Next Article in Journal
Presence of Borrelia Spirochetes in White Stork (Ciconia ciconia), White-Tailed Eagle (Haliaeetus albicilla), and Eastern Imperial Eagle (Aquila heliaca): Hospitalized in a Wild Bird Hospital and Sanctuary (Hortobágy, Hungary)
Previous Article in Journal
A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Analysis of HSP70 and HSF3 Polymorphisms and Their Associations with the Egg Production Traits of Bangladeshi Hilly Chickens

1
Bangladesh Livestock Research Institute, Savar, Dhaka 1341, Bangladesh
2
United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu 183-8538, Japan
3
College of Agriculture, Ibaraki University, Ami 300-0393, Ibaraki, Japan
*
Author to whom correspondence should be addressed.
Animals 2024, 14(24), 3552; https://doi.org/10.3390/ani14243552
Submission received: 12 October 2024 / Revised: 25 November 2024 / Accepted: 25 November 2024 / Published: 10 December 2024
(This article belongs to the Section Poultry)

Simple Summary

Heat stress is a challenging environmental factor that affects poultry production. Adaptation to heat stress is regulated by heat shock proteins (HSPs). In chickens, HSP70 expression is controlled by heat shock factor 3 (HSF3). The genetic diversity of heat shock genes is thought to be closely associated with the productive and reproductive performance of farm animals. The present study aimed to explore the relationships between single-nucleotide polymorphisms (SNPs) in the genes of Bangladeshi hilly chickens and their egg production traits. Sequencing and allele-specific PCR identified two novel SNPs (G-399A and A-68G) in the 5′-flanking regions of HSP70. In addition, three previously identified SNPs in HSP70 (A258G, C276G and C1431A) and two SNPs in HSF3 (A-1388G and A-1703G) were also genotyped. A population of 150 breeding hilly chickens was used to analyze the associations between SNPs in these genes and the chickens’ egg production traits. Among the analyzed SNPs, the two novel SNPs (G-399A and A-68G) were significantly associated with egg number and egg weight, respectively. In addition, all other SNPs except A-1703G were also found to be associated with egg production traits. These results suggest that the identified SNPs in these genes might be useful in a selective breeding program to enhance productivity in warm environments.

Abstract

In warm environments, thermoregulation in poultry is controlled by heat shock protein 70 (HSP70), whose expression is controlled by heat shock factor 3 (HSF3). Although the association between genetic polymorphisms in these genes and thermotolerance as well as reproductive traits has been extensively studied in mammals, the association has not yet been studied in poultry. This study aimed to explore the relationship between single-nucleotide polymorphisms (SNPs) in these genes and the egg production traits of Bangladeshi hilly chickens. Sequencing and allele-specific PCR (AS-PCR) were used to detect new SNPs and perform genotyping. We identified two novel SNPs (G-399A and A-68G) in the 5′-flanking regions of HSP70 that were significantly associated with egg numbers (ENs) at 161–190 days and increased egg weight (EW) at 40 weeks of age. Furthermore, three SNPs in HSP70 (A258G, C276G and C1431A) and one SNP in HSF3 (A-1388G) were associated with EN at different ages. The haplotype and combined genotypic effects of these two genes were found to be associated with age at sexual maturity (ASM), EN, EW, and body weight at ASM. The identified SNPs and their corresponding haplotypes may be useful in selective breeding to enhance the productivity of chickens in warm environments.

1. Introduction

In Bangladesh, indigenous poultry farming plays a vital role in providing nutrition to much of the population, with almost 89% of rural households engaged in this sector [1]. Commercial strains and indigenous chicken breeds contribute almost equal numbers of eggs (50:50) and meat (60:40) to satisfy the national demand in Bangladesh [2,3]. Compared to the other indigenous breeds, the hilly chicken exhibits superior disease resistance, earlier sexual maturity, and higher egg production in Bangladesh’s hot weather. In addition, the hilly chicken shows lower mortality during rearing in rural areas, highlighting its potential as a promising indigenous chicken breed in Bangladesh [4].
However, due to global climate change, indigenous poultry farming in Bangladesh faces the economically harmful challenge of high ambient temperatures [5]. During heat stress, birds generally thermoregulate through reduced feed intake, hormonal regulation, and panting, which can negatively influence production and reproduction [6,7]. Chicken thermoregulation also involves the expression of heat shock-related genes, such as genes that encode heat shock proteins (HSPs) and heat shock transcription factors (HSF) [8,9].
The heat shock protein 70 (HSP70) gene, a member of the HSP family, is expressed in almost all types of cells [10]. This gene plays protective roles in various stress responses, including heat stress, and maintains homeostasis by balancing the synthesis and degradation of cellular proteins [11,12]. It has been demonstrated in previous studies that genetic variations (i.e., single-nucleotide polymorphisms; SNPs) in the 5′-flanking regions of HSP70 affect the function of this gene, leading to changes in cellular processes and influencing phenotypic traits, including heat tolerance, weaning weight, milk production, fertility, and disease susceptibility in large animals [13,14]. Similarly, certain SNPs (e.g., A258G, C276G and C1431A) in the coding region of HSP70 have been linked to thermotolerance, production, and reproductive performance in chickens [15,16]. Polymorphisms in the 5′-flanking regions of HSP70 have also been associated with thermotolerance and reproductive traits in mammals [17,18,19]; however, the correlation between these SNPs and egg production traits in chickens remains unclear.
Heat shock proteins, including HSP70, are transcriptionally regulated by HSF3, a member of the HSF protein family, in chickens [20,21]. HSF3 regulates the expression of HSP70 and acts as a primary defense against heat stress [21,22]. A previous study found that the genetic polymorphism A-1388G alters the activity of the CdxA transcription binding site, resulting in changes to the promoter activity of the HSF3 gene in chickens [23,24]. This alteration has also been associated with heat-resistance parameters in Lingshan chickens; however, the associations between chicken reproductive traits and SNPs of HSF3 remain unexplored [23].
With regard to indigenous breeds such as the hilly chicken of Bangladesh, which exhibit resilience to harsh conditions, the genetic mechanisms underlying their superior thermotolerance, particularly in relation to HSPs and HSFs, remain inadequately explored [25]. In particular, understanding how genetic variations in key genes such as HSP70 and HSF3 affect reproductive traits under heat stress is crucial to optimizing poultry breeding programs for improved productivity in tropical climates [26,27].
We hypothesized that genetic variations in the HSP70 and HSF3 genes contribute to egg production traits in hilly chickens and could be used to improve thermotolerance and productivity in chickens raised in high ambient temperatures. Therefore, we aimed (i) to identify genetic variations (SNPs) in the HSP70 and HSF3 genes in hilly chicken in Bangladesh and (ii) to assess the associations between these SNPs and egg production traits. The development of genetic selection strategies aimed at improving thermotolerance and reproductive performance in poultry could help to improve the sustainability of chicken farming in hot climates.

2. Materials and Methods

2.1. Experimental Birds and Trait Records

A total of 150 female hilly chickens maintained at the Bangladesh Livestock Research Institute (BLRI) (9th generation of the breeding flock) were used in the present study (Figure 1). These hens were reared from hatching under the standard management protocol of the BLRI. At 16 weeks of age, the birds were transferred to separate cages in a naturally ventilated poultry house with a 16 h photoperiod that included 12 h of daylight and 4 h of artificial light. During the laying age period (17–72 weeks), the birds were fed twice a day (morning and evening) with a diet containing 16.33% crude protein and 2845 kcal ME/kg DM. The hens were provided free access to water. From that point until reaching 310 days of age, the following parameters were recorded: the age at sexual maturity (ASM), body weight (BW) at ASM, egg weight (EW) at ASM (g), monthly egg production (number/bird), and EW at 40 weeks of age (g).

2.2. Blood Collection and Genomic DNA Extraction

Blood samples from mature hilly hens were collected at 310 days of age and stored on FTA cards (Qiagen GmbH, Hilden, Germany). The genomic DNA was extracted from the cards according to the manufacturer’s instructions. After the genomic DNA was extracted, the DNA concentrations were measured using a Bio Spec-Nano (Shimadzu Corp., Kyoto, Japan) and stored at 20 °C until further analysis.

2.3. Primer Design, PCR Amplification, and Sequencing of the HSP70 Fragment

A pair of primers (Table 1) was designed using Primer3 software, v4.1.0(NCBI), utilizing the complete DNA sequence of HSP70 (NC_052536.1). To amplify the 5′ flanking region of the HSP70 gene, PCR was performed in a final reaction volume of 20 μL, containing 100 ng of genomic DNA, 10 μL of 2× GoTaq Green Master Mix (Promega Corp., Madison, WI, USA), and 10 pmol/μL of each primer (HSP70_F_Common and HSP70_R). Amplification was conducted, beginning with initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 64 °C for 30 s, and extension at 72 °C for 30 s, then a final 5 min of extension at 72 °C. The PCR products were electrophoresed on a 1% agarose gel, and the gel was stained with ethidium bromide to visualize the amplicons. The amplified PCR products were purified from the agarose gel using a NucleoSpin Gel and PCR Clean-up Kit (Macherey–Nagel GmbH & Co. KG, Valencienner, Dueren, Germany). The purified DNA provided the template for direct sequencing using a Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Inc., Foster City, CA, USA) for each primer strand (HSP70_F/Seq and HSP70_R/Seq) (Table 1). An AB1 3130 Sequencer (Applied Biosystems) was used to sequence the products according to the manufacturer’s protocol. The sequence data for the 5′-flanking regions of HSP70 were edited, assembled, and aligned. Polymorphism detection was conducted using GENETYX v.15 (GENETYX Corp., Tokyo, Japan).

2.4. Genotyping of SNPs and Reconstruction of Haplotypes in the HSP70 Gene

The SNPs were genotyped separately using allele-specific PCR (AS-PCR). AS-PCR was performed in a 20 μL reaction volume containing 10 pmol/μL of each primer (Table 1) using combinations of P1 + P5 or P2 + P5 for G-399A, P3 + P5 or P4 + P5 for A 68G, P9 + P13 or P10 + P13 for A258G, P11 + P13 or P12 + P13 for C276G, and P14 + P16 or P15 + P16 for C1431A. For the PCR reaction, we used 100 ng of DNA and 10 μL of 2 × GoTaq Green Master Mix (Promega); the remainder of the reaction volume was made up using nuclease-free water. The PCR protocol consisted of the following steps: initial denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing temperatures and cycle numbers as in Table 1, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. The PCR products were separated on 1.5% (>200 bp) or 2% (<200 bp) agarose gel depending on the amplicon size, and the gel was stained with ethidium bromide for visualization. Haplotypes were constructed using the population genotyping data (Table 2).

2.5. Genotyping of SNPs and Reconstruction of Haplotypes Within HSF3 Gene

Genotyping of the SNPs within HSF3 was performed via AS-PCR. The primer (Table 3) combinations of P17 + P19 or P18 + P19 were used for A-1388G, and those of P20 + P22 or P21 + P22 were used for A-1703G. The PCR conditions and mixtures are detailed above (Section 2.4). Haplotypes were constructed using genotyping data as described in Table 2.

2.6. Statistical Analysis

To assess the associations between egg production traits and SNPs or haplotypes, a general linear model procedure in IBM SPSS Statistics for Windows, v.20.0 (IBM Corp., Armonk, NY, USA) was used. The following equation was employed for the analysis [28]:
Yij = μ + Gi+ eij
where Yij represents the phenotypic value of the specific traits (e.g., egg production, EW, ASM, and BW), μ represents the population mean of the target trait, Gi represents the genotype effect (where i = 3 genotypes), and eij represents the random residual error associated with the Yij observation. A chi-squared (χ2) test was used to assess the Hardy–Weinberg equilibrium (HWE) in the population. The parameter values were presented as the least square means ± standard error, and statistical significance (least significant difference) was evaluated at p < 0.05. Haplotype frequencies with a minimum threshold of >3% were considered for the association study.

3. Results

3.1. Identification of Novel SNPs in the 5′-Flanking Region of HSP70

Based on a reference sequence of HSP70 from the NCBI database (https://www.ncbi.nlm.nih.gov/, accessed on 2 July 2022; NC_052536.1), two novel SNPs, G-399A (Figure 2A) and A-68G (Figure 2B), were identified in the 729 bp length of the 5′-flanking regions of the HSP70 gene in Bangladeshi hilly chickens.

3.2. Genotypic and Allelic Frequencies and Haplotype Combinations in HSP70

A total of five SNPs (Table 4) were genotyped, including two novel SNPs, G 399A (Figure 3A) and A-68G (Figure 3B), and three previously reported SNPs, A258G (Figure 3C), C276G (Figure 3D), and C1431A (Figure 3E), in the HSP70 gene of hilly chickens.
Table 5 shows the genotypic and allelic frequencies for the analyzed SNPs in HSP70. For the G-399A SNP, the frequency of the wild-type GG genotype (0.92) was significantly (p < 0.05) greater than that of the AG (0.08) genotype, and the frequency of the G allele (0.95) was notably greater (p < 0.05) than that of its A allele (0.05) counterpart. Regarding the A-68G SNP, the frequency of the AA genotype (0.67) was significantly greater (p < 0.05) compared with the AG (0.22) and GG (0.10) genotypes, and the frequency of the A allele (0.78) was greater than that of the G allele (0.22).
In SNP A258G, the frequency of the AG genotype (0.77) was significantly higher (p < 0.05) than that of the AA genotype (0.20) or the GG genotype (0.03). The frequency of the A allele (0.58) was comparatively greater (p < 0.05) than that of the G allele (0.4) for this SNP. Regarding the C276G SNP, the CC genotype had a more significant (p < 0.05) frequency (0.58) than the CG (0.39) and GG (0.03) genotypes. In addition, an increased frequency of the C allele (0.77) was noted compared with the G allele (0.23). The C1431A SNP of HSP70 exhibited two genotypes: CC (0.74) and CA (0.26). The frequency of the C allele (0.87) was significantly higher (p < 0.05) than that of the A allele (0.13). All SNPs, except C276G and C1431A, were outside the HWE (p < 0.05). Table 2 presents the 15 distinct haplotypes (H1–H15) identified in the study sample, derived from the genotyping data of the five SNPs. The most common haplotype was H1, with a frequency of 0.34, while the frequencies of the other haplotypes ranged from 0.02 to 0.12.

3.3. Association Between Genotypes and Egg Production Traits for HSP70

Table 6 shows the associations between specific polymorphisms in the HSP70 gene and egg production traits in chickens. Significant effects were observed for certain SNPs on traits such as egg number (EN) and EW. Notably, G-399A and A258G were linked to egg production during specific intervals, while A-68G was associated with EW at 40 weeks (Table 6).
G-399A was significantly (p < 0.05) correlated with EN at 161–190 days of age. Birds with the AG genotype of this SNP had significantly (p < 0.05) greater ENs compared to birds with the GG genotype. The A-68G SNP demonstrated a significant association with egg weight (EW) at 40 weeks of age, with birds possessing the mutant GG genotype exhibiting a notably higher EW (p < 0.05) in comparison to those with the wild AA genotype (Table 7).
The A258G SNP was related (p < 0.05) to the EN at 221–250 days of age. In addition, the AA genotype hens produced the highest number of eggs (16.00), which was significantly greater than the other two genotypes; however, no significant variations were observed between the AG and GG genotypes. The C276G SNP did not exhibit a significant association with the EN at 281–310 days of age; nevertheless, chickens with the GG genotype had statistically higher ENs compared to chickens with the CC and CG genotypes. The C1431A SNP was found to be associated (p < 0.05) with EN at 191–220 days of age, and the birds with the heterozygous CA genotype had significantly higher ENs than the CC genotype birds (Table 7).

3.4. Association of the Haplotypes for HSP70 with Egg Production Traits in the Hilly Chicken

This study considered a total of eight haplotypes (H1–H3 and H7–H11) with frequencies of >3% that were used in the association analysis. These haplotypes were significantly (p < 0.05) associated with ASM, EW at ASM, EW at 40 weeks, BW at ASM, and EN. Among all haplotypes, H11 exhibited an association with a substantially earlier ASM and a greater EN at 130–160 and 161–190 days of age compared to the other haplotypes. Haplotype 2 (H2) was significantly associated with reduced BW at ASM and increased EN at 191–220 days of age relative to the other haplotypes. In addition, H7 exhibited an association with markedly elevated EW values at ASM and 40 weeks compared with the other haplotypes (Table 8).

3.5. Genotypic and Allelic Frequencies and Haplotype Combinations in HSF3

Two previously known SNPs, A-1388G (Figure 4A) and A-1703G (Figure 4B), in the 5′-untranslated region (UTR) of the HSF3 gene were genotyped in the studied flock.
Table 9 presents the genotype and allele frequencies and reveals that the A-1388G SNP showed only two categories of genotypes, with the frequency of the dominant AA genotype (0.94) being remarkably greater than that of the AG genotype (0.06). The frequency of allele A (0.97) was much higher than that of the G allele (0.03), and the allocation of genotypes in the studied flock did not conflict with the HWE (p > 0.05).
Regarding the A-1703G SNP, the frequency of the AA genotype was notably greater (0.91) than that of the AG genotype (0.09), with a significantly greater frequency of the A allele (0.96) compared with the G allele (0.04). In addition, according to the χ2 test, this SNP deviated from the HWE (p < 0.05). The genotype data were used to perform haplotype reconstruction, which revealed the existence of two haplotype categories, AA and AG, from two novel SNPs (G-399A and A-68G), among the 150 individual birds that were examined.

3.6. Association Between Genotypes and Egg Production Traits and HSF3

The significant association analyses between the SNPs and egg production traits are shown in Table 10. For SNP A-1388G, a significant (p < 0.05) association was found for the EN at 130–160 days of age, with a greater value observed for the AG genotype compared with the AA genotype.
However, a significantly reduced EN was also found at 251–280 days of age for this SNP (A-1388G) compared with the AA genotypes (Table 11). Lastly, the A-1703G SNP did not show any significant (p < 0.05) correlations with the egg production traits in the studied flock (Table 10).

3.7. Association of HSF3 Haplotypes with Hilly Chicken Egg Production Traits

A significant association (p < 0.05) was observed between the haplotypes and the ASM and ENs at different ages. Compared with H1, H2 was associated with a significantly earlier ASM (days) and a higher EN during the 130–160 days of age period. Meanwhile, H1 showed a significant correlation with a higher EN during the 251–280 days of age period compared with H2 (Table 12).

3.8. Evaluation of Combined Genotypic Effects of SNPs G-399A and A-68G in HSP70 with A-1388G SNP in HSF3 on Egg Production Traits

We analyzed the effects of the combined genotypes of G-399A/A-1388G and A-68G/A-1388G SNPs on the phenotypic performance of the studied population. Birds with wild-type/heterozygote combinations for the G-399A and A-1388G SNPs showed a significantly (p < 0.05) earlier ASM and higher ENs at 130–160 days of age compared to wild-type/wild-type birds. BW at 40 weeks and EN at 161–190 and 251–280 days of age were also significantly (p < 0.05) influenced by different combinations of these two SNPs (Table 13).
The combined genotypic effects of the A-68G and A-1388G SNPs indicate that any mutant combinations, such as Het × Wild (AG × AA) or Mut × Wild (GG × AA), exhibited a more pronounced impact on EW at 40 weeks and ASM compared to Wild × Wild (AA × AA) birds (p < 0.05) (Table 14).

4. Discussion

High ambient temperatures negatively affect livestock reproduction, and this impact may be intensified by ongoing global warming, particularly for backyard poultry farms. The use of genetic heat-resistance markers in animal breeding programs is beneficial for improving poultry productivity in hot climates [30,31].
HSP70 is one of the most common biological response markers of thermal stress and participates in numerous physiological processes, including protein folding, transportation, and assembly within cells [32,33]. It also protects cells by inhibiting the apoptotic pathway, which can positively impact animal health and productivity [34]. The present study identified SNPs in the HSP70 and HSFF3 genes that regulate the transcription of HSP70 and investigated their associations with the reproductive traits of Bangladeshi hilly chickens.
Analysis of the HSP70 gene in hilly chickens showed that it exhibited heterogeneity in the 5′-flanking regions. These genetic variations are caused by the transitions of the nucleotides at positions −399 bp and −68 bp 5′-upstream from the start codon. The 5′-flanking region of HSP70 is polymorphic, and several SNPs have also been reported in the naked neck broiler and in Indonesian local chickens [18,35,36]. In addition, three previously reported synonymous SNPs in the coding region of this gene (A258G, C276G and C1431A) were also found in the studied flock. All the SNPs in HSP70, except C276G and C1431A, were outside the Hardy–Weinberg equilibrium (Table 3). This might be due to the selection and breeding strategy used to improve the studied flock.
The present study revealed significant associations between the tested HSP70 SNPs and specific egg production traits in hilly chickens (Table 6). The novel G-399A SNP was found to be significantly correlated with greater ENs (p < 0.05), and A-68G showed a significant association with increased EW (p < 0.05) (Table 7). These associations indicated that genetic variations in HSP70 may influence egg production efficiency in chickens in hot environments. Similar effects associated with HSP70 SNPs in the 5′-flanking region have been reported in other vertebrates, including the finding that several SNPs in the 5′-flanking region of the HSP70 gene in cattle were associated with mRNA stability, stress responses, milk production, and calf weaning weight [14,17]. Variations in the 5′-flanking regions of HSP70 may alter the specific binding sites of the transcription factors and could therefore modulate the binding efficiency that affects gene functions. This could lead to changes in cellular processes and ultimately alter phenotype performance [14,37]. The precise mechanism of how HSP70 affects egg production in chickens remains unknown. However, a possible explanation might be that during heat stress, HSP70 regulates thermotolerance and inhibits apoptosis in ovarian cells, which may lead to the protection of granulosa cells, ultimately improving folliculogenesis and egg production [38,39,40]. Therefore, further physiological research is required in this area.
Regarding the three examined synonymous SNPs of HSP70, the AA genotype of A258G conferred a higher EN (p < 0.05) at 221–250 days than the other genotypes. The AA genotype of the same SNP was significantly associated with improved thermotolerance and BW at an early stage in Taiwanese chickens, but not with EW or EN until 280 days of age [16]. This discrepancy may be due to differences in chicken breeds or environmental factors such as temperature and duration of heat stress exposure. Furthermore, the GG genotype of the C276G SNP was significantly associated with greater EN (Table 7). In a previous study, the C276G polymorphism was found to produce a novel haplotype in combination with the A258G SNP, reported as a heat stress marker in Indonesian Walik chickens [15]. These silent mutations in the coding region of the HSP70 gene have been previously reported as heat-resistance markers in chickens [41]. However, this earlier study was not an association study considering reproductive performance in chickens. In the present study, the C1431A SNP was significantly correlated with increased ENs, as shown in Table 7. A significant association between this SNP and EW, fertility, and hatchability percentage was previously observed in Iranian Mazandaran native breeder chickens, but the authors did not report an association between this SNP and the EN [29].
Although important egg production traits such as ASM, EW at ASM, and BW at ASM were not correlated with any individual HSP70 SNPs (Table 6), the haplotype combinations resulting from the five SNPs significantly affected these traits (Table 8). This suggests that the individual effects of these SNPs are small compared with their combined effects. In chickens, combined genotypes have a greater impact on BW than individual genotypes [42].
Regarding the SNPs in the HSF3 gene, although the A-1703G SNP did not significantly affect the egg production traits in the studied flock, the A-1388G SNP was found to be significantly associated with the EN (Table 11). Notably, the A-1388G polymorphism has been found to change the CdxA transcription factor binding site associated with thermotolerance in Chinese Lingshan chickens [23]. Haplotype analysis of HSF3 also revealed significant associations with several egg production traits, including EN and ASM for H2 (Table 12). Laying hens with the H2 haplotype exhibited an earlier ASM and significantly greater ENs than hens with the H1 haplotype. However, it is noteworthy that the EN was reduced at a later stage (251–280 days of age) for H2, indicating that this haplotype may be less advantageous for long-term egg production.
Our findings revealed significant associations between specific SNPs within the HSP70 and HSF3 genes and egg production traits in the studied population. Analysis of the combined effects of two novel SNPs (G-399A and A-68G) in HSP70 and the A-1388G SNP in HSF3 on phenotypic performance revealed a significant interaction that suggests that these genes may play synergistic or compensatory roles in egg production in hot environments.

5. Conclusions

Two novel SNPs (G-399A and A-68G) were identified in the 5′-flanking regions of HSP70 in hilly chickens, and three previously known SNPs (A258G, C276G and C1431A) of HSP70 also existed in HSP70 in the same breed. In addition, the HSF3 gene was also found to possess two reported SNPs (A-1388G and A-1703G) in this studied breed. All the SNPs in both genes, except A-1703G in HSF3, and their corresponding haplotypes were associated with egg production traits in hilly chickens. These significant SNPs and haplotypes might be available in the future for molecular marker-based selection programs to enhance the egg productivity of hilly chickens in the high ambient temperatures of Bangladesh. Further research is needed to elucidate the precise mechanisms that enable HSPs to improve the productive performance of chickens.

Author Contributions

Conception and design of the study, T.O. and M.Y.A.; curation of data, S.F. and M.Y.A.; formal analysis, M.Y.A.; methodology, M.Y.A., S.A. and S.F.; investigation, T.O. and M.Y.A.; original draft preparation, M.Y.A.; supervision, review and editing, S.A. and T.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

This study was conducted following the rules and standards established by the Institutional Animal Ethics Executive Committee of the Bangladesh Livestock Research Institute (BLRI), Bangladesh (Approval number: AEEC/BLRI 0012/22).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors confirmed and declared no conflicts of interest.

References

  1. Bhuiyan, A.K.F.H.; Bhuiyan, M.S.A.; Deb, G.K. Indigenous chicken genetic resources in Bangladesh: Current status and future outlook. Anim. Genet. Resour. Inf. 2005, 36, 73–84. [Google Scholar] [CrossRef]
  2. Rashid, M.A.; Manjula, P.; Faruque, S.; Bhuiyan, A.K.F.H.; Seo, D.; Alam, J.; Lee, J.H.; Bhuiyan, M.S.A. Genetic diversity and population structure of indigenous chicken of Bangladesh using microsatellite markers. Asian-Australas. J. Anim. Sci. 2020, 33, 1732–1740. [Google Scholar] [CrossRef]
  3. Afrin, A.; Ahmed, T.; Lahiry, A.; Rahman, S.; Dey, B.; Hashem, M.A.; Das, S.C. Profitability and meat quality of fast-, medium- and slow-growing meat-type chicken genotypes as affected by growth and length of rearing. Saudi J. Biol. Sci. 2024, 31, 104025. [Google Scholar] [CrossRef] [PubMed]
  4. Khan, M.K.; Siddiki, A.Z.; Ali, M.R.; Akter, M. Identification of best performer hilly chickens of Bangladesh in consideration of climate change factors: Light and heat. Indian J. Anim. Sci. 2017, 87, 991–995. [Google Scholar] [CrossRef]
  5. Chowdhury, Q.M.M.K.; Hossain, M.; Ahmed, J.; Shykat, C.A.; Islam, M.S.; Hasan, M. Impact of climate change on livestock in Bangladesh: A review of what we know and what we need to know. Am. J. Agric. Sci. Eng. Technol. 2019, 3, 89–96. [Google Scholar] [CrossRef]
  6. He, S.P.; Arowolo, M.A.; Medrano, R.F.; Li, S.; Yu, Q.F.; Chen, J.Y.; He, J.H. Impact of heat stress and nutritional interventions on poultry production. Worlds. Poult. Sci. J. 2018, 74, 647–664. [Google Scholar] [CrossRef]
  7. Kim, D.H.; Lee, Y.K.; Lee, S.D.; Kim, S.H.; Lee, S.R.; Lee, H.G.; Lee, K.W. Changes in production parameters, egg qualities, fecal volatile fatty acids, nutrient digestibility, and plasma parameters in laying hens exposed to ambient temperature. Front. Vet. Sci. 2020, 7, 412. [Google Scholar] [CrossRef]
  8. Feder, M.E.; Hofmann, G.E. Heat-shock proteins, molecular chaperones, and the stress response: Evolutionary and ecological physiology. Annu. Rev. Physiol. 1999, 61, 243–282. [Google Scholar] [CrossRef]
  9. Sawka, M.N.; Wenger, C.B.; Pandolf, K.B. Thermoregulatory responses to acute exercise-heat stress and heat acclimation. In Comprehensive Physiology; Wiley: Hoboken, NJ, USA, 2011; pp. 157–185. [Google Scholar]
  10. Lindquist, S.; Craig, E.A. The heat-shock proteins. Annu. Rev. Genet. 1988, 22, 631–677. [Google Scholar] [CrossRef]
  11. Huang, L.Z.; Zhou, M.; Ding, Y.F.; Zhu, C. Gene networks involved in plant heat stress response and tolerance. Int. J. Mol. Sci. 2022, 23, 11970. [Google Scholar] [CrossRef]
  12. Kan, Y.; Mu, X.R.; Gao, J.; Lin, H.X.; Lin, Y. The molecular basis of heat stress responses in plants. Mol. Plant 2023, 16, 1612–1634. [Google Scholar] [CrossRef] [PubMed]
  13. Moniruzzaman, M.; Ahmed, I.; Huq, S.; All Mahmud, M.S.; Begum, S.; Mahzabin Amin, U.S.; Rahman, M.H.; Sarker, P.K.; Hossain, M.U.; Das, K.C.; et al. Association of polymorphism in heat shock protein 70 genes with type 2 diabetes in Bangladeshi population. Mol. Genet. Genom. Med. 2020, 8, e1073. [Google Scholar] [CrossRef] [PubMed]
  14. Hassan, F.; Nawaz, A.; Rehman, M.S.; Ali, M.A.; Dilshad, S.M.R.; Yang, C. Prospects of HSP70 as a genetic marker for thermo-tolerance and immuno-modulation in animals under climate change scenario. Anim. Nutr. 2019, 5, 340–350. [Google Scholar] [CrossRef] [PubMed]
  15. Aryani, A.; Solihin, D.D.; Sumantri, C.; Afnan, R.; Sartika, T. Genetic diversity of the structure of HSP70 gene in Kampung Unggul Balitbangtan (KUB), Walik, and Kate Walik chickens. Trop. Anim. Sci. J. 2019, 42, 180–188. [Google Scholar] [CrossRef]
  16. Liang, H.M.; Lin, D.Y.; Hsuuw, Y.D.; Huang, T.P.; Chang, H.L.; Lin, C.Y.; Wu, H.H.; Hung, K.H. Association of heat shock protein 70 gene polymorphisms with acute thermal tolerance, growth, and egg production traits of native chickens in Taiwan. Arch. Anim. Breed. 2016, 59, 173–181. [Google Scholar] [CrossRef]
  17. Abbas, Z.; Hu, L.; Fang, H.; Sammad, A.; Kang, L.; Brito, L.F.; Xu, Q.; Wang, Y. Association analysis of polymorphisms in the 5′ flanking region of the HSP70 gene with blood biochemical parameters of lactating Holstein cows under heat and cold stress. Animals 2020, 10, 2016. [Google Scholar] [CrossRef]
  18. Prihandini, P.W.; Primasari, A.; Aryogi, A.; Luthfi, M.; Hariyono, D.N.H. Genetic polymorphisms of the 5′ untranslated regions of the HSP70 gene in Indonesian cattle populations. Vet. World 2022, 15, 168–172. [Google Scholar] [CrossRef]
  19. Suhendro, I.; Noor, R.R.; Jakaria, J.; Priyanto, R.; Manalu, W.; Andersson, G. Association of heat-shock protein 70.1 gene with physiological and physical performance of Bali cattle. Vet. World 2024, 17, 17–25. [Google Scholar] [CrossRef]
  20. Takii, R.; Fujimoto, M.; Matsuura, Y.; Wu, F.; Oshibe, N.; Takaki, E.; Katiyar, A.; Akashi, H.; Makino, T.; Kawata, M.; et al. HSF1 and HSF3 cooperatively regulate the heat shock response in lizards. PLoS ONE 2017, 12, e0180776. [Google Scholar] [CrossRef]
  21. Gouda, A.; Tolba, S.; Mahrose, K.; Felemban, S.G.; Khafaga, A.F.; Khalifa, N.E.; Jaremko, M.; Moustafa, M.; Alshaharni, M.O.; Algopish, U.; et al. Heat shock proteins as a key defense mechanism in poultry production under heat stress conditions. Poult. Sci. 2024, 103, 103537. [Google Scholar] [CrossRef]
  22. Shehata, A.M.; Saadeldin, I.M.; Tukur, H.A.; Habashy, W.S. Modulation of heat-shock proteins mediates chicken cell survival against thermal stress. Animals 2020, 10, 2407. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, W.; Kong, L.; Zhang, D.; Ji, C.; Zhang, X.; Luo, Q. Effect of the C.–1 388 A>G polymorphism in chicken heat shock transcription factor 3 gene on heat tolerance. J. Integr. Agric. 2015, 14, 1808–1815. [Google Scholar] [CrossRef]
  24. Wang, X.H.; Yu, H.L.; Zou, W.B.; Mi, C.H.; Dai, G.J.; Zhang, T.; Zhang, G.X.; Xie, K.Z.; Wang, J.Y. Study of the relationship between polymorphisms in the IL-8 gene promoter region and Coccidiosis resistance index in Jinghai yellow chickens. Genes 2020, 11, 476. [Google Scholar] [CrossRef] [PubMed]
  25. Perini, F.; Cendron, F.; Rovelli, G.; Castellini, C.; Cassandro, M.; Lasagna, E. Emerging genetic tools to investigate molecular pathways related to heat stress in chickens: A review. Animals 2020, 11, 46. [Google Scholar] [CrossRef] [PubMed]
  26. Juiputta, J.; Chankitisakul, V.; Boonkum, W. Appropriate genetic approaches for heat tolerance and maintaining good productivity in tropical poultry production: A review. Vet. Sci. 2023, 10, 591. [Google Scholar] [CrossRef]
  27. Onagbesan, O.M.; Uyanga, V.A.; Oso, O.; Tona, K.; Oke, O.E. Alleviating heat stress effects in poultry: Updates on methods and mechanisms of actions. Front. Vet. Sci. 2023, 10, 1255520. [Google Scholar] [CrossRef]
  28. Cui, Z.; Liu, L.; Zhao, X.; Ran, J.; Wang, Y.; Yin, H.; Li, D.; Zhu, Q. Analysis of expression and single nucleotide polymorphisms of INHA gene associated with reproductive traits in chickens. Biomed Res. Int. 2019, 2019, 8572837. [Google Scholar] [CrossRef]
  29. Najafi, M.; Rouhi, M.; Mokhtari, R.; Kazemi, H. Genetic analysis of a novel polymorphism in coding region of HSP70 gene and its association with some productive and reproductive traits in Mazandaran native breeder hens. J. Genet. Disord. Genet. Med. 2019, 2, 1–5. [Google Scholar]
  30. Deb, R.; Sajjanar, B.; Singh, U.; Kumar, S.; Brahmane, M.P.; Singh, R.; Sengar, G.; Sharma, A. Promoter variants at AP2 box region of Hsp70.1 affect thermal stress response and milk production traits in Frieswal cross bred cattle. Gene 2013, 532, 230–235. [Google Scholar] [CrossRef]
  31. Kumar, M.; Ratwan, P.; Dahiya, S.P.; Nehra, A.K. Climate change and heat stress: Impact on production, reproduction and growth performance of poultry and its mitigation using genetic strategies. J. Therm. Biol. 2021, 97, 102867. [Google Scholar] [CrossRef]
  32. Singh, M.K.; Shin, Y.; Ju, S.; Han, S.; Choe, W.; Yoon, K.S.; Kim, S.S.; Kang, I. Heat shock response and heat shock proteins: Current understanding and future opportunities in human diseases. Int. J. Mol. Sci. 2024, 25, 4209. [Google Scholar] [CrossRef] [PubMed]
  33. Archana, P.; Aleena, J.; Pragna, P.; Vidya, M.; Niyas, P.A.; Bagath, M.; Krishnan, G.; Manimaran, A.; Beena, V.; Kurien, E.; et al. Role of heat shock proteins in livestock adaptation to heat stress. J. Dairy Vet. Anim. Res. 2017, 5, 13–19. [Google Scholar] [CrossRef]
  34. Grepper, D.; Tabasso, C.; Zanou, N.; Aguettaz, A.K.F.; Castro-Sepulveda, M.; Ziegler, D.V.; Lagarrigue, S.; Arribat, Y.; Martinotti, A.; Ebrahimi, A.; et al. BCL2L13 at endoplasmic reticulum-mitochondria contact sites regulates calcium homeostasis to maintain skeletal muscle function. iScience 2024, 27, 110510. [Google Scholar] [CrossRef] [PubMed]
  35. Galal, A.; Radwan, L.M. Identification of single nucleotide polymorphism in heat shock protein HSP70 and HSP90 after four selection generations in two lines of chickens. Ann. Agric. Sci. 2020, 65, 124–128. [Google Scholar] [CrossRef]
  36. Galal, A.; Radwan, L.M.; Rezik, H.H.; Ayoub, H. Expression levels of HSP70 and CPT-1 in three local breeds of chickens reared under normal or heat stress conditions after the introduction of the naked neck gene. J. Therm. Biol. 2019, 80, 113–118. [Google Scholar] [CrossRef]
  37. Basiricò, L.; Morera, P.; Primi, V.; Lacetera, N.; Nardone, A.; Bernabucci, U. Cellular thermotolerance is associated with heat shock protein 70.1 genetic polymorphisms in Holstein lactating cows. Cell Stress Chaperones 2011, 16, 441–448. [Google Scholar] [CrossRef]
  38. Sirotkin, A.V. Effect of two types of stress (heat shock/high temperature and malnutrition/serum deprivation) on porcine ovarian cell functions and their response to hormones. J. Exp. Biol. 2010, 213, 2125–2130. [Google Scholar] [CrossRef]
  39. Li, L.; Wu, J.; Luo, M.; Sun, Y.; Wang, G. The effect of heat stress on gene expression, synthesis of steroids, and apoptosis in bovine granulosa cells. Cell Stress Chaperones 2016, 21, 467–475. [Google Scholar] [CrossRef]
  40. Yan, L.; Hu, M.; Gu, L.; Lei, M.; Chen, Z.; Zhu, H.; Chen, R. Effect of heat stress on egg production, steroid hormone synthesis, and related gene expression in chicken preovulatory follicular granulosa cells. Animals 2022, 12, 1467. [Google Scholar] [CrossRef]
  41. Budi, T.; Singchat, W.; Tanglertpaibul, N.; Thong, T.; Panthum, T.; Noito, K.; Wattanadilokchatkun, P.; Jehangir, M.; Chaiyes, A.; Wongloet, W.; et al. Possible influence of thermal selection on patterns of HSP70 and HSP90 gene polymorphisms in Thai indigenous and local chicken breeds and red junglefowls. Poult. Sci. 2024, 103, 103503. [Google Scholar] [CrossRef]
  42. Cao, Z.P.; Wang, S.Z.; Wang, Q.G.; Wang, Y.X.; Li, H. Association of spot14α gene polymorphisms with body weight in the chicken. Poult. Sci. 2007, 86, 1873–1880. [Google Scholar] [CrossRef]
Figure 1. Location of the conducted study.
Figure 1. Location of the conducted study.
Animals 14 03552 g001
Figure 2. Determination of SNPs in the 5′-flanking regions of the HSP70 gene by sequencing. (A) The unique SNP G-399A was detected as multiple peaks at the same positions of 399 bp upstream from the start codon. (B) The unique SNP A-68G was detected as multiple peaks at the same positions of 68 bp upstream from the start codon.
Figure 2. Determination of SNPs in the 5′-flanking regions of the HSP70 gene by sequencing. (A) The unique SNP G-399A was detected as multiple peaks at the same positions of 399 bp upstream from the start codon. (B) The unique SNP A-68G was detected as multiple peaks at the same positions of 68 bp upstream from the start codon.
Animals 14 03552 g002
Figure 3. The electrophoresis images of AS-PCR for five SNPs, including two novel SNPs (G-399A and A-68G) and three known in the coding regions (CDs) of the HSP70 gene. (A) Image of AS-PCR for G-399A SNP generated 300 bp. Samples 1, 2, and 5 represent wild GG, while 3 and 4 represent AG genotypes, respectively. M shows a 1 kb DNA ladder marker. (B) Photograph of AS-PCR for the A-68G SNP, which produced 630 bp. AA (Samples 1, 2), AG (Samples 3, 4 and 6) and GG (Sample 5) represent mutated homozygous genotypes. M shows a 1 kb DNA ladder marker. (C) Photograph of AS-PCR for the A258G SNP, which produced 600 bp. AA (Sample 1) represented wild type, while AG (Sample 2) indicates heterozygous, and mutated homozygous GG is represented in Sample 3, respectively. M shows a 1 kb DNA ladder marker. (D) The image of AS-PCR for the C276G SNP yielded 616 bp. Mutated GG (Sample 4) genotypes, CC (Samples 1 and 3), and CG (Sample 2) indicate wild and heterozygous genotypes, respectively. M shows a 1 kb DNA ladder marker. (E) Picture of AS-PCR for the SNP of C1431A, which created 198 bp. Heterozygous CA (Samples 1–3) genotype, while CC (Sample 4) represents a wild genotype. M shows a 100 bp DNA ladder marker.
Figure 3. The electrophoresis images of AS-PCR for five SNPs, including two novel SNPs (G-399A and A-68G) and three known in the coding regions (CDs) of the HSP70 gene. (A) Image of AS-PCR for G-399A SNP generated 300 bp. Samples 1, 2, and 5 represent wild GG, while 3 and 4 represent AG genotypes, respectively. M shows a 1 kb DNA ladder marker. (B) Photograph of AS-PCR for the A-68G SNP, which produced 630 bp. AA (Samples 1, 2), AG (Samples 3, 4 and 6) and GG (Sample 5) represent mutated homozygous genotypes. M shows a 1 kb DNA ladder marker. (C) Photograph of AS-PCR for the A258G SNP, which produced 600 bp. AA (Sample 1) represented wild type, while AG (Sample 2) indicates heterozygous, and mutated homozygous GG is represented in Sample 3, respectively. M shows a 1 kb DNA ladder marker. (D) The image of AS-PCR for the C276G SNP yielded 616 bp. Mutated GG (Sample 4) genotypes, CC (Samples 1 and 3), and CG (Sample 2) indicate wild and heterozygous genotypes, respectively. M shows a 1 kb DNA ladder marker. (E) Picture of AS-PCR for the SNP of C1431A, which created 198 bp. Heterozygous CA (Samples 1–3) genotype, while CC (Sample 4) represents a wild genotype. M shows a 100 bp DNA ladder marker.
Animals 14 03552 g003aAnimals 14 03552 g003b
Figure 4. Electrophoresis images of AS-PCR for two SNPs in the 5′-UTR regions of HSF3 gene. (A) Photograph of AS-PCR for the A-1388G SNP, which produced 420 bp. Only two categorized genotypes, AA (Samples 1–5) and AG (Sample 6), were found. M shows a 1 kb DNA ladder marker. (B) Image of AS-PCR for the SNP A-1703G, which produced 354 bp. Samples 1, 3, 4, and 5 represent AA, while sample 2 indicates AG genotype. M shows a 1 kb DNA ladder marker.
Figure 4. Electrophoresis images of AS-PCR for two SNPs in the 5′-UTR regions of HSF3 gene. (A) Photograph of AS-PCR for the A-1388G SNP, which produced 420 bp. Only two categorized genotypes, AA (Samples 1–5) and AG (Sample 6), were found. M shows a 1 kb DNA ladder marker. (B) Image of AS-PCR for the SNP A-1703G, which produced 354 bp. Samples 1, 3, 4, and 5 represent AA, while sample 2 indicates AG genotype. M shows a 1 kb DNA ladder marker.
Animals 14 03552 g004
Table 1. Primer sequences for sequencing and genotyping of the HSP70 gene.
Table 1. Primer sequences for sequencing and genotyping of the HSP70 gene.
NoPrimer NameSequence (5′ to 3′)Anneal. Temp.PCR CycleProduct Length
P1
P2
P3
P4
P5
P6
P7
P8
HSP70_R_S1_G
HSP70_R_S1_A
HSP70_R_S2_A
HSP70_R_S2_G
HSP70_F_Com
HSP70_R
HSP70_F_Seq
HSP70_R_Seq
CCAATCACAACGCGCTCTC
CCAATCACAACGCGCTCTT
TCGCTCGCAGTCACGTCT
TCGCTCGCAGTCACGTCC
AGAAGTTGTGTGAGTCGCGA
AATACGTGGTGCCCAGATCG
GTCGCGACCAAATAAGGGTA
GTGCCCAGATCGATGCCGATG
30300
6430630
30729
P9
P10
P11
P12
P13
HSP70_R_S1_A
HSP70_R_S1_G
HSP70_R_S2_C
HSP70_R_S2_G
HSP70_F_Com
GAAGGGCCAGTGCTTCATGTCT
GAAGGGCCAGTGCTTCATGTCC
CCTCGTTCACCACACGGAAG
CCTCGTTCACCACACGGAAC
CGATCTGGCTGCAATCTACG
6030600
5830616
P14
P15
P16
HSP70_R_S3_C
HSP70_R_S3_A
HSP70_S3_F_Com
CTATGTCAAAAGTGACCTCG
CTATGTCAAAAGTGACCTCT
AGCGTAACACCACCATTC
5530198
F: Forward primer, R: Reverse primer, Com: Common. Primer sets P1–P6 and P9–P16 were used for the amplification of specific alleles, and primers P7–P8 were used for sequencing the 5′ flanking in HSP70.
Table 2. Haplotype construction using 5 SNPs in the HSP70 gene and their frequencies.
Table 2. Haplotype construction using 5 SNPs in the HSP70 gene and their frequencies.
HaplotypePosition of SNPFrequency
G-399AA-68GA258GC276GC1431A
H1GAACC0.34
H2GAACA0.04
H3GAGGC0.08
H4GAGCA0.03
H5AAACC0.02
H6GAAGC0.03
H7GGACC0.09
H8GAGGA0.07
H9GAGCC0.12
H10GGGCC0.03
H11GGGCA0.04
H12GGGGA0.02
H13GGAGA0.03
H14GGACA0.03
H15GGGGC0.03
Table 3. Primer sequences for genotyping of HSF3 gene.
Table 3. Primer sequences for genotyping of HSF3 gene.
NoPrimer NameSequence (5′ to 3′)Anneal. Temp.PCR CycleProduct Length
P17
P18
P19
HSF3_F_S1_A
HSF3_F_S1_G
HSF3_S1_R_Com
GTCCCCATAATACCTCCCCA
GTCCCCATAATACCTCCCCG
TTTTAGCTGCCAGTTCCTTT
6025354
P20
P21
P22
HSF3_R_S2_ A
HSF3_R_S2_G
HSF3_S2_F_Com
TTTTAGCTGCCAGTTCCTTT
TTTTAGCTGCCAGTTCCTTC
AAGAATGGCTCCTTGCCACC
5930420
F: Forward primer, R: Reverse primer, Com: Common. Primer sets P17–P22 were used for the amplification of specific alleles in the HSF3 gene.
Table 4. Analyzed single-nucleotide polymorphisms (SNPs) in the chicken HSP70 gene.
Table 4. Analyzed single-nucleotide polymorphisms (SNPs) in the chicken HSP70 gene.
SNP NameMutationLocationGenomic Position
G-399AG>A *5′-flanking52383334
A-68GA>G *5′-flanking52383665
A258GA>GCoding[15]
C276GC>GCoding[15]
C1431AC>ACoding[29]
* Novel SNP found in the HSP70 gene.
Table 5. Genotypic and allelic frequencies with Hardy-Weinberg equilibrium test at the SNP locus of the HSP70 gene.
Table 5. Genotypic and allelic frequencies with Hardy-Weinberg equilibrium test at the SNP locus of the HSP70 gene.
SNPsGenotype FrequencyAllele Frequencyχ2 (HWE)p-Value
G-399AGGAGAAGA
0.92(137)0.08(12)0.950.057.44p < 0.01
A-68GAAAGGGAG
0.67(72)0.22(24)0.10(11)0.780.2211.68p < 0.01
A258GAAAGGGAG
0.20(28)0.77(113)0.03(5)0.580.4250.44p < 0.00
C276GCCCGGGCG
0.58(86)0.39(58)0.03(5)0.770.231.63p > 0.05
C1431ACCCAAACA
0.74(110)0.26(39)0.870.133.42p > 0.05
SNP: Single nucleotide polymorphism, p < 0.05: statistically significant using Pearson’s χ2 test, p > 0.05: Non-significant, HWE: Hardy–Weinberg equilibrium.
Table 6. Association of polymorphisms in HSP70 gene with egg production traits.
Table 6. Association of polymorphisms in HSP70 gene with egg production traits.
SNPsTraits (p Value of Significant Test)
ASM
(Days)
BW at ASMEW at ASMEW at
40 WK
EN
130–160 d
EN
161–190 d
EN
191–220 d
EN
221–250 d
EN
251–280 d
EN
281–310 d
G-399A0.8900.1480.1290.6600.5780.0200.4210.2180.4840.225
A-68G0.3650.5370.7070.0090.5470.5200.4780.4440.4130.186
A258G0.5430.5930.4260.9600.5610.5630.5900.0160.3770.805
C276G0.3820.2460.2750.7950.5680.3040.7590.2620.2220.050
C1431A0.1210.4640.6510.8550.9690.6810.0120.0580.3410.363
Significant: p < 0.05, ASM: Age at sexual maturity, EW: Egg weight, EN: Egg number, WK: Week.
Table 7. Genotypic effects of SNPs in HSP70 gene on egg production traits.
Table 7. Genotypic effects of SNPs in HSP70 gene on egg production traits.
SNPsTraitsGenotypes (Mean ± SE)p Value
G-399AEN at 161–190 dGG
16.27 ± 0.26 b
AG
18.83 ± 0.86 a
AA
 
0.020
A-68GEW at 40 wkAA
46.56 ± 0.11 b
AG
47.03 ± 0.18 ab
GG
47.30 ± 0.27 a
 
0.009
A258GEN at 221–250 dAA
16.00 ± 0.19 a
AG
14.82 ± 0.63 b
GG
14.60 ± 1.53 b
 
0.016
C276GEN at 281–310 dCC
13.01 ± 0.24
CG
12.67 ± 0.29
GG
13.60 ± 0.93
 
0.050
C1431AEN at 191–220 dCC
16.49 ± 0.21 b
CA
17.61 ± 0.39 a
AA
 
0.012
ab Means with different superscripts within the same row differ significantly. p < 0.05: statistically significant, EW: Egg weight, EN: Egg number.
Table 8. Association of haplotypes of the HSP70 polymorphisms with egg production traits in Hilly chicken.
Table 8. Association of haplotypes of the HSP70 polymorphisms with egg production traits in Hilly chicken.
HaplotypesTraits (Mean ± SE)
ASMEW at ASMEW at 40 wkBW at ASMEN
130–160 d
EN
161–190 d
EN
191–220 d
H1(GAACC)160.71 ± 1.61 ab25.85 ± 0.52 b46.812 ± 0.16 ab1728.52 ± 24.49 b2.00 ± 0.74 b15.91 ± 0.54 b16.03 ± 0.39 b
H2(GAACA)156.75 ± 4.68 ab26.00 ± 0.74 ab45.915 ± 0.46 b1543.75 ± 77.24 a4.50 ± 2.15 ab17.25 ± 1.58 ab18.75 ± 1.13 a
H3(GAGGC)157.00 ± 5.41 ab26.62 ± 0.52 ab46.356 ± 0.33 b1648.25 ± 54.62 ab4.25 ± 1.53 ab16.25 ± 1.12 ab16.75 ± 0.80 ab
H7(GGACC)161.44 ± 3.12 ab27.00 ± 0.49 a47.342 ± 0.31 a1839.55 ± 51.49 c4.33 ± 1.44 ab14.66 ± 1.05 ab16.44 ± 0.75 ab
H8(GAGGA)165.28 ± 3.54 b25.85 ± 0.55 ab46.526 ± 0.35 ab1688.85 ± 58.39 abc1.71 ± 1.63 ab15.57 ± 1.19 ab17.57 ± 0.86 ab
H9(GAGCC)158.88 ± 3.12 ab26.33 ± 0.49 ab46.399 ± 0.31 b1778.88 ± 51.49 c2.66 ± 1.43 ab17.22 ± 1.05 ab17.11 ± 0.75 ab
H10(GGGCC)159.25 ± 4.68 ab26.75 ± 0.74 ab47.125 ± 0.46 ab1711.25 ± 77.24 abc2.75 ± 2.15 ab16.75 ± 1.58 ab16.75 ± 1.13 ab
H11(GGGCA)153.25 ± 4.68 a27.00 ± 0.73 ab46.853 ± 0.46 ab1685.25 ± 77.24 abc7.00 ± 2.16 a18.25 ± 1.58 a18.25 ± 1.13 ab
abc Means with different superscripts within a column differ significantly (p < 0.05). ASM: Age at sexual maturity, EW: Egg weight (g), BW: Body weight (g), EN: Egg number/bird/month, WK: Week.
Table 9. Genotypic and allelic frequencies with Hardy–Weinberg equilibrium (HWE) test at the SNP locus of HSF3 gene.
Table 9. Genotypic and allelic frequencies with Hardy–Weinberg equilibrium (HWE) test at the SNP locus of HSF3 gene.
SNPsGenotype FrequencyAllele Frequencyχ2 (HWE)p-Value
A-1388GAAAGGGAG
0.94(141)0.06(9)0.970.030.143p > 0.05
A-1703GAAAGGGAG
0.91(136)0.09(14)0.960.046.88p < 0.01
SNP: Single nucleotide polymorphism, p < 0.05: statistically significant using Pearson’s χ2 test, p > 0.05: Non-significant, HWE: Hardy–Weinberg equilibrium.
Table 10. Association of polymorphisms in HSF3 gene with egg production traits.
Table 10. Association of polymorphisms in HSF3 gene with egg production traits.
SNPsTraits (p Value of Significant Test)
ASM
(Days)
BW at ASM(g)EW at ASM(g)EW at 40 wk(g)EN
130–160 d
EN
161–190 d
EN
191–220 d
EN
221–250 d
EN
251–280 d
EN
281–310 d
A-1388G0.0710.9480.6790.4500.0370.8030.0830.9130.0130.200
A-1703G0.3630.4840.4060.5100.7310.5720.3420.5690.5980.818
Significant: p < 0.05, ASM: Age at sexual maturity, EW: Egg weight, EN: Egg number, WK: Week.
Table 11. Effects of SNPs in HSF3 gene on egg production.
Table 11. Effects of SNPs in HSF3 gene on egg production.
SNPsTraitsGenotypes (Mean ± SE)p Value
A-1388G AAAG
EN at 130–160 d
EN at 251–280 d
2.85 ± 0.36 a
11.04 ± 0.25 a
5.55 ± 1.22 b
8.82 ± 0.84 b

0.037
0.013
ab Means with different superscripts within the same row differ significantly (p < 0.05), EN: Egg number.
Table 12. Association of haplotypes in HSF3 gene with egg production traits in Hilly chicken.
Table 12. Association of haplotypes in HSF3 gene with egg production traits in Hilly chicken.
HaplotypesTraits (Mean ± SE)
ASMEW at ASMEW at 40 WKBW at ASMEN
130–160 d
EN
161–190 d
EN
251–280 d
H1(AA)159.95 ± 0.76 b26.14 ± 0.1446.77 ± 0.081746.38 ± 14.542.76 ± 0.35 b16.48 ± 0.2711.03 ± 0.25 a
H2(AG)155.44 ± 1.78 a25.96 ± 0.3346.85 ± 0.181704.08 ± 34.184.60 ± 0.82 a16.61 ± 0.649.52 ± 0.59 b
ab Means within a column with different superscripts differ significantly (p < 0.05). ASM: Age at sexual maturity, EW: Egg weight (g), BW: Body weight (g), EN: Egg number/bird/month, WK: Week.
Table 13. Combined genotypic effects of two SNPs (G-399A in HSP70 gene and A-1388G in HSF3 gene) on productive and reproductive performances.
Table 13. Combined genotypic effects of two SNPs (G-399A in HSP70 gene and A-1388G in HSF3 gene) on productive and reproductive performances.
ParameterGenotype (Mean ± SE)p Value
Wild × Wild (GG × AA)
0.84 (120)
Wild × Het (GG × AG)
0.06 (9)
Het × Wild (AG × AA)
0.08 (11)
Mut × Wild (AA × AA)
0.01 (2)
ASM (d)160.08 ± 0.79 b154.11 ± 2.90 a156.0 ± 2.63 ab157.0 ± 6.16 ab0.05
EW at ASM (g)26.16 ± 0.1525.56 ± 0.5325.91 ± 0.4827.0 ± 1.130.28
BW at ASM (g)1748.71 ± 14.111730.89 ± 51.511672.91 ± 46.601715.0 ± 109.270.74
BW at 40 Wks2047.77 ± 24.65 a1947.78 ± 90.0 ab1838.73 ± 81.41 b2260.5 ± 190.92 a0.02
EW at 40 Wks46.78 ± 0.0846.39 ± 0.3046.95 ± 0.2846.72 ± 0.650.23
EN at 130–160 d2.71 ± 0.36 b6.11 ± 1.33 a3.64 ± 1.20 ab3.49 ± 2.82 ab0.02
EN at 161–190 d16.26 ± 0.28 b16.89 ± 1.02 ab18.91 ± 0.92 a16.50 ± 2.16 ab0.01
EN at 191–220 d16.85 ± 0.2015.44 ± 0.7316.45 ± 0.6618.5 ± 1.550.07
EN at 221–250 d15.13 ± 0.1915.0 ± 0.7114.91 ± 0.6412.50 ± 1.510.86
EN at 251–280 d11.14 ± 0.25 a8.56 ± 0.92 b10.18 ± 0.84 ab12.5 ± 1.96 ab0.01
EN at 281–310 d13.0 ± 0.1913.67 ± 0.6911.91 ± 0.6313.0 ± 1.480.36
ab Means with different superscripts within the same row differ significantly, Significant: p < 0.05, Non-significant: p > 0.05, Het: Heterozygous, Mut: Mutant, ASM: age at sexual maturity, EN: egg number/month, EW: egg weight, BW: body weight, Wks: weeks, HW: hatched weight.
Table 14. Combined genotypic effects of A-68G SNP in HSP70 gene and A-1388G SNP in HSF3 gene on productive performance.
Table 14. Combined genotypic effects of A-68G SNP in HSP70 gene and A-1388G SNP in HSF3 gene on productive performance.
ParameterCombined Genotypes (Mean ± SE)p Value
Wild × Wild (AA × AA)
0.62 (65)
Wild × Het (AA × AG)
0.07 (7)
Het × Wild (AG × AA)
0.22 (23)
Mut × Wild (GG × AA)
0.09 (10)
ASM (d)160.56 ± 1.11156.42 ± 3.29160.18 ± 1.86164.0 ± 2.760.37
EW at ASM (g)26.27 ± 0.18 b25.85 ± 0.56 b26.09 ± 0.31 b27.4 ± 0.47 a0.03
BW at ASM (g)1731.06 ± 20.811757.85 ± 61.921763.36 ± 34.931834.1 ± 51.810.31
BW at 40 Wks (g)2008.54 ± 33.732075.0 ± 100.382027.14 ± 56.622093.5 ± 83.980.77
EW at 40 Wks (g)46.56 ± 0.12 b46.49 ± 0.34 ab47.07 ± 0.19 a47.33 ± 0.29 a0.03
EN at 130 to 160 d2.17 ± 0.484.43 ± 1.423.0 ± 0.802.1 ± 1.190.43
EN at 161 to 190 d16.45 ± 0.4216.86 ± 1.2616.27 ± 0.7114.9 ± 1.050.55
EN at 191 to 220 d16.66 ± 0.2816.43 ± 0.8416.95 ± 0.4816.5 ± 0.700.92
EN at 221 to 250 d15.05 ± 0.2815.0 ± 0.8415.36 ± 0.4714.7 ± 0.700.88
EN at 251 to 280 d11.56 ± 0.37 a8.57 ± 1.09 b10.32 ± 0.62 ab10.5 ± 0.92 ab0.01
EN at 281 to 310 d13.08 ± 0.23 b14.57 ± 0.69 a12.45 ± 0.39 b12.9 ± 0.58 ab0.04
ab Means with different superscripts within the same row differ significantly, Significant: p < 0.05, Non-significant: p > 0.05, Het: Heterozygous, Mut: Mutant, ASM: age at sexual maturity, EN: egg number/month, EW: egg weight, BW: body weight, Wks: weeks, HW: hatched weight.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ali, M.Y.; Faruque, S.; Ahmadi, S.; Ohkubo, T. Genetic Analysis of HSP70 and HSF3 Polymorphisms and Their Associations with the Egg Production Traits of Bangladeshi Hilly Chickens. Animals 2024, 14, 3552. https://doi.org/10.3390/ani14243552

AMA Style

Ali MY, Faruque S, Ahmadi S, Ohkubo T. Genetic Analysis of HSP70 and HSF3 Polymorphisms and Their Associations with the Egg Production Traits of Bangladeshi Hilly Chickens. Animals. 2024; 14(24):3552. https://doi.org/10.3390/ani14243552

Chicago/Turabian Style

Ali, Md Yousuf, Shakila Faruque, Sadequllah Ahmadi, and Takeshi Ohkubo. 2024. "Genetic Analysis of HSP70 and HSF3 Polymorphisms and Their Associations with the Egg Production Traits of Bangladeshi Hilly Chickens" Animals 14, no. 24: 3552. https://doi.org/10.3390/ani14243552

APA Style

Ali, M. Y., Faruque, S., Ahmadi, S., & Ohkubo, T. (2024). Genetic Analysis of HSP70 and HSF3 Polymorphisms and Their Associations with the Egg Production Traits of Bangladeshi Hilly Chickens. Animals, 14(24), 3552. https://doi.org/10.3390/ani14243552

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop