Next Article in Journal
The Protective Role of Vitamin E against Oxidative Stress and Immunosuppression Induced by Non-Esterified Fatty Acids in Bovine Peripheral Blood Leukocytes
Previous Article in Journal
Evaluation of Alacepril Administration in Canine Patent Ductus Arteriosus According to Plasma Chymase Activity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Leishmania Infection in Wild Lagomorphs and Domestic Dogs in North-East Spain

by
Oscar Cabezón
1,2,
Pamela Martínez-Orellana
3,
Maria Puig Ribas
1,
Catarina Jota Baptista
4,
Diana Gassó
5,
Roser Velarde
6,
Xavier Fernández Aguilar
1 and
Laia Solano-Gallego
3,*
1
Wildlife Conservation Medicine Research Group (WildCoM), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Catalonia, Spain
2
Unitat Mixta d’Investigació IRTA-UAB, Centre de Recerca en Sanitat Animal (CReSA), Campus de la Universitat Autònoma de Barcelona (UAB), 08193 Bellaterra, Catalonia, Spain
3
Infectious and Inflammatory Diseases in Companion Animals Research Group (MIAC), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Catalonia, Spain
4
Egas Moniz Center for Interdisciplinary Research (CiiEM), Egas Moniz School of Health & Science, 2829-511 Almada, Portugal
5
Departament de Ciència Animal, Escola Tècnica Superior d’Enginyeria Agroalimentaria i Forestal i de Veterinària (ETSEAFIV), Universitat de Lleida (UdL), 25199 Lleida, Catalonia, Spain
6
Wildlife Ecology and Health Group (WE&H), and Servei d’ Ecopatologia de Fauna Salvatge (SEFaS), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Catalonia, Spain
*
Author to whom correspondence should be addressed.
Animals 2024, 14(7), 1080; https://doi.org/10.3390/ani14071080
Submission received: 8 March 2024 / Revised: 29 March 2024 / Accepted: 1 April 2024 / Published: 2 April 2024
(This article belongs to the Section Wildlife)

Abstract

:

Simple Summary

Leishmania infantum is a zoonotic protozoan parasite transmitted by phlebotomine sandflies. Dogs are the main reservoir for human infections. In recent years, outbreaks of human leishmaniasis have been reported in different regions of Spain associated with the Iberian hare and European rabbit. However, there is a notable scarcity of information regarding L. infantum infection in the European hare and in Northeastern Spain where this species occurs. The present study aimed to assess Leishmania spp. exposure and infection in lagomorphs and sympatric domestic dogs in NE Spain. Results suggest a more important role for the European rabbit than the European hare in the epidemiology of this parasite in NE Spain. Given the strong correlation between lagomorph densities and human leishmaniasis outbreaks in Spain, the high rabbit and human densities in NE Spain, and the high Leishmania spp. seroprevalence in rabbits, it becomes relevant to establish surveillance programs for lagomorphs in this region.

Abstract

Leishmania infantum is a zoonotic protozoan parasite distributed worldwide that is transmitted by phlebotomine sandflies. Dogs are the main reservoir for human infections. However, in recent years, the capacity of lagomorphs to contribute to Leishmania transmission has been confirmed. The present study aimed to assess Leishmania spp. exposure and infection in lagomorphs and sympatric domestic dogs in NE Spain. Sera from European hares, European rabbits, and rural dogs were tested for antibodies against L. infantum using an in-house indirect ELISA. PCR analysis targeting Leishmania spp. was performed in spleens from L. europaeus. Antibodies against Leishmania spp. were detected in all the species analyzed. Total sample prevalence was significantly higher in O. cuniculus (27.9%) than in L. europaeus (2.0%). Results of the PCR were all negative. The present study expands knowledge about Leishmania infections in free-ranging lagomorphs in the Iberian Peninsula, suggesting a more important role of O. cuniculus in the study area. Given the strong correlation between lagomorph densities and human leishmaniasis outbreaks in Spain, the high rabbit and human densities in NE Spain, and the high Leishmania spp. seroprevalence in rabbits, it becomes imperative to establish surveillance programs for lagomorphs in this region.

