The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Animals and Cell Sampling
2.3. Isolation of Bovine PBMCs and PMNs
2.4. NEFE, Vitamin E, and Medium Preparation
2.5. Cell Culture
2.6. Vitamin E Detection
2.7. SOD Activity Detection
2.8. TABRS Detection
2.9. Determination of Cytokine mRNA Expression
2.10. Phagocytosis
2.11. Statistical Analysis
3. Results
3.1. Cellular Vitamin E Content
3.2. Oxidative Stress (SOD Activity and TABRS)
3.3. Inflammation-Related Cytokine Gene Expression and Phagocytosis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Herdt, T.H. Ruminant adaptation to negative energy balance. Influences on the etiology of ketosis and fatty liver. Vet. Clin. N. Am. Food Anim. Pract. 2000, 16, 215–230. [Google Scholar] [CrossRef] [PubMed]
- Sordillo, L.M.; Aitken, S.L. Impact of oxidative stress on the health and immune function of dairy cattle. Vet. Immunol. Immunopathol. 2009, 128, 104–109. [Google Scholar] [CrossRef] [PubMed]
- Melendez, P.; Marin, M.P.; Robles, J.; Rios, C.; Duchens, M.; Archbald, L. Relationship between serum nonesterified fatty acids at calving and the incidence of periparturient diseases in Holstein dairy cows. Theriogenology 2009, 72, 826–833. [Google Scholar] [CrossRef] [PubMed]
- Marutsova, V.; Binev, R.; Marutsov, P. Comparative Clinical and Haematological Investigations in Lactating Cows with Subclinical and Clinical Ketosis. Maced. Vet. Rev. 2015, 38, 159–166. [Google Scholar] [CrossRef]
- Shimizu, T.; Morino, I.; Kitaoka, R.; Miyamoto, A.; Kawashima, C.; Haneda, S.; Magata, F. Changes of leukocyte counts and expression of pro- and anti-inflammatory cytokines in peripheral leukocytes in periparturient dairy cows with retained fetal membranes. Anim. Sci. J. 2018, 89, 1371–1378. [Google Scholar] [CrossRef]
- Trevisi, E.; Minuti, A. Assessment of the innate immune response in the periparturient cow. Res. Vet. Sci. 2018, 116, 47–54. [Google Scholar] [CrossRef]
- Scalia, D.; Lacetera, N.; Bernabucci, U.; Demeyere, K.; Duchateau, L.; Burvenich, C. In vitro effects of nonesterified fatty acids on bovine neutrophils oxidative burst and viability. J. Dairy Sci. 2006, 89, 147–154. [Google Scholar] [CrossRef] [PubMed]
- Li, C.-Y.; Liao, Y.-W.; Liu, C.-S.; Cheng, C.-Y.; Chan, J.P.-W.; Wang, C.-K. In vitro effects of nonesterified fatty acids and β-hydroxybutyric acid on inflammatory cytokine expression in bovine peripheral blood leukocytes. Ital. J. Anim. Sci. 2021, 20, 2197–2210. [Google Scholar] [CrossRef]
- Uchida, K.; Beck, D.C.; Yamamoto, T.; Berclaz, P.Y.; Abe, S.; Staudt, M.K.; Carey, B.C.; Filippi, M.D.; Wert, S.E.; Denson, L.A.; et al. GM-CSF autoantibodies and neutrophil dysfunction in pulmonary alveolar proteinosis. N. Engl. J. Med. 2007, 356, 567–579. [Google Scholar] [CrossRef] [PubMed]
- Hidaka, T.; Akada, S.; Teranishi, A.; Morikawa, H.; Sato, S.; Yoshida, Y.; Yajima, A.; Yaegashi, N.; Okamura, K.; Saito, S. Mirimostim (macrophage colony-stimulating factor; M-CSF) improves chemotherapy-induced impaired natural killer cell activity, Th1/Th2 balance, and granulocyte function. Cancer Sci. 2003, 94, 814–820. [Google Scholar] [CrossRef]
