Bovine FRAS1: mRNA Expression Profile, Genetic Variations, and Significant Correlations with Ovarian Morphological Traits, Mature Follicle, and Corpus Luteum
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Bovine Ovary Tissues
2.2. Potential Indel Loci Screening, Identification, and Genotyping
2.3. Extraction of Total RNA and cDNA for qRT-PCR
2.4. Detection of Whether Expression Levels Are Associated with Mutations
2.5. Statistical Analysis and Transcription Factor Binding Prediction
3. Results
3.1. The Transcription Expression of the FRAS1 Gene in Bovine Different Tissues
3.2. Identification of the P3-D20-bp (rs522341234) and P4-D15-bp (rs453892138) Polymorphisms
3.3. Genetic Parameters and Haplotype Analysis of Two Polymorphic Indels
3.4. Correlation Analysis of Two Indel Polymorphisms with Ovarian Dimensions Phenotypes
3.5. Relationships between the Tested Polymorphisms of FRAS1 and Mature Follicles, Luteum, or Corpus Albicans
3.6. Correlations between Ovarian Traits and mRNA Expression of the FRAS1 Gene
3.7. Potential Combination of Transcription Factors with a Mutation Sequence
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Berry, D.P.; Friggens, N.C.; Lucy, M.; Roche, J.R. Milk production and fertility in cattle. Annu. Rev. Anim. Biosci. 2016, 4, 269–290. [Google Scholar] [CrossRef]
- Burgers, E.E.A.; Kok, A.; Goselink, R.M.A.; Hogeveen, H.; Kemp, B.; van Knegsel, A.T.M. Fertility and milk production on commercial dairy farms with customized lactation lengths. J. Dairy Sci. 2021, 104, 443–458. [Google Scholar] [CrossRef] [PubMed]
- Abdollahi-Arpanahi, R.; Morota, G.; Peñagaricano, F. Predicting bull fertility using genomic data and biological information. J. Dairy Sci. 2017, 100, 9656–9666. [Google Scholar] [CrossRef] [PubMed]
- Cai, Z.; Guldbrandtsen, B.; Lund, M.S.; Sahana, G. Prioritizing candidate genes for fertility in dairy cows using gene-based analysis, functional annotation and differential gene expression. BMC Genom. 2019, 20, 255. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Bovenhuis, H. Genome-wide association studies for genetic effects that change during lactation in dairy cattle. J. Dairy Sci. 2019, 102, 7263–7276. [Google Scholar] [CrossRef]
- Jaton, C.; Schenkel, F.S.; Chud, T.C.S.; Malchiodi, F.; Sargolzaei, M.; Price, C.A.; Canovàs, A.; Baes, C.; Miglior, F. Genetic and genomic analyses of embryo production in dairy cattle. Reprod. Fertil. Dev. 2019, 32, 50–55. [Google Scholar] [CrossRef]
- Ma, L.; Cole, J.B.; Da, Y.; VanRaden, P.M. Symposium review: Genetics, genome-wide association study, and genetic improvement of dairy fertility traits. J. Dairy Sci. 2019, 102, 3735–3743. [Google Scholar] [CrossRef]
- Pausch, H.; Mapel, X.M. Review: Genetic mutations affecting bull fertility. Animal 2023, 17 (Suppl. 1), 100742. [Google Scholar] [CrossRef]
- Liang, Z.; Prakapenka, D.; VanRaden, P.M.; Jiang, J.; Ma, L.; Da, Y. A million-cow genome-wide association study of three fertility traits in U.S. Holstein cows. Int. J. Mol. Sci. 2023, 24, 10496. [Google Scholar] [CrossRef]
- Smyth, I.; Du, X.; Taylor, M.S.; Justice, M.J.; Beutler, B.; Jackson, I.J. The extracellular matrix gene Frem1 is essential for the normal adhesion of the embryonic epidermis. Proc. Natl. Acad. Sci. USA 2004, 101, 13560–13565. [Google Scholar] [CrossRef]