1. Introduction

Leishmania infantum (Kinetoplastida: Trypanosomatidae; Nicolle, 1908) is a zoonotic protozoan parasite distributed worldwide that is transmitted by phlebotomine sandflies [1]. In Mediterranean countries, leishmaniasis is reported yearly with a clinical disease ratio of 0.02–0.49/100,000 in people [2,3]. Several different species of Leishmania have been described that cause disease in animals and humans in the Mediterranean area: L. infantum is the most frequent and it is considered endemic in the whole area; L. donovani, Laveran and Mesnil, 1903, occurs in Cyprus; L. major, Yakimoff and Schokhor, 1914, occurs in North Africa and the Middle East; and L. tropica, Wright, 1903, occurs in Greece, Turkey, the Middle East, and North Africa [4]. Dogs are the main reservoir of L. infantum for human infections, with a prevalence of infection in this species ranging between 5% and 50% in Spain [5,6]. However, L. infantum has also been detected in different wildlife species, such as rodents, carnivores, and lagomorphs in Europe [7]. Recently, there has been documented evidence of sylvatic cycles, shedding light on the increasing importance of wildlife reservoirs of L. infantum in the Mediterranean basin [7,8]. The expansion of urbanised areas into natural habitats, and the increase of urban wildlife in green zones and parks in populated areas may be also promoting the abundance of Phlebotomus sandflies and leishmaniasis [9,10].
The capacity of lagomorphs to contribute to Leishmania transmission has been confirmed by xenodiagnoses. Among the four lagomorph species naturally occurring in Spain, the European hare (Lepus europaeus; Pallas, 1778), the Broom hare (Lepus castroviejoi; Palacios, 1976) the Iberian hare (L. granatensis; Rosenhauer, 1856), and the European rabbit (O. cuniculus; Linnaeus, 1758), the transmission of L. infantum back to sandflies has been confirmed in the latter two [10,11,12]. In addition, outbreaks of human leishmaniasis have been reported in different regions of Spain associated with lagomorphs. Between 2009 and 2012, a total of 449 visceral and cutaneous leishmaniasis human cases, representing a ratio of 56 cases of leishmaniasis per 100,000 human beings, were recorded in Central Spain [11]. In this outbreak, a sylvatic cycle maintained by lagomorphs was confirmed as the main source of the human cases, which were mostly associated with visits to an urban park. In that park, L. granatensis were at high densities and were considered the primary reservoir species of L. infantum, potentially with the added contribution of O. cuniculus [11,13]. Similarly, in Granada province in South Spain, an increase in the incidence of human leishmaniasis between 2008 (0 cases) and 2016 (11.3 per 100,000 inhabitants) was associated with the overlapping of domestic and sylvatic cycles, and O. cuniculus was considered the main reservoir species [14].
Some authors have pointed out the usefulness of determining the prevalence of infection and parasite burden in lagomorphs to control and reduce leishmaniasis risk to people [14]. Considering the significance of lagomorphs in the spread of L. infantum in Spain, numerous epidemiological studies have focused on these species, demonstrating high exposure and infection prevalence [14,15,16,17,18]. Nevertheless, there is a notable scarcity of information regarding L. infantum infection in the European hare and in Northeastern Spain where this species occurs.
The Iberian Peninsula is one of the most biodiverse areas in Europe, with highly diverse ecoregions. NE Spain (Western Mediterranean basin) is characterized by hot and dry summers and relatively temperate and humid-to-sub-humid winters. The annual average temperature ranges from 10 to 17 °C, and the minimum average temperature of the coldest month ranges from 5 to 10 °C. The annual precipitation ranges from 350 to 800 mm, typified by torrential rainfall in autumn [19]. In this ecoregion, L. infantum is found endemic in domestic dogs [20].
The present study aimed to assess L. infantum exposure and infection in European hares from Northeastern Spain. We also analyzed samples from sympatric rabbits and domestic rural dogs, which are the two other competent hosts known to have significant contributions to L. infantum epidemiology in NE Spain [15,20].

2. Materials and Methods

2.1. Animals and Samples

Blood (n = 147) and spleen (n = 20) samples were obtained from 158 hunted L. europaeus from three different provinces within NE Spain: Girona (n = 122), Lleida (n = 14), and Barcelona (n = 11) (Figure 1). All hares were sampled from October to March between 2012 and 2017 during the hunting season. There were 66 females and 60 males, and 32 had unknown gender. Also, blood samples from 111 O. cuniculus were collected between 2014 and 2017 in Lleida (n = 54), Tarragona (n = 13), Girona (n = 3), and Barcelona (n = 37), and four more were sampled without a known location within the study area. Rabbits were sampled during the regular hunting season (October to February) and included 46 females, 31 males, and 34 rabbits with unknown gender. Finally, sera were obtained from 226 rural dogs (Canis familiaris) from Girona (n = 115), Lleida (n = 39), Barcelona (n = 7), and Tarragona (n = 65) between 2012 and 2016. In all cases, the dogs were housed in outdoor facilities and were mostly used for hunting activities, livestock rearing, or as guard dogs.

2.2. Serological and Molecular Analyses

All sera from L. europaeus, O. cuniculus, and dogs were tested for antibodies against L. infantum using an in-house indirect ELISA previously described [19]. This technique was modified for sera samples of Lagomorpha species. Sera were diluted to 1:400 in hare and rabbit samples and to 1:800 in dog samples, and incubated in sonicated crude L. infantum antigen-coated plates (20 μg/mL) for 1 h at 37 °C. The plates were washed with 0.05% Tween 20 in phosphate-buffered saline (PBS) and incubated with Protein A conjugated to horseradish peroxidase (1:30,000 dilution; Sigma-Aldrich, Madrid, Spain) for 1 h at 37 °C. Plates were rewashed with 0.05% PBS–Tween 20. Subsequently, substrate solution ortho-phenylenediamine (OPD) and stable peroxide substrate buffer (Sigma-Aldrich, Madrid, Spain) were added. The reaction was stopped with 50 μL of 2.5 M H2SO4. Absorbance values were read at 492 nm in an automatic micro-ELISA reader (ELISA Reader Anthos 2020, Biochrom, Cambridge, UK). All plates included the serum from two infected animals with a confirmed infection (hare controls in lagomorph assays and dog controls in dog assays), one of which was the positive control (calibrator), and serum from a non-infected hare, non-infected rabbit, and non-infected dog were used as negative controls. All samples were analysed in duplicate. Results were quantified as ELISA units (EU) in relation to the controls that were used as calibrators, and arbitrarily set at 100 EU in dogs, and lagomorphs were set at 170 EU.
The cut-offs were established by different methods between the two lagomorph species. For L. europaeus, the cut-off was established at 2.43 EU for negative samples and at 4.14 EU for positive samples (calculated as the mean + 2 SD and mean + 4 SD, from values of 29 hares from non-endemic areas). For O. cuniculus, the cut-off was established at 2.0 EU for negative samples and at 2.8 EU for positive samples (calculated as the mean + 4 SD and mean + 6 SD, respectively, from values of 15 O. cuniculus SPF (some pathogens free)). Sera from hares were classified as positive when ≥4.14 EU, doubtful when ≥2.43 EU and <4.14 EU, and negative with EU < 2.43 EU. Sera from O. cuniculus were classified as positive when ≥2.8 EU, doubtful when ≥2.0 EU and <2.8 EU, and negative when <2.0 EU. The cut-off for dog samples was established at 35 EU (mean + 4 SD from values of 80 dogs from non-endemic areas, United Kingdom).
PCR analysis targeting Leishmania spp. was performed in 20 spleen samples from European hares. DNA was extracted from spleen homogenates using the commercial kit BioSprint 96 DNA Blood Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s procedure, and the extraction robot Biosprint 96 (QIAGEN, Hilden, Germany). Extracted DNA was amplified using real-time-PCR with the primers Leish-1 (3′ AACTTTTCTCGTCCTCCGGGTAG 5′) and Leish-2 (3′ ACCCCCAGTTTCCCGCC 5′) [21], the probe (3′ FAM-AAAAATGGGTGCAGAAAT-MGB 5′), and a commercial kit (TaqMan PCR Master Mix; Applied Biosystems, Carlsbad, CA, USA).