- Stabel, J.R.; Kehrli, M.E., Jr.; Thurston, J.R.; Goff, J.P.; Boone, T.C. Granulocyte colony-stimulating factor effects on lymphocytes and immunoglobulin concentrations in periparturient cows. J. Dairy Sci. 1991, 74, 3755–3762. [Google Scholar] [CrossRef] [PubMed]
- Kehrli, M.E., Jr.; Goff, J.P.; Stevens, M.G.; Boone, T.C. Effects of granulocyte colony-stimulating factor administration to periparturient cows on neutrophils and bacterial shedding. J. Dairy Sci. 1991, 74, 2448–2458. [Google Scholar] [CrossRef] [PubMed]
- McDougall, S.; LeBlanc, S.J.; Heiser, A. Effect of prepartum energy balance on neutrophil function following pegbovigrastim treatment in periparturient cows. J. Dairy Sci. 2017, 100, 7478–7492. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, J.A. Colony-stimulating factors in inflammation and autoimmunity. Nat. Rev. Immunol. 2008, 8, 533–544. [Google Scholar] [CrossRef] [PubMed]
- Weiss, W.P.; Todhunter, D.A.; Hogan, J.S.; Smith, K.L. Effect of Duration of Supplementation of Selenium and Vitamin E on Periparturient Dairy Cows1. J. Dairy Sci. 1990, 73, 3187–3194. [Google Scholar] [CrossRef] [PubMed]
- Castillo, C.; Hernández, J.; Bravo, A.; Lopez-Alonso, M.; Pereira, V.; Benedito, J.L. Oxidative status during late pregnancy in dairy cows. Vet. J. 2005, 169, 286–292. [Google Scholar] [CrossRef] [PubMed]
- Politis, I.; Bizelis, I.; Tsiaras, A.; Baldi, A. Effect of vitamin E supplementation on neutrophil function, milk composition and plasmin activity in dairy cows in a commercial herd. J. Dairy Res. 2004, 71, 273–278. [Google Scholar] [CrossRef] [PubMed]
- Politis, I.; Hidiroglou, M.; Batra, T.R.; Gilmore, J.A.; Gorewit, R.C.; Scherf, H. Effects of vitamin E on immune function of dairy cows. Am. J. Vet. Res. 1995, 56, 179–184. [Google Scholar] [CrossRef] [PubMed]
- Sordillo, L.M. Nutritional strategies to optimize dairy cattle immunity1. J. Dairy Sci. 2016, 99, 4967–4982. [Google Scholar] [CrossRef] [PubMed]
- Hall, J.A.; Bobe, G.; Vorachek, W.R.; Kasper, K.; Traber, M.G.; Mosher, W.D.; Pirelli, G.J.; Gamroth, M. Effect of Supranutritional Organic Selenium Supplementation on Postpartum Blood Micronutrients, Antioxidants, Metabolites, and Inflammation Biomarkers in Selenium-Replete Dairy Cows. Biol. Trace Elem. Res. 2014, 161, 272–287. [Google Scholar] [CrossRef] [PubMed]
- Bouwstra, R.J.; Goselink, R.M.A.; Dobbelaar, P.; Nielen, M.; Newbold, J.R.; van Werven, T. The Relationship Between Oxidative Damage and Vitamin E Concentration in Blood, Milk, and Liver Tissue from Vitamin E Supplemented and Nonsupplemented Periparturient Heifers. J. Dairy Sci. 2008, 91, 977–987. [Google Scholar] [CrossRef] [PubMed]
- Romana Kadek, J.F.; Mikulková, K.; Illek, J. Concentration of vitamin E in bovine plasma and erythrocytes. Acta Vet. Brno. 2022, 91, 133–139. [Google Scholar] [CrossRef]
- National Research Council, Committee on Animal Nutrition, Subcommittee on Dairy Cattle Nutrition. Nutrient Requirements of Dairy Cattle; National Academies Press: Washington, DC, USA, 2001. [Google Scholar]
- Horn, P.; Bork, S.; Wagner, W. Standardized Isolation of Human Mesenchymal Stromal Cells with Red Blood Cell Lysis. In Mesenchymal Stem Cell Assays and Applications; Vemuri, M., Chase, L.G., Rao, M.S., Eds.; Humana Press: Totowa, NJ, USA, 2011; pp. 23–35. [Google Scholar] [CrossRef]
