATGCGACTGGTTG | MH708240.1 | 60 | 102 |
| P. ruminicola | F: GAAAGTCGGATTAATGCTCTATGTTG R: CATCCTATAGCGGTAAACCTTTGG | LT975683.1 | 58.5 | 74 |
| Item 1 | Treatments 2 | SEM | Contrast, p 3 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | CFA | FA | Treatment | Source | CFA Level | FA Level | ||||||||
| LCFA | MCFA | HCFA | LFA | MFA | HFA | Linear | Quadratic | Linear | Quadratic | |||||
| Dry matter intake, kg/d | 26.1 | 25.6 | 25.3 | 25.5 | 25.5 | 26.1 | 25.8 | 0.551 | 0.301 | 0.432 | 0.265 | 0.332 | 0.158 | 0.316 |
| Body weight days 0 postpartum, kg | 665 | 672 | 681 | 667 | 677 | 679 | 664 | 21.08 | 0.453 | 0.668 | 0.556 | 0.437 | 0.331 | 0.365 |
| Body weight days 42 postpartum, kg | 636 | 648 | 660 | 647 | 651 | 651 | 633 | 19.45 | 0.378 | 0.346 | 0.477 | 0.356 | 0.273 | 0.254 |
| Body weight change, kg/d | −0.69 | −0.57 | −0.50 | −0.48 | −0.61 | −0.66 | −0.74 | 0.164 | 0.096 | 0.371 | 0.083 | 0.172 | 0.113 | 0.258 |
| Milk yield | ||||||||||||||
| Actual milk, kg/d | 41.0 b | 42.9 a | 42.8 a | 44.3 a | 40.6 b | 41.3 b | 39.8 b | 0.947 | 0.025 | 0.014 | 0.039 | 0.234 | 0.351 | 0.172 |
| Fat-corrected milk, kg/d | 41.7 c | 44.1 ab | 44.3 ab | 45.6 a | 43.3 b | 43.7 b | 41.7 c | 1.069 | 0.039 | 0.076 | 0.008 | 0.118 | 0.042 | 0.098 |
| Fat, kg/d | 1.69 b | 1.80 a | 1.81 a | 1.86 a | 1.80 a | 1.81 a | 1.72 b | 0.045 | 0.028 | 0.124 | 0.013 | 0.274 | 0.022 | 0.107 |
| Protein, kg/d | 1.35 b | 1.40 ab | 1.45 a | 1.51 a | 1.32 b | 1.37 b | 1.37 b | 0.034 | 0.033 | 0.018 | 0.011 | 0.135 | 0.157 | 0.263 |
| Lactose, kg/d | 2.16 | 2.27 | 2.28 | 2.35 | 2.12 | 2.16 | 2.09 | 0.093 | 0.108 | 0.236 | 0.096 | 0.318 | 0.263 | 0.332 |
| Milk composition content | ||||||||||||||
| Fat, % | 4.12 | 4.18 | 4.24 | 4.20 | 4.44 | 4.38 | 4.32 | 0.113 | 0.116 | 0.254 | 0.108 | 0.262 | 0.253 | 0.174 |
| Protein, % | 3.28 | 3.26 | 3.38 | 3.41 | 3.24 | 3.32 | 3.45 | 0.093 | 0.084 | 0.118 | 0.253 | 0.304 | 0.275 | 0.311 |
| Lactose, % | 5.26 | 5.29 | 5.33 | 5.31 | 5.22 | 5.24 | 5.26 | 0.103 | 0.515 | 0.172 | 0.233 | 0.139 | 0.216 | 0.158 |
| Urea nitrogen, mg/dL | 12.2 | 12.0 | 11.9 | 11.7 | 11.5 | 12.3 | 12.5 | 0.191 | 0.346 | 0.534 | 0.382 | 0.178 | 0.333 | 0.264 |
| De novo FAs, g/100 g FAs | 25.3 b | 26.6 a | 26.9 a | 27.0 a | 24.8 b | 24.7 b | 25.1 b | 0.402 | 0.013 | 0.012 | 0.043 | 0.214 | 0.122 | 0.333 |
| Mixed FAs, g/100 g FAs | 31.2 | 30.8 | 30.7 | 30.9 | 31.3 | 31.9 | 31.3 | 0.731 | 0.476 | 0.273 | 0.118 | 0.154 | 0.237 | 0.134 |
| Preformed FAs, g/100 g FAs | 42.2 a | 41.5 ab | 41.0 b | 40.9 b | 42.5 a | 42.0 a | 41.9 a | 0.392 | 0.011 | 0.033 | 0.024 | 0.315 | 0.245 | 0218 |