2.3. Review of Leishmania Infection in Wild Lagomorphs in Spain

A review of Leishmania spp. infection in wild lagomorphs (O. cuniculus, L. europaeus, L. castroviejoi, and L. granatensis) in Spain was performed using a systematic search and compilation methodology of available peer-reviewed literature. We searched Web of Science: All Databases (WoS; Thomson Reuters, Toronto, ON, Canada) literature database using “topic” searcher. We used the words “(Leishmania AND lagomorph AND Spain)”, and then we selected epidemiological studies on L. infantum infection in wild lagomorphs in Spain.

2.4. Statistical Analysis

Differences in antibody prevalence between species, geographic locations (provinces within NE Spain), and sex of the animals were tested with a Pearson’s chi-squared test or Fisher’s exact test when one or more cells in the contingency table had less than five cases. All analyses were performed using R software, version 4.1.0, and the 95% interval confidence of apparent prevalence was calculated with the “EpiR” package 2.0.61 [22]. The significance level was set at 0.05 in all tests.

3. Results

3.1. Serological and Molecular Analyses

Antibodies against L. infantum antigen were detected in all the species analyzed and in all provinces in at least one of the species. Remarkably, positive cases of L. europaeus were only detected in Girona province, which is the region with a lower sample prevalence in O. cuniculus and dogs (Table 1). The results of the serology, considering the different species and geographical locations, are summarized in Table 1.
The differences in sample prevalence between species were statistically significant (Fisher’s exact test p-value < 0.001). Among lagomorphs, total sample prevalence was also significantly higher in O. cuniculus than in L. europaeus (Fisher’s exact test p-value < 0.001; OR 18.5; 95% CI: 6.3–82.2). There were no statistical differences between males and females for all three species. Regarding geographical locations (provinces within NE Spain), sample prevalence was higher in Tarragona for C. familiaris (Fisher’s exact test p-value = 0.002; OR 1.8; 95% CI: 0.3–48.0) but not for L. europaeus or O. cuniculus, in which sample prevalence did not significantly vary between provinces.
Results of the PCR analysis for the detection of L. infantum in L. europaeus spleens were all negative (0.0%; 95% CI: 0.0–16.1).

3.2. Leishmania infantum in Lagomorphs in Spain

A literature review found nine original research articles reporting epidemiological studies of L. infantum infection in lagomorphs in Spain. A summary of the studies is presented in Table 2. The most studied lagomorph species studied were L. granatensis and O. cuniculus. Only one study included samples of L. europaeus, with a few individuals analyzed (n = 14).

4. Discussion

The sample prevalence of antibodies against L. infantum found in the present study confirms exposure in all the species sampled, further indicating the endemic status of Leishmania in NE Spain and the Mediterranean basin. Oryctolagus cuniculus had a significantly higher sample prevalence as compared to L. europaeus and domestic dogs, suggesting a more important role of this species in the epidemiology of the parasite in the study area. This is in accordance with previous studies reporting high exposure and infections of Leishmania in lagomorphs in Spain (Table 2).
These previous studies found a high variability of Leishmania infection in lagomorphs, and several factors have been proposed to drive these differences (e.g., host distribution, host density, vector density, and host susceptibility). In our area of study, the geographic distributions of species sampled (i.e., L. europaeus, O. cuniculus, and domestic dog) overlap [26,27], and the presence of sandflies and the parasite are known to occur throughout the ecoregion. However, the overall density of wild rabbits (29–300 individuals/km2) is higher than the density of L. europaeus (1.29–13 individuals/km2) and domestic dogs [26,27]. Also, the ecology of O. cuniculus favors higher aggregations of individuals and the attraction of sandflies [10,28,29]. These high densities, together with the feeding preference of sandflies for lagomorphs [13,30,31], may increase the prevalence of Leishmania infection in O. cuniculus. Nonetheless, our study provides a snapshot overview of L. infantum epidemiology in North-East Spain, and dynamics of infection may vary locally or temporally depending on hosts and vector abundance.
Leishmania spp. are also widespread in other areas of the Mediterranean basin. However, Leishmania infection is underreported in lagomorphs in this area, and no studies on the potential role of lagomorphs in the epidemiology of human and animal leishmaniasis are available [4]. The few studies performed on Leishmania spp. infection in wild lagomorphs in other geographic areas from the Mediterranean basin point to a wide heterogeneity of epidemiological scenarios, including the circulation of different species of the parasite [32].
In the Mediterranean basin, Leishmania spp. infection has been reported in wild lagomorphs contrasting a wide range of results on both exposure and molecular detection of the parasite. In Tuscany, Central Italy, 9.8% (n = 51) of L. europaeus sampled were positive in PCR analyses [33]. Also, in Central Italy, in the province of Pisa, Ebani et al. [34] found that 0.9% (n = 222) of L. europaeus had antibodies against Leishmania spp. by IFAT. In North-East Italy, Taddei et al. [35] recorded that 15.4% (n = 39) of free-ranging European hares were positive for Leishmania DNA by PCR. In Northern Italy, Zanet et al. [36] found Leishmania DNA in 30% (CI95% 10.78–60.32%; n = 10) of O. cuniculus analyzed, in 26.92% (CI95% 19.33–36.16%; n = 104) of exotic invasive Eastern cottontails (Sylvilagus floridanus), and in 18.52% (CI95% 12.32–26.88%; n = 108) of L. europaeus.
Abbate et al. [37] reported a positivity of 4.2% (n = 71) by qPCR in wild rabbits of Sicily, Southern Italy. In Greece, different prevalence of Leishmania infections have been documented in European hares [32]. In Northern Greece, a sample prevalence of 23.49% (n = 166) was found by PCR [38]. Also, Tsokana et al. [39] studied hares from Northern and Central Greece, detecting antibodies in 12.4% (n = 105) and Leishmania DNA in 9.6% (n = 52) of the hares. In the same geographic area, Tsakmakidis et al. [40] found a similar prevalence of antibodies (6.7%; n = 90) and Leishmania DNA (3.6%; n = 56) in hares. Furthermore, Leishmania spp. infection has been studied in O. cuniculus from Greece showing similar exposure to that reported in hares from the same country. Tsakmakidis et al. [40] observed a seroprevalence of antibodies of 7.6% (n = 393), and Leishmania DNA was detected in 2.6% (n = 113) of the rabbits from Northern Greece.
The different Leishmania species circulating in the Eastern Mediterranean basin, the heterogeneity of Leishmania infection rates in lagomorphs, and the few studies on the role of these species in the epidemiology of Leishmania spp. in the Mediterranean basin reinforce the need for further research in lagomorphs.
Wildlife species are important for the epidemiology and transmission of zoonotic diseases and sometimes can represent a reservoir of disease to people [41]. However, the diversity of pathogens that naturally circulate in wild populations, and the characteristics of the host populations that favour the emergence of the zoonoses are far from being understood [9,41]. Several studies have investigated how synanthropic animals may increase the risk of spill-over of zoonotic diseases from wildlife reservoirs to people [42,43]. In Spain, human leishmaniasis outbreaks have been related to high densities of the two proven L. infantum wildlife reservoirs, L. granatensis and O. cuniculus, when they were in proximity to densely human-populated areas [8,9,10,11]. Currently, NE Spain is home to more than 7.5 M human beings, representing 16.4% of the population of Spain [44]. Also, the populations of O. cuniculus in recent years in NE Spain have been increasing and are requiring management measures to control their populations [45]. Although no outbreaks of human leishmaniasis have been noticed in NE Spain to date, sporadic cases may have been underreported [4]. Given the identified strong correlation between lagomorph densities and human leishmaniasis outbreaks in Spain, the high rabbit and human densities in NE Spain, and the high L. infantum seroprevalence in rabbits, it becomes imperative to establish robust surveillance programs for lagomorphs in this ecoregion. Furthermore, the dynamics of Leishmania in lagomorph species is not well understood and, therefore, longitudinal studies are necessary.

5. Conclusions

The present study expands the knowledge about Leishmania infections in free-ranging lagomorphs in the Iberian Peninsula and reinforces the hypothesis of the important role of O. cuniculus in the epidemiology of the parasite in North-East Spain. In contrast, the European hare does not seem to play an important role in the overall epidemiology of Leishmania spp. in this region.

Author Contributions

Conceptualization, O.C. and L.S.-G.; methodology, P.M.-O., C.J.B. and M.P.R.; validation, O.C. and L.S.-G.; formal analysis, P.M.-O., C.J.B., M.P.R. and X.F.A.; investigation, O.C. and L.S.-G.; resources, R.V., D.G. and L.S.-G.; data curation, O.C. and L.S.-G.; writing—original draft preparation, O.C. and L.S.-G.; writing—review and editing, O.C., R.V., P.M.-O., C.J.B., D.G., M.P.R., X.F.A. and L.S.-G.; supervision, O.C. and L.S.-G. All authors have read and agreed to the published version of the manuscript.

Funding

X. F. Aguilar was funded through the Maria Zambrano post-doctoral program (ID-709248). M. P. Ribas was funded through the 2021 FI Scholarship, Departament de Recerca i Universitats, Generalitat de Catalunya, Spain (FI_B 00171).

Institutional Review Board Statement

Ethical review and approval were waived for this study due to the samples from Lagomorpha species being collected from legally hunted animals.

Informed Consent Statement

Informed consent was obtained from all the owners of sampled dogs involved in the study.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

The authors are very grateful for the laboratory contribution of Nuria Pujol and Joan Pujol from IRTA-CReSA. The antibody-negative sera from hares were kindly provided by Dolores Gavier-Widen from the Swedish Veterinary Agency (SVA).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. World Organization for Animal Health—WOAH. Terrestrial Manual 2021, Chapter 3.01.11: Leishmaniosis. Available online: https://www.woah.org/en/disease/leishmaniosis (accessed on 17 January 2024).
  2. Alvar, J.; Vélez, I.D.; Bern, C.; Herrero, M.; Desjeux, P.; Cano, J.; Jannin, J.; den Boer, M. Leishmaniasis worldwide and global estimates of its incidence. WHO Leishmaniasis Control Team. PLoS ONE 2012, 7, e35671. [Google Scholar] [CrossRef] [PubMed]
  3. Antoniou, M.; Gramiccia, M.; Molina, R.; Dvorak, V.; Volf, P. The role of indigenous phlebotomine sandflies and mammals in the spreading of leishmaniasis agents in the Mediterranean region. Eurosurveillance 2013, 18, 20540. [Google Scholar] [CrossRef] [PubMed]
  4. ECDC—European Centre for Disease Prevention and Control. 2022. Surveillance, Prevention and Control of Leishmaniases in the European Union and Its Neighbouring Countries. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/leishmaniasis-surveillance-eu.pdf (accessed on 16 January 2024).
  5. Solano-Gallego, L.; Koutinas, A.; Miró, G.; Cardoso, L.; Pennisi, M.G.; Ferrer, L.; Bourdeau, P.; Oliva, G.; Baneth, G. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Vet. Parasitol. 2009, 165, 1–18. [Google Scholar] [CrossRef] [PubMed]
  6. Gálvez, R.; Montoya, A.; Cruz, I.; Fernández, C.; Martín, O.; Checa, R.; Chicharro, C.; Migueláñez, S.; Marino, V.; Miró, G. Latest trends in Leishmania infantum infection in dogs in Spain, Part I: Mapped seroprevalence and sand fly distributions. Parasit. Vectors 2020, 13, 204. [Google Scholar] [CrossRef] [PubMed]
  7. Millán, J.; Ferroglio, E.; Solano-Gallego, L. Role of wildlife in the epidemiology of Leishmania infantum infection in Europe. Parasitol. Res. 2014, 113, 2005–2014. [Google Scholar] [CrossRef] [PubMed]
  8. Azami-Conesa, I.; Gómez-Muñoz, M.T.; Martínez-Díaz, R.A. A Systematic Review (1990–2021) of Wild Animals Infected with Zoonotic Leishmania . Microorganisms 2021, 9, 1101. [Google Scholar] [CrossRef]
  9. Tomassone, L.; Berriatua, E.; De Sousa, R.; Duscher, G.G.; Mihalca, A.D.; Silaghi, C.; Sprong, H.; Zintl, A. Neglected vector-borne zoonoses in Europe: Into the wild. Vet. Parasitol. 2018, 251, 17–26. [Google Scholar] [CrossRef]
  10. Jiménez, M.; González, E.; Martín-Martín, I.; Hernández, S.; Molina, R. Could wild rabbits (Oryctolagus cuniculus) be reservoirs for Leishmania infantum in the focus of Madrid, Spain? Vet. Parasitol. 2014, 202, 296–300. [Google Scholar] [CrossRef]
  11. Molina, R.; Jiménez, M.I.; Cruz, I.; Iriso, A.; Martín-Martín, I.; Sevillano, O.; Melero, S.; Bernal, J. The hare (Lepus granatensis) as potential sylvatic reservoir of Leishmania infantum in Spain. Vet. Parasitol. 2012, 190, 268–271. [Google Scholar] [CrossRef]
  12. Moreno, I.; Álvarez, J.; García, N.; de la Fuente, S.; Martínez, I.; Marino, E.; Toraño, A.; Goyache, J.; Vilas, F.; Domínguez, L.; et al. Detection of anti-Leishmania infantum antibodies in sylvatic lagomorphs from an epidemic area of Madrid using the indirect immunofluorescence antibody test. Vet. Parasitol. 2014, 199, 264–267. [Google Scholar] [CrossRef]
  13. Jiménez, M.; González, E.; Iriso, A.; Marco, E.; Alegret, A.; Fúster, F.; Molina, R. Detection of Leishmania infantum and identification of blood meals in Phlebotomus perniciosus from a focus of human leishmaniasis in Madrid, Spain. Parasitol. Res. 2013, 112, 2453–2459. [Google Scholar] [CrossRef] [PubMed]
  14. Martín-Sánchez, J.; Torres-Medina, N.; Morillas-Márquez, F.; Corpas-López, V.; Díaz-Sáez, V. Role of wild rabbits as reservoirs of leishmaniasis in a non-epidemic Mediterranean hot spot in Spain. Acta Trop. 2021, 222, 106036. [Google Scholar] [CrossRef] [PubMed]
  15. Chitimia, L.; Muñoz-García, C.I.; Sánchez-Velasco, D.; Lizana, V.; Del Río, L.; Murcia, L.; Fisa, R.; Riera, C.; Giménez-Font, P.; Jiménez-Montalbán, P.; et al. Cryptic Leishmaniosis by Leishmania infantum, a feature of canines only? A study of natural infection in wild rabbits, humans and dogs in southeastern Spain. Vet. Parasitol. 2011, 181, 12–16. [Google Scholar] [CrossRef] [PubMed]
  16. Ruiz-Fons, F.; Ferroglio, E.; Gortázar, C. Leishmania infantum in free-ranging hares, Spain, 2004–2010. Eurosurveillance 2013, 18, 20541. [Google Scholar] [CrossRef] [PubMed]