- Douglas, G.N.; Rehage, J.; Beaulieu, A.D.; Bahaa, A.O.; Drackley, J.K. Prepartum Nutrition Alters Fatty Acid Composition in Plasma, Adipose Tissue, and Liver Lipids of Periparturient Dairy Cows. J. Dairy Sci. 2007, 90, 2941–2959. [Google Scholar] [CrossRef]
- Lacetera, N.; Scalia, D.; Franci, O.; Bernabucci, U.; Ronchi, B.; Nardone, A. Short Communication: Effects of Nonesterified Fatty Acids on Lymphocyte Function in Dairy Heifers. J. Dairy Sci. 2004, 87, 1012–1014. [Google Scholar] [CrossRef] [PubMed]
- Adolfsson, O.; Huber, B.T.; Meydani, S.N. Vitamin E-Enhanced IL-2 Production in Old Mice: Naive But Not Memory T Cells Show Increased Cell Division Cycling and IL-2-Producing Capacity1. J. Immunol. 2001, 167, 3809–3817. [Google Scholar] [CrossRef] [PubMed]
- Wankhade, P.R.; Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Ramesha, K.P.; Sejian, V.; Rajendran, D.; Varghese, M.R. Metabolic and immunological changes in transition dairy cows: A review. Vet. World 2017, 10, 1367–1377. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Zhang, B.; Xu, C.; Zhang, H.; Cheng, X. Effects of Ketosis in Dairy Cows on Blood Biochemical Parameters, Milk Yield and Composition, and Digestive Capacity. J. Vet. Res. 2019, 63, 555–560. [Google Scholar] [CrossRef] [PubMed]
- Robinson, T.L.; Sutherland, I.A.; Sutherland, J. Validation of candidate bovine reference genes for use with real-time PCR. Vet. Immunol. Immunopathol. 2007, 115, 160–165. [Google Scholar] [CrossRef] [PubMed]
- Hayirli, A.; Grummer, R.R.; Nordheim, E.V.; Crump, P.M. Models for Predicting Dry Matter Intake of Holsteins During the Prefresh Transition Period. J. Dairy Sci. 2003, 86, 1771–1779. [Google Scholar] [CrossRef] [PubMed]
- Weber, C.; Hametner, C.; Tuchscherer, A.; Losand, B.; Kanitz, E.; Otten, W.; Singh, S.P.; Bruckmaier, R.M.; Becker, F.; Kanitz, W.; et al. Variation in fat mobilization during early lactation differently affects feed intake, body condition, and lipid and glucose metabolism in high-yielding dairy cows. J. Dairy Sci. 2013, 96, 165–180. [Google Scholar] [CrossRef] [PubMed]
- van der Drift, S.G.A.; Houweling, M.; Schonewille, J.T.; Tielens, A.G.M.; Jorritsma, R. Protein and fat mobilization and associations with serum β-hydroxybutyrate concentrations in dairy cows. J. Dairy Sci. 2012, 95, 4911–4920. [Google Scholar] [CrossRef]
- Reynolds, C.K.; Aikman, P.C.; Lupoli, B.; Humphries, D.J.; Beever, D.E. Splanchnic Metabolism of Dairy Cows During the Transition From Late Gestation Through Early Lactation. J. Dairy Sci. 2003, 86, 1201–1217. [Google Scholar] [CrossRef] [PubMed]
- Pullen, D.L.; Liesman, J.S.; Emery, R.S. A species comparison of liver slice synthesis and secretion of triacylglycerol from nonesterified fatty acids in media2. J. Anim. Sci. 1990, 68, 1395–1399. [Google Scholar] [CrossRef]
- Herdt, T.H.; Wensing, T.; Haagsman, H.P.; van Golde, L.M.G.; Breukink, H.J. Hepatic Triacylglycerol Synthesis during a Period of Fatty Liver Development in Sheep2. J. Anim. Sci. 1988, 66, 1997–2013. [Google Scholar] [CrossRef]