| Feed efficiency | 1.57 b | 1.68 ab | 1.71 a | 1.73 a | 1.59 b | 1.58 b | 1.54 b | 0.062 | 0.008 | 0.026 | 0.035 | 0.277 | 0.412 | 0.254 |
| Item | Treatments 1 | SEM | Contrast, p 2 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | CFA | FA | Treatment | Source | CFA Level | FA Level | ||||||||
| LCFA | MCFA | HCFA | LFA | MFA | HFA | Linear | Quadratic | Linear | Quadratic | |||||
| Dry matter, % | 71.3 c | 73.4 b | 75.5 a | 75.0 a | 73.7 b | 73.8 b | 70.7 c | 1.077 | 0.014 | 0.103 | 0.008 | 0.535 | 0.691 | 0.037 |
| Organic matter, % | 72.0 c | 74.8 b | 76.3 a | 76.7 a | 74.5 ab | 74.3 b | 73.6 b | 1.135 | 0.017 | 0.093 | 0.002 | 0.832 | 0.048 | 0.136 |
| Crude protein, % | 69.4 b | 70.8 b | 72.1 a | 72.6 a | 70.8 b | 71.3 b | 68.2 b | 1.136 | 0.014 | 0.116 | 0.017 | 0.555 | 0.334 | 0.722 |
| Neutral detergent fibre, % | 53.2 c | 56.2 b | 56.3 b | 59.0 a | 58.3 a | 57.2 a | 58.0 a | 1.408 | 0.007 | 0.374 | 0.011 | 0.924 | 0.014 | 0.198 |
| Acid detergent fibre, % | 49.9 b | 50.9 b | 53.6 a | 53.4 a | 51.5 b | 50.7 b | 51.4 b | 1.382 | 0.018 | 0.105 | 0.034 | 0.797 | 0.463 | 0.566 |
| Item 1 | Treatments 2 | SEM | Contrast, p 3 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | CFA | FA | Treatment | Source | CFA Level | FA Level | ||||||||
| LCFA | MCFA | HCFA | LFA | MFA | HFA | Linear | Quadratic | Linear | Quadratic | |||||
| Rumen pH | 6.56 | 6.51 | 6.46 | 6.40 | 6.35 | 6.29 | 6.41 | 0.133 | 0.239 | 0.246 | 0.128 | 0.117 | 0.281 | 0.121 |
| Total VFA, mmol/L | 112 c | 121 b | 126 ab | 132 a | 129 a | 134 a | 112 c | 2.459 | 0.028 | 0.286 | 0.033 | 0.187 | 0.241 | 0.041 |
| Acetate, % | 61.8 | 62.9 | 62.4 | 62.4 | 62.8 | 60.9 | 61.4 | 1.245 | 0.133 | 0.177 | 0.168 | 0.259 | 0.187 | 0.233 |
| Propionate, % | 22.9 b | 21.9 b | 22.2 b | 22.2 b | 22.9 b | 25.1 a | 24.5 a | 1.122 | 0.047 | 0.031 | 0.447 | 0.696 | 0.027 | 0.251 |
| Butyrate, % | 10.3 | 9.7 | 9.7 | 9.5 | 9.00 | 8.81 | 9.00 | 0.863 | 0.663 | 0.275 | 0.326 | 0.257 | 0.125 | 0.383 |
| Valerate, % | 2.50 | 2.50 | 2.53 | 2.75 | 2.35 | 2.55 | 2.32 | 0.042 | 0.236 | 0.138 | 0.241 | 0.287 | 0.129 | 0.286 |
| Isobutyrate, % | 1.33 | 1.18 | 1.35 | 1.21 | 1.25 | 1.12 | 1.09 | 0.013 | 0.106 | 0.096 | 0.253 | 0.426 | 0.188 | 0.167 |
| Isovalerate, % | 1.11 c | 1.77 b | 1.73 b | 1.96 a | 1.60 b | 1.52 b | 1.64 b | 0.038 | 0.040 | 0.019 | 0.027 | 0.159 | 0.042 | 0.246 |
| Acetate/Propionate | 2.70 b | 2.87 a | 2.81 a | 2.81 a | 2.74 ab | 2.43 b | 2.51 b | 0.006 | 0.032 | 0.028 | 0.017 | 0.263 | 0.058 | 0.389 |