- Thomas, I.T.; Frias, J.L.; Felix, V.; de Leon, L.S.; Hernandez, R.A.; Jones, M.C. Isolated and syndromic cryptophthalmos. Am. J. Med. Genet. 1986, 25, 85–98. [Google Scholar] [CrossRef] [PubMed]
- Ou, T.Y.; Tsai, M.C.; Kuo, P.L.; Lee, N.C.; Chou, Y.Y. Whole exome sequencing identifies a novel FRAS1 mutation and aids in vitro fertilization with preimplantation genetic diagnosis in Fraser syndrome. Taiwan. J. Obstet. Gynecol. 2022, 61, 521–524. [Google Scholar] [CrossRef] [PubMed]
- Esho, T.; Kobbe, B.; Tufa, S.F.; Keene, D.R.; Paulsson, M.; Wagener, R. The fraser complex proteins [Frem1, Frem2, and Fras1] can form anchoring cords in the absence of AMACO at the dermal-epidermal junction of mouse skin. Int. J. Mol. Sci. 2023, 24, 6782. [Google Scholar] [CrossRef] [PubMed]
- Kiyozumi, D.; Sugimoto, N.; Sekiguchi, K. Breakdown of the reciprocal stabilization of QBRICK/Frem1, Fras1, and Frem2 at the basement membrane provokes Fraser syndrome-like defects. Proc. Natl. Acad. Sci. USA 2006, 103, 11981–11986. [Google Scholar] [CrossRef] [PubMed]
- Pavlakis, E.; Chiotaki, R.; Chalepakis, G. The role of Fras1/Frem proteins in the structure and function of basement membrane. Int. J. Biochem. Cell Biol. 2011, 43, 487–495. [Google Scholar] [CrossRef] [PubMed]
- McGregor, L.; Makela, V.; Darling, S.M.; Vrontou, S.; Chalepakis, G.; Roberts, C.; Smart, N.; Rutland, P.; Prescott, N.; Hopkins, J.; et al. Fraser syndrome and mouse blebbed phenotype caused by mutations in FRAS1/Fras1 encoding a putative extracellular matrix protein. Nat. Genet. 2003, 34, 203–208. [Google Scholar] [CrossRef] [PubMed]
- Fridley, B.L.; Ghosh, T.M.; Wang, A.; Raghavan, R.; Dai, J.; Goode, E.L.; Lamba, J.K. Genome-Wide Study of Response to Platinum, Taxane, and Combination Therapy in Ovarian Cancer: In vitro Phenotypes, Inherited Variation, and Disease Recurrence. Front. Genet. 2016, 7, 37. [Google Scholar] [CrossRef]
- Al-Hamed, M.H.; Sayer, J.A.; Alsahan, N.; Tulbah, M.; Kurdi, W.; Ambusaidi, Q.; Ali, W.; Imtiaz, F. Novel loss of function variants in FRAS1 AND FREM2 underlie renal agenesis in consanguineous families. J. Nephrol. 2021, 34, 893–900. [Google Scholar] [CrossRef]
- Robinson, R.S.; Hammond, A.J.; Wathes, D.C.; Hunter, M.G.; Mann, G.E. Corpus luteum–endometrium–embryo interactions in the dairy cow: Underlying mechanisms and clinical relevance. Reprod. Dom. Anim. 2008, 43, 104–112. [Google Scholar] [CrossRef]
- Edson, M.A.; Nagaraja, A.K.; Matzuk, M.M. The mammalian ovary from genesis to revelation. Endocr. Rev. 2009, 30, 624–712. [Google Scholar] [CrossRef]
- Rimon-Dahari, N.; Yerushalmi-Heinemann, L.; Alyagor, L.; Dekel, N. Ovarian Folliculogenesis. Results Probl. Cell Differ. 2016, 58, 167–190. [Google Scholar]
- Stocco, C.; Telleria, C.; Gibori, G. The molecular control of corpus luteum formation, function, and regression. Endocr. Rev. 2007, 28, 117–149. [Google Scholar] [CrossRef]
- Petro, E.M.; Leroy, J.L.; Van Cruchten, S.J.; Covaci, A.; Jorssen, E.P.; Bols, P.E. Endocrine disruptors and female fertility: Focus on [bovine] ovarian follicular physiology. Theriogenology 2012, 78, 1887–1900. [Google Scholar] [CrossRef]
- Freetly, H.C.; Vonnahme, K.A.; McNeel, A.K.; Camacho, L.E.; Amundson, O.L.; Forbes, E.D.; Lents, C.A.; Cushman, R.A. The consequence of level of nutrition on heifer ovarian and mammary development. J. Anim. Sci. 2014, 92, 5437–5443. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mossa, F.; Ireland, J.J. Physiology and endocrinology symposium: Anti-Müllerian hormone: A biomarker for the ovarian reserve, ovarian function, and fertility in dairy cows. J. Anim. Sci. 2019, 97, 1446–1455. [Google Scholar] [CrossRef]
- Liu, H.; Zhai, J.; Wu, H.; Wang, J.; Zhang, S.; Li, J.; Niu, Z.; Shen, C.; Zhang, K.; Liu, Z.; et al. Diversity of Mitochondrial DNA Haplogroups and Their Association with Bovine Antral Follicle Count. Animals 2022, 12, 2350. [Google Scholar] [CrossRef]
- Li, J.; Zhang, S.; Shen, C.; Niu, Z.; Yang, H.; Zhang, K.; Liu, Z.; Wang, Y.; Lan, X. Indel mutations within the bovine HSD17B3 gene are significantly associated with ovary morphological traits and mature follicle number. J. Steroid Biochem. Mol. Biol. 2021, 209, 105833. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.L. The Studies on Histological Characteristics of Follicular Systems and Corpus Luteum in Yaks during the Estrous Cycle. Master’s Thesis, Gansu Agricultural University, Lanzhou, China, 2002. [Google Scholar]
- Aljanabi, S.M.; Martinez, I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acids Res. 1997, 25, 4692–4693. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Shen, C.; Zhang, K.; Niu, Z.; Liu, Z.; Zhang, S.; Wang, Y.; Lan, X. Polymorphic variants of bovine ADCY5 gene identified in GWAS analysis were significantly associated with ovarian morphological related traits. Gene 2021, 766, 145158. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, Z.; He, Z.; Tang, W.; Li, T.; Zeng, Z.; He, L.; Shi, Y.Y. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis [http://analysis.bio-x.cn]. Cell Res. 2009, 19, 519–523. [Google Scholar] [CrossRef]
- Gethöffer, F.; Pfarrer, C.; Siebert, U. Histology confirms that macroscopic evaluation of ovaries is a valid method for the assessment of the reproductive status in wild boar. Theriogenology 2018, 113, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Lan, K.; Shen, C.; Li, J.; Zhang, S.; Lan, X.; Pan, C.; Wang, Y. A novel indel within the bovine SEPT7 gene is associated with ovary length. Anim. Biotechnol. 2021, 34, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Deng, T.; Jiang, E.; Li, J.; Wijayanti, D.; Wang, Y.; Ding, X.; Lan, X. Genetic variations of bovine PCOS-related DENND1A gene identified in GWAS significantly affect female reproductive traits. Gene 2021, 802, 145867. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Li, J.; Jiang, F.; Song, E.; Lan, X.; Zhao, H. Fertility-associated polymorphism within bovine ITGβ5 and its significant correlations with ovarian and luteal traits. Animals 2021, 11, 1579. [Google Scholar] [CrossRef] [PubMed]
- Kalpachidou, T.; Makrygiannis, A.K.; Pavlakis, E.; Stylianopoulou, F.; Chalepakis, G.; Stamatakis, A. Behavioural effects of extracellular matrix protein Fras1 depletion in the mouse. Eur. J. Neurosci. 2021, 53, 3905–3919. [Google Scholar] [CrossRef] [PubMed]
- Messad, F.; Louveau, I.; Koffi, B.; Gilbert, H.; Gondret, F. Investigation of muscle transcriptomes using gradient boosting machine learning identifies molecular predictors of feed efficiency in growing pigs. BMC Genom. 2019, 20, 659. [Google Scholar] [CrossRef]
- Son, D.H.; Hwang, N.H.; Chung, W.H.; Seong, H.S.; Lim, H.; Cho, E.S.; Choi, J.W.; Kang, K.S.; Kim, Y.M. Whole-genome resequencing analysis of 20 Micro-pigs. Genes Genom. 2020, 42, 263–272. [Google Scholar] [CrossRef]
- Takamiya, K.; Kostourou, V.; Adams, S.; Jadeja, S.; Chalepakis, G.; Scambler, P.J.; Huganir, R.L.; Adams, R.H. A direct functional link between the multi-PDZ domain protein GRIP1 and the Fraser syndrome protein Fras1. Nat. Genet. 2004, 36, 172–177. [Google Scholar] [CrossRef]
- Miller, K.A.; Gordon, C.T.; Welfare, M.F.; Caruana, G.; Bertram, J.F.; Bateman, J.F.; Farlie, P.G. bfb, a novel ENU-induced blebs mutant resulting from a missense mutation in Fras1. PLoS ONE 2013, 8, e76342. [Google Scholar] [CrossRef]
- Wang, V.; Geybels, M.S.; Jordahl, K.M.; Gerke, T.; Hamid, A.; Penney, K.L.; Markt, S.C.; Freedman, M.; Pomerantz, M.; Lee, G.M.; et al. A polymorphism in the promoter of FRAS1 is a candidate SNP associated with metastatic prostate cancer. Prostate 2021, 81, 683–693. [Google Scholar] [CrossRef]
- Midro, A.T.; Stasiewicz-Jarocka, B.; Borys, J.; Hubert, E.; Skotnicka, B.; Hassmann-Poznańska, E.; Sierpińska, T.; Panasiuk, B.; Schanze, D.; Zenker, M. Two unrelated families with variable expression of fraser syndrome due to the same pathogenic variant in the FRAS1 gene. Am. J. Med. Genet. A 2020, 182, 773–779. [Google Scholar] [CrossRef]
- Fischer, D.; Laiho, A.; Gyenesei, A.; Sironen, A. Identification of reproduction-related gene polymorphisms using whole transcriptome sequencing in the large white pig population. G3 2015, 5, 1351–1360. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.X.; Shen, Q.C.; Zheng, M.Q.; Su, Y.C.; Cai, R.C.; Yu, Y.; Yang, X.R.; Chen, Z.W.; Wen, J.; Zhao, G.P. A selection method of chickens with blue-eggshell and dwarf traits by molecular marker-assisted selection. Poult. Sci. 2019, 98, 3114–3118. [Google Scholar] [CrossRef] [PubMed]
- Ansari-Mahyari, S.; Sørensen, A.C.; Lund, M.S.; Thomsen, H.; Berg, P. Across-family marker-assisted selection using selective genotyping strategies in dairy cattle breeding schemes. J. Dairy Sci. 2008, 91, 1628–1639. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Hack, M.E.; Abdelnour, S.A.; Swelum, A.A.; Arif, M. The application of gene marker-assisted selection and proteomics for the best meat quality criteria and body measurements in Qinchuan cattle breed. Mol. Biol. Rep. 2018, 45, 1445–1456. [Google Scholar] [CrossRef] [PubMed]
- Hayes, B.; Goddard, M. Genome-wide association and genomic selection in animal breeding. Genome 2010, 53, 876–883. [Google Scholar] [CrossRef] [PubMed]
- Ahmar, S.; Ballesta, P.; Ali, M.; Mora-Poblete, F. Achievements and challenges of genomics-assisted breeding in forest trees: From marker-assisted selection to genome editing. Int. J. Mol. Sci. 2021, 22, 10583. [Google Scholar] [CrossRef]
- Baldassarre, H. Laparoscopic ovum pick-up followed by in vitro embryo production and transfer in assisted breeding programs for ruminants. Animals 2021, 11, 216. [Google Scholar] [CrossRef]






| Loci | Rs Numbers | Primer Sequences (5′–3′) | Product Sizes (bp) | Tm (°C) | Region | Note |
|---|---|---|---|---|---|---|
| P1-D36-bp | rs438887427 | F1: TTCCACTGTTTCCCCATCTATT | 291/255 | 58.1 | intron 14 | deletion |
| R1: GGCTGTATTTTGTCACCCTTCT | ||||||
| P2-D21-bp | rs432223525 | F2: GCATCCCTGGAATAAACCCAAT | 175/154 | 62.0 | intron 19 | deletion |
| R2: ACCACTACCCTGATACCAAAAC | ||||||
| P3-D20-bp | rs522341234 | F3: GTTAATCGCCCAATATGTCTCGTG | 195/175 | 62.9 | intron29 | deletion |
| R3: CTGAAAGAAGCCTCTCTACCACTC | ||||||
| P4-D15-bp | rs453892138 | F4: ACAGAATTCTCTCCAGAGCAATGAA | 252/237 | 60.3 | exon73 (non-coding region) | deletion |
| R4: CTGTCTTGGAAGAAACAGTGGC | ||||||
| P5-D18-bp | rs527003260 | F5: GGTCGCAAAGAATTGGACACG | 248/230 | 60.4 | exon 73 | deletion |
| R5: TTGGCAGGTGGGTTCTTAACT | ||||||
| Bovine-FRAS1 | - | F: CACCAGGAGCTGGAATTCAT | 105 | 62.0 | - | qRT-PCR |
| R: AGTCCTCCCATCTTGAAACAC |
| Loci | Sizes | Genotypic Frequencies | Allelic Frequencies | HWE p Values | Population Parameters | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| DD | ID | II | D | I | Ho | He | Ne | PIC | |||
| P3-D20-bp | 1169 | 0.537 | 0.384 | 0.079 | 0.729 | 0.271 | 0.350 | 0.605 | 0.395 | 1.652 | 0.317 |
| P4-D15-bp | 1826 | 0.080 | 0.146 | 0.774 | 0.153 | 0.847 | 1.747 × 10−77 | 0.741 | 0.259 | 1.350 | 0.226 |
| Stage | Sizes * | Traits | Observed Genotypes (LSM ± SE) | p Values | ||
|---|---|---|---|---|---|---|
| II | ID | DD | ||||
| Dioestrum | 236 | Ovarian weight (g) | 10.21 b ± 0.55 (21) | 11.93 b ± 0.49 (91) | 13.64 a ± 0.39 (124) | 0.019 |
| 231 | Corpus luteum diameter (mm) | 14.40 b ± 1.42 (21) | 17.24 b ± 0.67 (89) | 18.91 a ± 0.81 (121) | 0.035 | |
| 645 | Ovarian length (mm) | 39.33 B ± 1.03 (46) | 43.20 A ± 0.52 (256) | 41.87 AB ± 0.46 (343) | 0.008 | |
| Stage | Sizes * | Traits | Observed Genotypes (LSM ± SE) | p Values | ||
|---|---|---|---|---|---|---|
| II | ID | DD | ||||
| Metaestrus | 322 | Ovarian length (mm) | 41.69 b ± 0.59 (251) | 44.85 a ± 1.01 (48) | 44.26 ab ± 1.52 (23) | 0.045 |
| 110 | Mature follicle diameter (mm) | 12.11 B ± 0.45 (85) | 11.95 B ± 0.85 (14) | 16.59 A ± 1.44 (11) | 0.004 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, L.; Shen, S.; Pan, C.; Lan, X.; Li, J. Bovine FRAS1: mRNA Expression Profile, Genetic Variations, and Significant Correlations with Ovarian Morphological Traits, Mature Follicle, and Corpus Luteum. Animals 2024, 14, 597. https://doi.org/10.3390/ani14040597
Zhu L, Shen S, Pan C, Lan X, Li J. Bovine FRAS1: mRNA Expression Profile, Genetic Variations, and Significant Correlations with Ovarian Morphological Traits, Mature Follicle, and Corpus Luteum. Animals. 2024; 14(4):597. https://doi.org/10.3390/ani14040597
Chicago/Turabian StyleZhu, Leijing, Siyuan Shen, Chuanying Pan, Xianyong Lan, and Jie Li. 2024. "Bovine FRAS1: mRNA Expression Profile, Genetic Variations, and Significant Correlations with Ovarian Morphological Traits, Mature Follicle, and Corpus Luteum" Animals 14, no. 4: 597. https://doi.org/10.3390/ani14040597
APA StyleZhu, L., Shen, S., Pan, C., Lan, X., & Li, J. (2024). Bovine FRAS1: mRNA Expression Profile, Genetic Variations, and Significant Correlations with Ovarian Morphological Traits, Mature Follicle, and Corpus Luteum. Animals, 14(4), 597. https://doi.org/10.3390/ani14040597