- Shu, C. Investigation on the Relationship of Insulin Resistance and Ketosis in Dairy Cows. J. Vet. Sci. Technol. 2014, 5, 2–5. [Google Scholar] [CrossRef]
- Li, Y.; Ding, H.Y.; Wang, X.C.; Feng, S.B.; Li, X.B.; Wang, Z.; Liu, G.W.; Li, X.W. An association between the level of oxidative stress and the concentrations of NEFA and BHBA in the plasma of ketotic dairy cows. J. Anim. Physiol. Anim. Nutr. 2016, 100, 844–851. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Li, D.; Deng, Q.; Li, Y.; Sun, G.; Yuan, X.; Song, Y.; Wang, Z.; Li, X.; Li, X.; et al. NEFAs activate the oxidative stress-mediated NF-κB signaling pathway to induce inflammatory response in calf hepatocytes. J. Steroid Biochem. Mol. Biol. 2015, 145, 103–112. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Huang, J.; Chen, X.; Yan, Y.; Li, L.; Zhao, W. Transcriptome Analysis Reveals That NEFA and β-Hydroxybutyrate Induce Oxidative Stress and Inflammatory Response in Bovine Mammary Epithelial Cells. Metabolites 2022, 12, 1060. [Google Scholar] [CrossRef] [PubMed]
- Sharma, N.; Singh, N.K.; Singh, O.P.; Pandey, V.; Verma, P.K. Oxidative Stress and Antioxidant Status during Transition Period in Dairy Cows. Asian-Australas. J. Anim. Sci. 2011, 24, 479–484. [Google Scholar] [CrossRef]
- Wagner, B.A.; Buettner, G.R.; Burns, C.P. Free radical-mediated lipid peroxidation in cells: Oxidizability is a function of cell lipid bis-allylic hydrogen content. Biochemistry 1994, 33, 4449–4453. [Google Scholar] [CrossRef]
- Trommer, S.; Leimert, A.; Bucher, M.; Schumann, J. Polyunsaturated Fatty Acids Induce ROS Synthesis in Microvascular Endothelial Cells. Adv. Exp. Med. Biol. 2018, 1072, 393–397. [Google Scholar] [CrossRef] [PubMed]
- Burns, C.; Welshman, I.; Spector, A. Differences in free fatty acid and glucose metabolism of human blood neutrophils and lymphocytes. Blood 1976, 47, 431–437. [Google Scholar] [CrossRef] [PubMed]
- Politis, I.; Hidiroglou, N.; White, J.H.; Gilmore, J.A.; Williams, S.N.; Scherf, H.; Frigg, M. Effects of vitamin E on mammary and blood leukocyte function, with emphasis on chemotaxis, in periparturient dairy cows. Am. J. Vet. Res. 1996, 57, 468–471. [Google Scholar] [CrossRef] [PubMed]
- Dang, A.K.; Prasad, S.; De, K.; Pal, S.; Mukherjee, J.; Sandeep, I.V.R.; Mutoni, G.; Pathan, M.M.; Jamwal, M.; Kapila, S.; et al. Effect of supplementation of vitamin E, copper and zinc on the in vitro phagocytic activity and lymphocyte proliferation index of peripartum Sahiwal (Bos indicus) cows. J. Anim. Physiol. Anim. Nutr. 2013, 97, 315–321. [Google Scholar] [CrossRef] [PubMed]
- Schäfers, S.; von Soosten, D.; Meyer, U.; Drong, C.; Frahm, J.; Tröscher, A.; Pelletier, W.; Sauerwein, H.; Dänicke, S. Influence of conjugated linoleic acids and vitamin E on biochemical, hematological, and immunological variables of dairy cows during the transition period. J. Dairy Sci. 2018, 101, 1585–1600. [Google Scholar] [CrossRef] [PubMed]
- Khatti, A.; Mehrotra, S.; Patel, P.K.; Singh, G.; Maurya, V.P.; Mahla, A.S.; Chaudhari, R.K.; Das, G.K.; Singh, M.; Sarkar, M.; et al. Supplementation of vitamin E, selenium and increased energy allowance mitigates the transition stress and improves postpartum reproductive performance in the crossbred cow. Theriogenology 2017, 104, 142–148. [Google Scholar] [CrossRef] [PubMed]
- Ndiweni, N.; Finch, J.M. Effects of in vitro supplementation of bovine mammary gland macrophages and peripheral blood lymphocytes with α-tocopherol and sodium selenite: Implications for udder defences. Vet. Immunol. Immunopathol. 1995, 47, 111–121. [Google Scholar] [CrossRef] [PubMed]
- Weiss, W.P.; Hogan, J.S.; Wyatt, D.J. Relative bioavailability of all-rac and RRR vitamin E based on neutrophil function and total α-tocopherol and isomer concentrations in periparturient dairy cows and their calves. J. Dairy Sci. 2009, 92, 720–731. [Google Scholar] [CrossRef] [PubMed]
- Palladini, G.; Di Pasqua, L.G.; Berardo, C.; Siciliano, V.; Richelmi, P.; Mannucci, B.; Croce, A.C.; Rizzo, V.; Perlini, S.; Vairetti, M.; et al. Fatty Acid Desaturase Involvement in Non-Alcoholic Fatty Liver Disease Rat Models: Oxidative Stress Versus Metalloproteinases. Nutrients 2019, 11, 799. [Google Scholar] [CrossRef] [PubMed]
- Grajchen, E.; Loix, M.; Baeten, P.; Côrte-Real, B.F.; Hamad, I.; Vanherle, S.; Haidar, M.; Dehairs, J.; Broos, J.Y.; Ntambi, J.M.; et al. Fatty acid desaturation by stearoyl-CoA desaturase-1 controls regulatory T cell differentiation and autoimmunity. Cell. Mol. Immunol. 2023, 20, 666–679. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Li, L.; Zhang, C.; Cheng, X.; Zhang, Y.; Guo, Y.; Long, M.; Yang, S.; He, J. Palmitic Acid and β-Hydroxybutyrate Induce Inflammatory Responses in Bovine Endometrial Cells by Activating Oxidative Stress-Mediated NF-κB Signaling. Molecules 2019, 24, 2421. [Google Scholar] [CrossRef] [PubMed]
- Bahramian, N.; Östergren-Lundén, G.; Bondjers, G.; Olsson, U. Fatty acids induce increased granulocyte macrophage-colony stimulating factor secretion through protein kinase C-activation in THP-1 macrophages. Lipids 2004, 39, 243–249. [Google Scholar] [CrossRef] [PubMed]
- O’Mahony, D.S.; Pham, U.; Iyer, R.; Hawn, T.R.; Liles, W.C. Differential constitutive and cytokine-modulated expression of human Toll-like receptors in primary neutrophils, monocytes, and macrophages. Int. J. Med. Sci. 2008, 5, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Sattler, M.; Winkler, T.; Verma, S.; Byrne, C.H.; Shrikhande, G.; Salgia, R.; Griffin, J.D. Hematopoietic Growth Factors Signal Through the Formation of Reactive Oxygen Species. Blood 1999, 93, 2928–2935. [Google Scholar] [CrossRef] [PubMed]
- Cárcamo, J.M.; Bórquez-Ojeda, O.; Golde, D.W. Vitamin C inhibits granulocyte macrophage–colony-stimulating factor–induced signaling pathways. Blood 2002, 99, 3205–3212. [Google Scholar] [CrossRef] [PubMed]
- Dirandeh, E.; Towhidi, A.; Ansari, Z.; Zeinoaldini, S.; Ganjkhanlou, M. Effects of Dietary Supplementation with Different Polyunsaturated Fatty Acids on Expression of Genes Related to Somatotropic Axis Function in the Liver, Selected Blood Indicators, Milk Yield and Milk Fatty Acids Profile in Dairy Cows. Ann. Anim. Sci. 2016, 16, 1045–1058. [Google Scholar] [CrossRef]
- Sontag, T.J.; Parker, R.S. Influence of major structural features of tocopherols and tocotrienols on their ω-oxidation by tocopherol-ω-hydroxylase. J. Lipid Res. 2007, 48, 1090–1098. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, M.J.; Sordillo, L.M. Vitamin E analogs limit in vitro oxidant damage to bovine mammary endothelial cells. J. Dairy Sci. 2021, 104, 7154–7167. [Google Scholar] [CrossRef] [PubMed]
- Gong, J.; Xiao, M. Effect of Organic Selenium Supplementation on Selenium Status, Oxidative Stress, and Antioxidant Status in Selenium-Adequate Dairy Cows During the Periparturient Period. Biol. Trace Elem. Res. 2018, 186, 430–440. [Google Scholar] [CrossRef] [PubMed]


| Gene Symbol | GenBank Accession Number | Forward Primer 5′-3′ | Product Size (bp) |
|---|---|---|---|
| Reverse Primer 3′-5′ | |||
| GAPDH | NM_001034034.2 | CAAGCTCATTTCCTGGTACGAC | 130 |
| AACTCTTCCTCTCGTGCTCC | |||
| IL-1β | NM_174093 | GACGAGTTTCTGTGTGACGC | 149 |
| ATGCAGAACACCACTTCTCGG | |||
| IL-6 | NM_173923.2 | TGAAAGCAGCAAGGAGACACT | 99 |
| CAAATCGCCTGATTGAACCCAG | |||
| IL-10 | NM_174088.1 | CTGTTGACCCAGTCTCTGCT | 216 |
| GCTCTTGTTTTCGCAGGGC | |||
| CSF-1 | NM_174026.1 | GCCCGTTTTAACTCCGTTCC | 180 |
| TGGCTCTTGATGGCTCCGAC | |||
| CSF-2 | NM_174027.2 | GGCCACCCACTACGAGAAAC | 160 |
| CTGGTTTGGCCTGCTTCACT | |||
| CSF-3 | NM_174028.1 | GCCTGAACCAACTACACGGC | 209 |
| GGCTGAAGTGAAGGTCGGCA |
| Oxidative Stress Indicator | Blank 1 | NEFA 2 | VENEFA 3 |
|---|---|---|---|
| PBMC | |||
| SOD (U/mL) | 2.43 ± 0.41 | 2.35 ± 0.44 | 2.79 ± 0.46 |
| TBARS (µM/107 cells) | 3.01 ± 0.25 a | 3.86 ± 0.34 b | 3.13 ± 0.24 a |
| PMN | |||
| SOD (U/mL) | 0.4 ± 0.09 | 0.46 ± 0.1 | 0.63 ± 0.13 |
| TBARS (µM/107 cells) | 3.04 ± 0.3 | 3.35 ± 0.33 | 3.37 ± 0.43 |
| PBMC | PMN | |||||
|---|---|---|---|---|---|---|
| Blank 1 | NEFA 2 | VENEFA 3 | Blank 1 | NEFA 2 | VENEFA 3 | |
| IL1β | 1 ± 0.02 A | 1.7 ± 0.08 C | 1.35 ± 0.17 B | 1 ± 0.03 | 1.49 ± 0.31 | 1.35 ± 0.27 |
| IL6 | 1 ± 0.03 a | 0.86 ± 0.06 ab | 0.82 ± 0.11 b | 1 ± 0.03 | 0.99 ± 0.25 | 1.01 ± 0.34 |
| IL10 | 1 ± 0.03 a | 1.37 ± 0.21 b | 1.02 ± 0.13 a | 1 ± 0.02 | 2.08 ± 0.96 | 2.24 ± 1.28 |
| CSF1 | 1 ± 0.03 | 1.37 ± 0.29 | 1.09 ± 0.25 | 1 ± 0.03 A | 0.88 ± 0.18 AB | 0.61 ± 0.09 B |
| CSF2 | 1 ± 0.06 | 1.55 ± 0.4 | 1.13 ± 0.23 | 1 ± 0.06 A | 1.82 ± 0.28 B | 1.42 ± 0.26 AB |
| CSF3 | 1 ± 0.02 a | 4.72 ± 1.78 b | 3.07 ± 1.33 ab | 1 ± 0.03 | 1.76 ± 0.59 | 1.16 ± 0.41 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.-Y.; Lin, W.-C.; Moonmanee, T.; Chan, J.P.-W.; Wang, C.-K. The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes. Animals 2024, 14, 1079. https://doi.org/10.3390/ani14071079
Li C-Y, Lin W-C, Moonmanee T, Chan JP-W, Wang C-K. The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes. Animals. 2024; 14(7):1079. https://doi.org/10.3390/ani14071079
Chicago/Turabian StyleLi, Cheng-Yan, Wei-Chen Lin, Tossapol Moonmanee, Jacky Peng-Wen Chan, and Chien-Kai Wang. 2024. "The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes" Animals 14, no. 7: 1079. https://doi.org/10.3390/ani14071079
APA StyleLi, C.-Y., Lin, W.-C., Moonmanee, T., Chan, J. P.-W., & Wang, C.-K. (2024). The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes. Animals, 14(7), 1079. https://doi.org/10.3390/ani14071079