| Total bacteria, ×1011/mL | 5.55 c | 8.16 b | 8.47 b | 9.30 a | 9.14 a | 9.13 a | 7.89 b | 0.200 | 0.003 | 0.343 | 0.018 | 0.604 | 0.034 | 0.529 |
| Fungi, ×107/mL | 2.51 c | 3.70 b | 4.90 a | 5.12 a | 5.24 a | 5.35 a | 2.76 c | 0.232 | 0.007 | 0.312 | 0.020 | 0.349 | 0.306 | 0.017 |
| Protozoa, ×105/mL | 1.31 c | 1.53 c | 2.81 b | 3.61 a | 3.50 a | 3.54 a | 3.69 a | 0.146 | 0.001 | 0.014 | 0.008 | 0.200 | 0.007 | 0.176 |
| R. albus, ×108/mL | 1.06 c | 1.12c | 1.66 b | 2.60 a | 2.40 a | 1.72 b | 0.97 c | 0.155 | 0.032 | 0.651 | 0.006 | 0.118 | 0.104 | 0.003 |
| R. flavefaciens, ×109/mL | 1.46 c | 2.36 b | 2.57 b | 3.03 b | 3.97 a | 3.13 ab | 1.65 c | 0.114 | 0.014 | 0.083 | 0.013 | 0.183 | 0.171 | 0.013 |
| F. fuccinogenes, ×1010/mL | 4.96 c | 5.17 b c | 5.97 b | 6.91 a | 7.34 a | 7.14 a | 7.25 a | 0.157 | 0.020 | 0.007 | 0.028 | 0.426 | 0.022 | 0.142 |
| B. fibrisolvens, ×109/mL | 2.15 | 2.44 | 2.36 | 2.46 | 3.04 | 2.53 | 2.75 | 0.216 | 0.141 | 0.166 | 0.133 | 0.168 | 0.411 | 0.148 |
| P. ruminicola, ×109/mL | 5.09 b | 5.48 b | 6.57 a | 6.77 a | 7.09 a | 6.76 a | 7.07 a | 0.211 | 0.007 | 0.023 | 0.029 | 0.253 | 0.016 | 0.432 |
| Rb. amylophilus, ×108/mL | 2.94 b | 3.15 b | 3.55 a | 3.74 a | 3.68 a | 3.64 a | 3.61 a | 0.158 | 0.009 | 0.421 | 0.047 | 0.469 | 0.005 | 0.333 |
| Item 1 | Treatments 2 | SEM | Contrast, p 3 | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Control | CFA | FA | Treatment | Source | CFA Level | FA Level | ||||||||
| LCFA | MCFA | HCFA | LFA | MFA | HFA | Linear | Quadratic | Linear | Quadratic | |||||
| Blood | ||||||||||||||
| Glucose, mmol/L | 3.59 | 3.67 | 3.99 | 3.89 | 3.55 | 3.62 | 3.84 | 0.246 | 0.057 | 0.343 | 0.406 | 0.337 | 0.286 | 0.382 |
| Total protein, g/L | 73.9 b | 80.4 a | 77.5 a | 77.1 a | 73.6 b | 72.1 b | 70.8 b | 2.270 | 0.045 | 0.032 | 0.026 | 0.486 | 0.340 | 0.214 |
| Albumin, g/L | 40.5 b | 44.4 a | 43.4 a | 44.2 a | 40.7 b | 39.8 b | 40.6 b | 2.414 | 0.035 | 0.018 | 0.009 | 0.545 | 0.395 | 0.248 |
| SOD, U/mL | 75.5 b | 96.9 a | 101.6 a | 107.2 a | 81.3 b | 77.6 b | 72.1 b | 5.307 | 0.038 | 0.027 | 0.014 | 0.751 | 0.235 | 0.676 |
| GSH-Px, U/mL | 526 b | 585 a | 552 a | 570 a | 537 b | 529 b | 516 b | 18.41 | 0.003 | 0.011 | 0.006 | 0.521 | 0.156 | 0.273 |
| MDA, nmol/L | 6.41 a | 5.13 b | 5.50 b | 5.20 b | 5.96 ab | 6.31 a | 6.29 a | 0.431 | 0.048 | 0.037 | 0.027 | 0.382 | 0.086 | 0.337 |
| Folate, µmol/L | 13.7 b | 15.1 a | 15.9 a | 16.8 a | 13.9 b | 14.3 b | 14.5 b | 0.621 | 0.003 | 0.007 | 0.003 | 0.138 | 0.252 | 0.371 |
| 5-MTHF, ng/mL | 27.6 b | 31.8 a | 31.9 a | 33.6 a | 27.9 b | 28.3 b | 28.3 b | 1.154 | 0.002 | 0.038 | 0.021 | 0.137 | 0.256 | 0.146 |