  17. Risueño, J.; Ortuño, M.; Pérez-Cutillas, P.; Goyena, E.; Maia, C.; Cortes, S.; Campino, L.; Bernal, L.J.; Muñoz, C.; Arcenillas, I.; et al. Epidemiological and genetic studies suggest a common Leishmania infantum transmission cycle in wildlife, dogs and humans associated to vector abundance in Southeast Spain. Vet. Parasitol. 2018, 259, 61–67. [Google Scholar] [CrossRef]
  18. Díaz-Sáez, V.; Merino-Espinosa, G.; Morales-Yuste, M.; Corpas-López, V.; Pratlong, F.; Morillas-Márquez, F.; Martín-Sánchez, J. High rates of Leishmania infantum and Trypanosoma nabiasi infection in wild rabbits (Oryctolagus cuniculus) in sympatric and syntrophic conditions in an endemic canine leishmaniasis area: Epidemiological consequences. Vet. Parasitol. 2014, 202, 119–127. [Google Scholar] [CrossRef]
  19. Olson, D.M.; Dinerstein, E.; Wikramanayake, E.D.; Burgess, N.D.; Powell, G.V.N.; Underwood, E.C.; D'Amico, J.A.; Itoua, I.; Strand, H.E.; Morrison, J.C. Terrestrial Ecoregions of the World: A New Map of Life on Earth. BioScience 2001, 11, 933–938. [Google Scholar] [CrossRef]
  20. Solano-Gallego, L.; Villanueva-Saz, S.; Carbonell, M.; Trotta, M.; Furlanello, T.; Natale, A. Serological diagnosis of canine leishmaniosis: Comparison of three commercial ELISA tests (Leiscan, ID Screen and Leishmania 96), a rapid test (Speed Leish K) and an in-house IFAT. Parasit. Vectors 2014, 7, 111. [Google Scholar] [CrossRef] [PubMed]
  21. Francino, O.; Altet, L.; Sánchez-Robert, E.; Rodriguez, A.; Solano-Gallego, L.; Alberola, J.; Ferrer, L.; Sánchez, A.; Roura, X. Advantages of real-time PCR assay for diagnosis and monitoring of canine leishmaniosis. Vet. Parasitol. 2006, 137, 214–221. [Google Scholar] [CrossRef]
  22. R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing. 2017. Available online: http://www.R-project.org (accessed on 10 January 2024).
  23. De la Cruz, M.L.; Pérez, A.; Domínguez, M.; Moreno, I.; García, N.; Martínez, I.; Navarro, A.; Domínguez, L.; Álvarez, J. Assessment of the sensitivity and specificity of serological (IFAT) and molecular (direct-PCR) techniques for diagnosis of leishmaniasis in lagomorphs using a Bayesian approach. Vet. Med. Sci. 2016, 2, 211–220. [Google Scholar] [CrossRef]
  24. García, N.; Moreno, I.; Alvarez, J.; de la Cruz, M.L.; Navarro, A.; Pérez-Sancho, M.; García-Seco, T.; Rodríguez-Bertos, T.; Conty, M.L.; Toraño, A.; et al. Evidence of Leishmania infantum infection in rabbits (Oryctolagus cuniculus) in a natural area in Madrid, Spain. Biomed. Res. Int. 2014, 2014, 318254. [Google Scholar] [CrossRef] [PubMed]
  25. Ortega-García, M.V.; Salguero, F.J.; Rodríguez-Bertos, A.; Moreno, I.; García, N.; García-Seco, T.; Luz Torre, G.; Domínguez, L.; Domínguez, M. A pathological study of Leishmania infantum natural infection in European rabbits (Oryctolagus cuniculus) and Iberian hares (Lepus granatensis). Transbound. Emerg. Dis. 2019, 66, 2474–2481. [Google Scholar] [CrossRef] [PubMed]
  26. Ruiz-Olmo, J.; Such-Sanz, A.R.; Lavín, S.; Camps, D. Lepus europaeus. Grans Mamífers de Catalunya i Andorra. Distribució, Biologia, Ecologia I Convervació, 1st ed.; Lynx Nature Books: Barcelona, Spain, 2023; pp. 54–59. [Google Scholar]
  27. Such-Sanz, A.; Cases FVelarde, R.; Lavín, S. Oryctolagus cuniculus. Grans Mamífers de Catalunya i Andorra. Distribució, Biologia, Ecologia I Convervació, 1st ed.; Lynx Nature Books: Barcelona, Spain, 2023; pp. 46–53. [Google Scholar]
  28. Benito-De Martin, M.I.; Gracia-Salinas, M.J.; Molina-Moreno, R.; Ferrer-Dufol, M.; Lucientes-Curdi, J. Influence of the nature of the ingested blood on the gonotrophic parameters of Phlebotomus perniciosus under laboratory conditions. Parasite 1994, 1, 409–411. [Google Scholar] [CrossRef] [PubMed]
  29. Martín-Martín, I.; Jiménez, M.; González, E.; Eguiluz, C.; Molina, R. Natural transmission of Leishmania infantum through experimentally infected Phlebotomus perniciosus highlights the virulence of Leishmania parasites circulating in the human visceral leishmaniasis outbreak in Madrid, Spain. Vet. Res. 2015, 46, 138. [Google Scholar] [CrossRef] [PubMed]
  30. González, E.; Jiménez, M.; Hernández, S.; Martín-Martín, I.; Molina, R. Phlebotomine sand fly survey in the focus of leishmaniasis in Madrid, Spain (2012–2014): Seasonal dynamics, Leishmania infantum infection rates and blood meal preferences. Parasit. Vectors 2017, 10, 368. [Google Scholar] [CrossRef] [PubMed]
  31. González, E.; Molina, R.; Iriso, A.; Ruiz, S.; Aldea, I.; Tello, A.; Fernández, D.; Jiménez, M. Opportunistic feeding behaviour and Leishmania infantum detection in Phlebotomus perniciosus females collected in the human leishmaniasis focus of Madrid, Spain (2012-2018). PLoS Negl. Trop. Dis. 2021, 15, e0009240. [Google Scholar] [CrossRef] [PubMed]
  32. Cardoso, L.; Schallig, H.; Persichetti, M.F.; Pennisi, M.G. New Epidemiological Aspects of Animal Leishmaniosis in Europe: The Role of Vertebrate Hosts Other Than Dogs. Pathogens 2021, 10, 307. [Google Scholar] [CrossRef]
  33. Rocchigiani, G.; Ebani, V.V.; Nardoni, S.; Bertelloni, F.; Bascherini, A.; Leoni, A.; Mancianti, F.; Poli, A. Molecular survey on the occurrence of arthropod-borne pathogens in wild brown hares (Lepus europaeus) from Central Italy. Infect. Genet. Evol. 2018, 59, 142–147. [Google Scholar] [CrossRef] [PubMed]
  34. Ebani, V.V.; Poli, A.; Rocchigiani, G.; Bertelloni, F.; Nardoni, S.; Papini, R.A.; Mancianti, F. Serological survey on some pathogens in wild brown hares (Lepus europaeus) in Central Italy. Asian Pac. J. Trop. Med. 2016, 9, 465–469. [Google Scholar] [CrossRef]
  35. Taddei, R.; Bregoli, A.; Galletti, G.; Carra, E.; Fiorentini, L.; Fontana, M.C.; Frasnelli, M.; Musto, C.; Pupillo, G.; Reggiani, A.; et al. Wildlife Hosts of Leishmania infantum in a Re-Emerging Focus of Human Leishmaniasis, in Emilia-Romagna, Northeast Italy. Pathogens 2022, 11, 1308. [Google Scholar] [CrossRef]
  36. Zanet, S.; Chiari, M.; Battisti, E.; Tizzani, P.; Trisciuoglio, A.; Taricco, L.; Lavazza, A.; Ferroglio, E. Leishmania infantum in wild lagomorphs: An epidemiological survey in Italy. In Proceedings of the Contributions to the 12th Conference of the European Wildlife Disease Association (EWDA), Berlin, Germany, 27–31 August 2016; Schumann, A., Wibbelt, G., Greenwood, A.D., Hofer, H., Eds.; Leibniz Institute for Zoo and Wildlife Research: Berlin, Germany, 2016; p. 213. [Google Scholar]
  37. Abbate, J.M.; Arfuso, F.; Napoli, E.; Gaglio, G.; Giannetto, S.; Latrofa, M.S.; Otranto, D.; Brianti, E. Leishmania infantum in wild animals in endemic areas of southern Italy. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101374. [Google Scholar] [CrossRef] [PubMed]
  38. Tsokana, C.N.; Sokos, C.; Giannakopoulos, A.; Mamuris, Z.; Birtsas, P.; Papaspyropoulos, K.; Valiakos, G.; Spyrou, V.; Lefkaditis, M.; Chatzopoulos, D.C.; et al. First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp. Parasitol. Res. 2016, 115, 313–321. [Google Scholar] [CrossRef] [PubMed]
  39. Tsokana, C.N.; Sokos, C.; Giannakopoulos, A.; Birtsas, P.; Athanasiou, L.V.; Valiakos, G.; Sofia, M.; Chatzopoulos, D.C.; Kantere, M.; Spyrou, V.; et al. Serological and molecular investigation of selected parasitic pathogens in European brown hare (Lepus europaeus) in Greece: Inferring the ecological niche of Toxoplasma gondii and Leishmania infantum in hares. Parasitol. Res. 2019, 118, 2715–2721. [Google Scholar] [CrossRef] [PubMed]
  40. Tsakmakidis, I.; Pavlou, C.; Tamvakis, A.; Papadopoulos, T.; Christodoulou, V.; Angelopoulou, K.; Dovas, C.I.; Antoniou, M.; Anastasakis, C.; Diakou, A. Leishmania infection in lagomorphs and minks in Greece. Vet. Parasitol. Reg. Stud. Reports 2019, 16, 100279. [Google Scholar] [CrossRef] [PubMed]
  41. Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef] [PubMed]
  42. Ecke, F.; Han, B.A.; Hörnfeldt, B.; Khalil, H.; Magnusson, M.; Singh, N.J.; Ostfeld, R.S. Population fluctuations and synanthropy explain transmission risk in rodent-borne zoonoses. Nat. Commun. 2022, 13, 7532. [Google Scholar] [CrossRef]
  43. Pruvot, M.; Chea, S.; Hul, V.; In, S.; Buor, V.; Ramassamy, J.-L.; Fillieux, C.; Sek, S.; Sor, R.; Ros, S.; et al. Small mammals at the edge of deforestation in Cambodia: Transient community dynamics and potential pathways to pathogen emergence. One Earth 2023, 7, 123–135. [Google Scholar] [CrossRef]
  44. IDESCAT—Institute d’Estadística de Catalunya. Available online: https://www.idescat.cat/indicadors/?id=aec&n=15228 (accessed on 18 January 2024).
  45. Generalitat de Catalunya, 2018. Department of Agriculture, Livestock, Fisheries and Food. Damage and Risk Prevention Plan Originated by Hunting Fauna (2017–2018). [In Catalan]. Available online: https://agricultura.gencat.cat/web/.content/01-departament/plans-programes-sectorials/enllacos-documents/fitxers-binaris/pla-prevencio-danys-riscos-originats-fauna-cinegetica-2017-2018.pdf (accessed on 15 January 2024).
Figure 1. Map of the study area in Catalonia, NE Spain, indicating provinces sampled (Barcelona, Girona, Lleida, and Tarragona), and the distribution of the European hare (Lepus europaeus). The European rabbit (Oryctolagus cuniculus) is widely distributed throughout the territory in all provinces within Catalonia.