| Hcy, µmol/L | 11.7 a | 9.04 b | 9.78 b | 9.66 b | 11.2 a | 11.0 a | 11.9 a | 0.424 | 0.003 | 0.042 | 0.019 | 0.357 | 0.168 | 0.346 |
| TG, mmol/L | 7.39 | 7.18 | 7.23 | 7.09 | 7.16 | 7.33 | 7.10 | 0.108 | 0.381 | 0.287 | 0.395 | 0.468 | 0.476 | 0.648 |
| NEFA, mmol/L | 0.42 a | 0.38 b | 0.36 b | 0.36 b | 0.43 a | 0.41 a | 0.41 a | 0.019 | 0.027 | 0.005 | 0.016 | 0.677 | 0.482 | 0.575 |
| BHB, mmol/L | 1.06 a | 0.83 b | 0.88 b | 0.89 b | 0.96 a | 0.99 a | 1.01 a | 0.012 | 0.027 | 0.013 | 0.011 | 0.248 | 0.328 | 0.261 |
| VLDL, mmol/L | 1.11 | 1.14 | 1.17 | 1.17 | 1.19 | 1.16 | 1.14 | 0.452 | 0.100 | 0.873 | 0.459 | 0.593 | 0.431 | 0.647 |
| ApoB100, pg/mL | 1019 | 1035 | 1061 | 1041 | 1049 | 1027 | 1022 | 22.08 | 0.384 | 0.267 | 0.185 | 0.153 | 0.124 | 0.284 |
| Liver | ||||||||||||||
| Total lipid, mg/g fresh tissue | 51.4 a | 46.5 b | 46.1 b | 45.6 b | 49.9 a | 51.8 a | 51.4 a | 0.825 | 0.022 | 0.006 | 0.013 | 0.421 | 0.332 | 0.286 |
| TG, mg/g fresh tissue | 23.4 a | 21.9 b | 21.3 b | 20.8 b | 22.3 a | 22.8 a | 23.5 a | 0.905 | 0.044 | 0.014 | 0.026 | 0.376 | 0.263 | 0.417 |
| Folate, µg/g fresh tissue | 8.12 b | 11.1 a | 11.1 a | 12.3 a | 8.27 b | 8.63 b | 8.07 b | 0.798 | 0.001 | 0.023 | 0.008 | 0.299 | 0.431 | 0.345 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, N.; Zou, S.; Feng, J.; Guo, G.; Liu, Q.; Zhang, Y.; Chen, L.; Huo, W.; Wang, C. Effects of Dietary Coated Folic Acid and Folic Acid Addition on Lactation Performance, Rumen Fermentation, and Hepatic Lipid Content in Early Lactation Dairy Cows. Animals 2025, 15, 169. https://doi.org/10.3390/ani15020169
Sun N, Zou S, Feng J, Guo G, Liu Q, Zhang Y, Chen L, Huo W, Wang C. Effects of Dietary Coated Folic Acid and Folic Acid Addition on Lactation Performance, Rumen Fermentation, and Hepatic Lipid Content in Early Lactation Dairy Cows. Animals. 2025; 15(2):169. https://doi.org/10.3390/ani15020169
Chicago/Turabian StyleSun, Nan, Songming Zou, Jiaxin Feng, Gang Guo, Qiang Liu, Yawei Zhang, Lei Chen, Wenjie Huo, and Cong Wang. 2025. "Effects of Dietary Coated Folic Acid and Folic Acid Addition on Lactation Performance, Rumen Fermentation, and Hepatic Lipid Content in Early Lactation Dairy Cows" Animals 15, no. 2: 169. https://doi.org/10.3390/ani15020169
APA StyleSun, N., Zou, S., Feng, J., Guo, G., Liu, Q., Zhang, Y., Chen, L., Huo, W., & Wang, C. (2025). Effects of Dietary Coated Folic Acid and Folic Acid Addition on Lactation Performance, Rumen Fermentation, and Hepatic Lipid Content in Early Lactation Dairy Cows. Animals, 15(2), 169. https://doi.org/10.3390/ani15020169