Figure 1. Map of the study area in Catalonia, NE Spain, indicating provinces sampled (Barcelona, Girona, Lleida, and Tarragona), and the distribution of the European hare (Lepus europaeus). The European rabbit (Oryctolagus cuniculus) is widely distributed throughout the territory in all provinces within Catalonia.
Animals 14 01080 g001
Table 1. Apparent sample prevalence (%) of antibodies against L. infantum in European hare (Lepues europaeus), European rabbit (O. cuniculus), and rural domestic dogs in the four provinces of Northeastern Spain Mediterranean Ecoregion (Girona, Tarragona, Lleida, and Barcelona).
Table 1. Apparent sample prevalence (%) of antibodies against L. infantum in European hare (Lepues europaeus), European rabbit (O. cuniculus), and rural domestic dogs in the four provinces of Northeastern Spain Mediterranean Ecoregion (Girona, Tarragona, Lleida, and Barcelona).
SpeciesGironaTarragonaLleidaBarcelonaTotal
% (n)% (n)% (n)% (n)% (n; 95% CI)
Lepus europaeus2.7 (122)-0 (14)0 (11)2.0 (147; 0.7–5.8)
Oryctolagus cuniculus0 (3)46.1 (13)20.4 (54)37.8 (37)27.9 (111; 20.4–36.9) *
Canis familiaris5.2 (115)24.6 (65)10.3 (39)14.29 (7)11.9 (226; 8.3–16.8)
Total3.8 (240)27.8 (78)13.0 (107)25.4 (55)12.6 (484; 9.9–15.9)
* The total sample size of O. cuniculus does not sum up because four individuals were from unknown provinces within the study area. n: number of samples analyzed; CI: confidence intervals.
Table 2. Prevalence of L. infantum in lagomorph species from Spain (i.e., European rabbit–Oryctolagus cuniculus; European hare–Lepus europaeus; Iberian hare–Lepus granatensis; Broom hare–Lepus castroviejoi) reported in the literature.
Table 2. Prevalence of L. infantum in lagomorph species from Spain (i.e., European rabbit–Oryctolagus cuniculus; European hare–Lepus europaeus; Iberian hare–Lepus granatensis; Broom hare–Lepus castroviejoi) reported in the literature.
Geographic Origin% (Analyzed)MethodSampleRef
L. europaeusMediterranean NE Spain2.0% (147)ELISASerumPresent study
0% (20)PCRSpleen
O. cuniculusCatalonia, NE Spain27.9% (111)ELISASerum
L. europaeusAtlantic, Northern Spain64.25% (14)PCRSpleen[16]
NE Spain0% (2)PCRSpleen
L. castroviejoiAtlantic, Northern Spain0% (2)PCRSpleen
Central Spain60% (10)PCRSpleen
L. granatensisNE Spain60% (5)PCRSpleen
Northern plateau20% (5)PCRSpleen
Southern plateau38.8% (54)PCRSpleen
Guadalquivir valley, South Spain50% (2)PCRSpleen
L. granatensisSouthern Madrid, Central Spain74.1% (85) *IFATSerum[12]
O. cuniculus 45.7% (35) *IFATSerum
O. cuniculusMediterranean SE Spain0% (36)ELISASerum[15]
0.8% (129)PCRSpleen
O. cuniculusLoja, Granada, SE Spain100% (40) *PCRSkin[14]
Huéscar, Granada, SE Spain0% (11)PCRSkin
L. granatensisNorthern Madrid, Central Spain17.4% (69)IFATSerum[23]
1.45% (69)PCRSkin
O. cuniculus 49.8% (215)IFAT Serum
12.1% (215)PCRSkin
O. cuniculusSouth-East Spain30% (80)rtPCRSkin[17]
L. granatensis 0% (1)
O. cuniculusGranada, SE Spain28.6% (150)IFATSerum[18]
20.7% (150)PCRblood, liver, Spleen, heart, skin
O. cuniculusMadrid, Central Spain75.4% (69) *IFATSerum[24]
2.9%/17.4% (69) *PCRSpleen/Skin
L. granatensisMadrid, Central Spain85.71% (7) *DFA assayMultiple [25]
14.29% (7) *IFATSpleen exudate
O. cuniculus 36.54% (52) *DFA assayMultiple
0% (50) *IFATSpleen exudate
L.: Lepus. O.: Oryctolagus. (*): animals from areas with emerging human leishmaniasis. IFAT: Indirect Fluorescent Antibody Technique. DFA assay: direct fluorescence antibody assay.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cabezón, O.; Martínez-Orellana, P.; Ribas, M.P.; Baptista, C.J.; Gassó, D.; Velarde, R.; Aguilar, X.F.; Solano-Gallego, L. Leishmania Infection in Wild Lagomorphs and Domestic Dogs in North-East Spain. Animals 2024, 14, 1080. https://doi.org/10.3390/ani14071080

AMA Style

Cabezón O, Martínez-Orellana P, Ribas MP, Baptista CJ, Gassó D, Velarde R, Aguilar XF, Solano-Gallego L. Leishmania Infection in Wild Lagomorphs and Domestic Dogs in North-East Spain. Animals. 2024; 14(7):1080. https://doi.org/10.3390/ani14071080

Chicago/Turabian Style

Cabezón, Oscar, Pamela Martínez-Orellana, Maria Puig Ribas, Catarina Jota Baptista, Diana Gassó, Roser Velarde, Xavier Fernández Aguilar, and Laia Solano-Gallego. 2024. "Leishmania Infection in Wild Lagomorphs and Domestic Dogs in North-East Spain" Animals 14, no. 7: 1080. https://doi.org/10.3390/ani14071080

APA Style

Cabezón, O., Martínez-Orellana, P., Ribas, M. P., Baptista, C. J., Gassó, D., Velarde, R., Aguilar, X. F., & Solano-Gallego, L. (2024). Leishmania Infection in Wild Lagomorphs and Domestic Dogs in North-East Spain. Animals, 14(7), 1080. https://doi.org/10.3390/ani14071080

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop