A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reference Strains
2.2. Clinical Samples
2.3. Primers and Probes
2.4. Total Nucleic Acid
2.5. Standard Plasmid Constructs
2.6. Optimal Reaction Parameters
2.7. Standard Curves
2.8. Analytical Specificity
2.9. Analytical Sensitivity
2.10. Reproducibility Analysis
2.11. Test of the Clinical Specimens
3. Results
3.1. Construction of the Standard Plasmids
3.2. Determination of the Optimal Parameters
3.3. Generation of the Standard Curves
3.4. Specificity Analysis
3.5. Sensitivity Analysis
3.6. Reproducibility
3.7. Assessment of Clinical Specimens
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, Z.; Chen, W.; Qiu, Z.; Li, Y.; Fan, J.; Wu, K.; Li, X.; Zhao, M.; Ding, H.; Fan, S.; et al. African Swine Fever Virus: A Review. Life 2022, 12, 1255. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Zhang, X.; Qi, W.; Yang, Y.; Liu, Z.; An, T.; Wu, X.; Chen, J. Prevention and Control Strategies of African Swine Fever and Progress on Pig Farm Repopulation in China. Viruses 2021, 13, 2552. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and Virulence in Pigs of the First African Swine Fever Virus Isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef]
- Yu, L.; Zhu, Z.; Deng, J.; Tian, K.; Li, X. Antagonisms of ASFV towards Host Defense Mechanisms: Knowledge Gaps in Viral Immune Evasion and Pathogenesis. Viruses 2023, 15, 574. [Google Scholar] [CrossRef] [PubMed]
- Salguero, F.J. Comparative Pathology and Pathogenesis of African Swine Fever Infection in Swine. Front. Vet. Sci. 2020, 7, 282. [Google Scholar] [CrossRef] [PubMed]
- Penrith, M.L.; Van Heerden, J.; Heath, L.; Abworo, E.O.; Bastos, A.D.S. Review of the Pig-Adapted African Swine Fever Viruses in and Outside Africa. Pathogens 2022, 11, 1190. [Google Scholar] [CrossRef]
- Zhao, K.; Shi, K.; Zhou, Q.; Xiong, C.; Mo, S.; Zhou, H.; Long, F.; Wei, H.; Hu, L.; Mo, M. The Development of a Multiplex Real-Time Quantitative PCR Assay for the Differential Detection of the Wild-Type Strain and the MGF505-2R, EP402R and I177L Gene-Deleted Strain of the African Swine Fever Virus. Animals 2022, 12, 1754. [Google Scholar] [CrossRef]
- Qian, X.; Hu, L.; Shi, K.; Wei, H.; Shi, Y.; Hu, X.; Zhou, Q.; Feng, S.; Long, F.; Mo, S.; et al. Development of a Triplex Real-Time Quantitative PCR for Detection and Differentiation of Genotypes I and II African Swine Fever Virus. Front. Vet. Sci. 2023, 10, 1278714. [Google Scholar] [CrossRef]
- EFSA Panel on Animal Health and Welfare (AHAW); Nielsen, S.S.; Alvarez, J.; Bicout, D.J.; Calistri, P.; Canali, E.; Drewe, J.A.; Garin-Bastuji, B.; Gonzales Rojas, J.L.; Gortázar Schmidt, C.; et al. Assessment of the Control Measures of the Category A Diseases of Animal Health Law: Classical Swine Fever. EFSA J. 2021, 19, e06707. [Google Scholar] [CrossRef]
- Guo, X.; Zhang, M.; Liu, X.; Zhang, Y.; Wang, C.; Guo, Y. Attachment, Entry, and Intracellular Trafficking of Classical Swine Fever Virus. Viruses 2023, 15, 1870. [Google Scholar] [CrossRef]
- Luo, Y.; Li, S.; Sun, Y.; Qiu, H.J. Classical Swine Fever in China: A Minireview. Vet. Microbiol. 2014, 172, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Ganges, L. Classical Swine Fever Virus: The Past, Present and Future. Virus Res. 2020, 289, 198151. [Google Scholar] [CrossRef]
- Fan, J.; Liao, Y.; Zhang, M.; Liu, C.; Li, Z.; Li, Y.; Li, X.; Wu, K.; Yi, L.; Ding, H.; et al. Anti-Classical Swine Fever Virus Strategies. Microorganisms 2021, 9, 761. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, B.; Niu, X.; Chen, W.; Li, Y.; Wu, K.; Li, X.; Ding, H.; Zhao, M.; Chen, J.; et al. The Development of Classical Swine Fever Marker Vaccines in Recent Years. Vaccines 2022, 10, 603. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Feng, S.; Shi, K.; Shi, Y.; Yin, Y.; Long, F.; Wei, X.; Li, Z. Development of A Quadruplex Real-Time Quantitative RT-PCR for Detection and Differentiation of PHEV, PRV, CSFV, and JEV. Front. Vet. Sci. 2023, 10, 1276505. [Google Scholar] [CrossRef]
- Neumann, E.J.; Kliebenstein, J.B.; Johnson, C.D.; Mabry, J.W.; Bush, E.J.; Seitzinger, A.H.; Green, A.L.; Zimmerman, J.J. Assessment of the Economic Impact of Porcine Reproductive and Respiratory Syndrome on Swine Production in the United States. J. Am. Vet. Med. Assoc. 2005, 227, 385–392. [Google Scholar] [CrossRef]
- Zhou, L.; Han, J.; Yang, H. The Evolution and Diversity of Porcine Reproductive and Respiratory Syndrome Virus in China. Vet. Microbiol. 2024, 298, 110252. [Google Scholar] [CrossRef]
- Ruedas-Torres, I.; Rodríguez-Gómez, I.M.; Sánchez-Carvajal, J.M.; Larenas-Muñoz, F.; Pallarés, F.J.; Carrasco, L.; Gómez-Laguna, J. The Jigsaw of PRRSV Virulence. Vet. Microbiol. 2021, 260, 109168. [Google Scholar] [CrossRef]
- Brinton, M.A.; Gulyaeva, A.A.; Balasuriya, U.B.R.; Dunowska, M.; Faaberg, K.S.; Goldberg, T.; Leung, F.C.C.; Nauwynck, H.J.; Snijder, E.J.; Stadejek, T.; et al. ICTV Virus Taxonomy Profile: Arteriviridae 2021. J. Gen. Virol. 2021, 102, 001632. [Google Scholar] [CrossRef]
- Sun, Q.; Xu, H.; An, T.; Cai, X.; Tian, Z.; Zhang, H. Recent Progress in Studies of Porcine Reproductive and Respiratory Syndrome Virus 1 in China. Viruses 2023, 15, 1528. [Google Scholar] [CrossRef]
- Li, C.; Zhao, J.; Li, W.; Xu, H.; Gong, B.; Sun, Q.; Guo, Z.; Li, J.; Xiang, L.; Tang, Y.; et al. Prevalence and Genetic Evolution of Porcine Reproductive and Respiratory Syndrome Virus in Commercial Fattening Pig Farms in China. Porc. Health Manag. 2024, 10, 5. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Qiao, S.; Li, R.; Wang, J.; Li, X.; Zhang, G. Evasion Strategies of Porcine Reproductive and Respiratory Syndrome Virus. Front. Microbiol. 2023, 14, 1140449. [Google Scholar] [CrossRef] [PubMed]
- Bo, Z.; Li, X. A Review of Pseudorabies Virus Variants: Genomics, Vaccination, Transmission, and Zoonotic Potential. Viruses 2022, 14, 1003. [Google Scholar] [CrossRef]
- Tan, L. Current Status and Challenge of Pseudorabies Virus Infection in China. Virol. Sin. 2021, 36, 588–607. [Google Scholar] [CrossRef] [PubMed]
- Freuling, C.M.; Hlinak, A.; Schulze, C.; Sehl-Ewert, J.; Wysocki, P.; Szentiks, C.A.; Schmitt, K.; Wohlsein, P.; Kluth, G.; Reinhardt, I.; et al. Suid Alphaherpesvirus 1 of Wild Boar Origin as a Recent Source of Aujeszky’s Disease in Carnivores in Germany. Virol. J. 2023, 20, 110. [Google Scholar] [CrossRef]
- Zheng, H.H.; Fu, P.F.; Chen, H.Y.; Wang, Z.Y. Pseudorabies Virus: From Pathogenesis to Prevention Strategies. Viruses 2022, 14, 1638. [Google Scholar] [CrossRef]
- Liu, Q.; Wang, X.; Xie, C.; Ding, S.; Yang, H.; Guo, S.; Li, J.; Qin, L.; Ban, F.; Wang, D.; et al. A Novel Human Acute Encephalitis Caused by Pseudorabies Virus Variant Strain. Clin. Infect. Dis. 2021, 73, e3690–e3700. [Google Scholar] [CrossRef]
- Liu, Q.; Kuang, Y.; Li, Y.; Guo, H.; Zhou, C.; Guo, S.; Tan, C.; Wu, B.; Chen, H.; Wang, X. The Epidemiology and Variation in Pseudorabies Virus: A Continuing Challenge to Pigs and Humans. Viruses 2022, 14, 1463. [Google Scholar] [CrossRef]
- Hou, Y.; Wang, Y.; Zhang, Y.; Yu, H.; Zhao, Y.; Yi, A. Human Encephalitis Caused by Pseudorabies Virus in China: A Case Report and Systematic Review. Vector Borne Zoonotic Dis. 2022, 22, 391–396. [Google Scholar] [CrossRef]
- Zhao, P.; Wang, Y.; Zhang, P.; Du, F.; Li, J.; Wang, C.; Fang, R.; Zhao, J. Epidemiological Investigation, Risk Factors, Spatial-Temporal Cluster, and Epidemic Trend Analysis of Pseudorabies Virus Seroprevalence in China (2017 to 2021). Microbiol. Spectr. 2023, 11, e05297-22. [Google Scholar] [CrossRef]
- Zhang, H.; Yan, Z.; Wang, X.; Gaňová, M.; Chang, H.; Laššáková, S.; Korabecna, M.; Neuzil, P. Determination of Advantages and Limitations of qPCR Duplexing in a Single Fluorescent Channel. ACS Omega 2021, 6, 22292–22300. [Google Scholar] [CrossRef] [PubMed]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Xia, H.; Everett, H.; Sosan, O.; Crooke, H.; Meindl-Böhmer, A.; Qiu, H.J.; Moennig, V.; Belák, S.; Widén, F. A Generic Real-Time TaqMan Assay for Specific Detection of Lapinized Chinese Vaccines against Classical Swine Fever. J. Virol. Methods 2011, 175, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Cheng, T.Y.; Henao-Diaz, A.; Poonsuk, K.; Buckley, A.; Van Geelen, A.; Lager, K.; Harmon, K.; Gauger, P.; Wang, C.; Ambagala, A.; et al. Pseudorabies (Aujeszky’s Disease) Virus DNA Detection in Swine Nasal Swab and Oral Fluid Specimens Using a gB-Based Real-Time Quantitative PCR. Prev. Vet. Med. 2021, 189, 105308. [Google Scholar] [CrossRef] [PubMed]
- Pan, J.; Zeng, M.; Zhao, M.; Huang, L. Research Progress on the Detection Methods of Porcine Reproductive and Respiratory Syndrome Virus. Front. Microbiol. 2023, 14, 1097905. [Google Scholar] [CrossRef]
- Hwang, H.J.; Choi, Y.S.; Song, K.; Frant, M.; Kim, J.H. Development and Validation of a Fast Quantitative Real-Time PCR Assay for the Detection of African Swine Fever Virus. Front. Vet. Sci. 2023, 9, 1037728. [Google Scholar] [CrossRef]
- Chen, Y.; Shi, K.; Liu, H.; Yin, Y.; Zhao, J.; Long, F.; Lu, W.; Si, H. Development of a Multiplex qRT-PCR Assay for Detection of African Swine Fever Virus, Classical Swine Fever Virus and Porcine Reproductive and Respiratory Syndrome Virus. J. Vet. Sci. 2021, 22, e87. [Google Scholar] [CrossRef]
- Zhao, L.; Wen, X.H.; Jia, C.L.; Zhou, X.R.; Luo, S.J.; Lv, D.H.; Zhai, Q. Development of a Multiplex qRT-PCR Assay for Detection of Classical Swine Fever Virus, African Swine Fever Virus, and Erysipelothrix Rhusiopathiae. Front. Vet. Sci. 2023, 10, 1183360. [Google Scholar] [CrossRef]
- Ma, Y.; Shi, K.; Chen, Z.; Shi, Y.; Zhou, Q.; Mo, S.; Wei, H.; Hu, L.; Mo, M. Simultaneous Detection of Porcine Respiratory Coronavirus, Porcine Reproductive and Respiratory Syndrome Virus, Swine Influenza Virus, and Pseudorabies Virus via Quadruplex One-Step RT-qPCR. Pathogens 2024, 13, 341. [Google Scholar] [CrossRef]
- Zhang, H.; Zhao, S.; Zhang, H.; Qin, Z.; Shan, H.; Cai, X. Vaccines for African Swine Fever: An Update. Front. Microbiol. 2023, 14, 1139494. [Google Scholar] [CrossRef]
- Forth, J.H.; Calvelage, S.; Fischer, M.; Hellert, J.; Sehl-Ewert, J.; Roszyk, H.; Deutschmann, P.; Reichold, A.; Lange, M.; Thulke, H.H.; et al. African Swine Fever Virus—Variants on the Rise. Emerg. Microbes Infect. 2023, 12, 2146537. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.; Sun, E.; Huang, L.; Ding, L.; Zhu, Y.; Zhang, J.; Shen, D.; Zhang, X.; Zhang, Z.; Ren, T.; et al. Highly Lethal Genotype I and II Recombinant African Swine Fever Viruses Detected in Pigs. Nat. Commun. 2023, 14, 3096. [Google Scholar] [CrossRef] [PubMed]
- An, T.; Zhou, Y.; Liu, G.; Tian, Z.; Li, J.; Qiu, H.; Tong, G. Genetic Diversity and Phylogenetic Analysis of Glycoprotein 5 of PRRSV Isolates in Mainland China from 1996 to 2006: Coexistence of Two NA-Subgenotypes with Great Diversity. Vet. Microbiol. 2007, 123, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Chen, N.; Xiao, Y.; Ye, M.; Li, X.; Li, S.; Xie, N.; Wei, Y.; Wang, J.; Zhu, J. High Genetic Diversity of Chinese Porcine Reproductive and Respiratory Syndrome Viruses from 2016 to 2019. Res. Vet. Sci. 2020, 131, 38–42. [Google Scholar] [CrossRef]
- Li, C.; Fan, A.; Liu, Z.; Wang, G.; Zhou, L.; Zhang, H.; Huang, L.; Zhang, J.; Zhang, Z.; Zhang, Y. Prevalence, Time of Infection, and Diversity of Porcine Reproductive and Respiratory Syndrome Virus in China. Viruses 2024, 16, 774. [Google Scholar] [CrossRef]
- Yu, Y.; Zhang, Q.; Cao, Z.; Tang, Y.D.; Xia, D.; Wang, G.; Shan, H. Recent Advances in Porcine Reproductive and Respiratory Syndrome Virus NADC30-like Research in China: Molecular Characterization, Pathogenicity, and Control. Front. Microbiol. 2022, 12, 791313. [Google Scholar] [CrossRef]
- Zhao, J.; Xu, L.; Xu, Z.; Deng, H.; Li, F.; Sun, X.; Zhou, Y.; Zhu, L. Emergence and Spread of NADC34-like PRRSV in Southwest China. Transbound. Emerg. Dis. 2022, 69, e3416–e3424. [Google Scholar] [CrossRef]
- Zhang, H.; Luo, Q.; He, Y.; Zheng, Y.; Sha, H.; Li, G.; Kong, W.; Liao, J.; Zhao, M. Research Progress on the Development of Porcine Reproductive and Respiratory Syndrome Vaccines. Vet. Sci. 2023, 10, 491. [Google Scholar] [CrossRef]
- Li, J.; Miller, L.C.; Sang, Y. Current Status of Vaccines for Porcine Reproductive and Respiratory Syndrome: Interferon Response, Immunological Overview, and Future Prospects. Vaccines 2024, 12, 606. [Google Scholar] [CrossRef]
- Yao, J.; Li, J.; Gao, L.; He, Y.; Xie, J.; Zhu, P.; Zhang, Y.; Zhang, X.; Duan, L.; Yang, S.; et al. Epidemiological Investigation and Genetic Analysis of Pseudorabies Virus in Yunnan Province of China from 2017 to 2021. Viruses 2022, 14, 895. [Google Scholar] [CrossRef]
- Lin, Y.; Tan, L.; Wang, C.; He, S.; Fang, L.; Wang, Z.; Zhong, Y.; Zhang, K.; Liu, D.; Yang, Q.; et al. Serological Investigation and Genetic Characteristics of Pseudorabies Virus in Hunan Province of China From 2016 to 2020. Front. Vet. Sci. 2021, 8, 762326. [Google Scholar] [CrossRef] [PubMed]
- Sun, E.; Zhang, Z.; Wang, Z.; He, X.; Zhang, X.; Wang, L.; Wang, W.; Huang, L.; Xi, F.; Huangfu, H.; et al. Emergence and Prevalence of Naturally Occurring Lower Virulent African Swine Fever Viruses in Domestic Pigs in China in 2020. Sci. China Life Sci. 2021, 64, 752–765. [Google Scholar] [CrossRef] [PubMed]
- Sun, E.; Huang, L.; Zhang, X.; Zhang, J.; Shen, D.; Zhang, Z.; Wang, Z.; Huo, H.; Wang, W.; Huangfu, H.; et al. Genotype I African Swine Fever Viruses Emerged in Domestic Pigs in China and Caused Chronic Infection. Emerg. Microbes Infect. 2021, 10, 2183–2193. [Google Scholar] [CrossRef] [PubMed]
- Tang, Q.; Ge, L.; Tan, S.; Zhang, H.; Yang, Y.; Zhang, L.; Deng, Z. Epidemiological Survey of Four Reproductive Disorder Associated Viruses of Sows in Hunan Province during 2019–2021. Vet. Sci. 2022, 9, 425. [Google Scholar] [CrossRef]
- Coronado, L.; Perera, C.L.; Rios, L.; Frías, M.T.; Pérez, L.J. A Critical Review about Different Vaccines against Classical Swine Fever Virus and Their Repercussions in Endemic Regions. Vaccines 2021, 9, 154. [Google Scholar] [CrossRef]
- Postel, A.; Nishi, T.; Kameyama, K.; Meyer, D.; Suckstorff, O.; Fukai, K.; Becher, P. Reemergence of Classical Swine Fever, Japan, 2018. Emerg. Infect. Dis. 2019, 25, 1228–1231. [Google Scholar] [CrossRef]
- Fang, K.; Liu, S.; Li, X.; Chen, H.; Qian, P. Epidemiological and Genetic Characteristics of Porcine Reproductive and Respiratory Syndrome Virus in South China Between 2017 and 2021. Front. Vet. Sci. 2022, 9, 853044. [Google Scholar] [CrossRef]




| Virus | Gene | Primer/Probe | Sequence (5′ → 3′) | Product (bp) |
|---|---|---|---|---|
| ASFV-F ASFV-R ASFV-P | CAAAGTTCTGCAGCTCTTACA | |||
| ASFV | B646L (p72) | TGGGTTGGTATTCCTCCCGT | 120 | |
| FAM-TCCGGGYGCGATGATGATTACCTT-BHQ1 | ||||
| CSFV-F CSFV-R CSFV-P | TAGTGGCGAGCTCCCTGGGTG | |||
| CSFV | 5′UTR | GGTTAAGGTGTGTCTTGGGCAT | 124 | |
| VIC-AGTACAGGACAGTCGTCAGTAGTTCGACGT-BHQ1 | ||||
| PRRSV-F PRRSV-R PRRSV-P | TTCATCACYTCCAGATGC | |||
| PRRSV | ORF6 | GCCRCCCAACACGAGGC | 195 | |
| CY5-TACATTCTGGCCCCTGCCCACC-BHQ2 | ||||
| PRV-F PRV-R PRV-P | GAGGCCCTGGAAGAAGTT | |||
| PRV | gB | TCCTGGACTACAGCGAGAT | 131 | |
| Texas red-ATGCCGCGCAGCAGCACCAC-BHQ2 |
| Reagent | Volume (μL) | Final Concentration (nM) |
|---|---|---|
| 2× One-Step RT-PCR Buffer | 10.0 | / |
| Ex Taq HS (5 U/μL) | 0.4 | / |
| PrimerScript RT Enzyme Mix | 0.4 | / |
| ASFV-F (20 pmol/μL) | 0.2 | 200 |
| ASFV-R (20 pmol/μL) | 0.2 | 200 |
| ASFV-P (20 pmol/μL) | 0.2 | 200 |
| CSFV-F (20 pmol/μL) | 0.4 | 400 |
| CSFV-R (20 pmol/μL) | 0.4 | 400 |
| CSFV-P (20 pmol/μL) | 0.3 | 300 |
| PRRSV-F (20 pmol/μL) | 0.2 | 200 |
| PRRSV-R (20 pmol/μL) | 0.2 | 200 |
| PRRSV-P (20 pmol/μL) | 0.2 | 200 |
| PRV-F (20 pmol/μL) | 0.4 | 400 |
| PRV-R (20 pmol/μL) | 0.4 | 400 |
| PRV-P (20 pmol/μL) | 0.4 | 400 |
| Nucleic Acid Template | 2.0 | / |
| Nuclease-Free Water | 3.5 | / |
| Plasmid | Concentration (Copies/Reaction) | Number of Samples | Quadruplex RT-qPCR | |
|---|---|---|---|---|
| Ct (Average) | Hit Rate (%) | |||
| p-ASFV | 500 | 30 | 33.47 | 100 |
| 250 | 30 | 34.53 | 100 | |
| 125 | 30 | 35.79 | 90.00 | |
| 62.5 | 30 | ND | 0 | |
| p-CSFV | 500 | 30 | 33.81 | 100 |
| 250 | 30 | 35.00 | 100 | |
| 125 | 30 | 35.92 | 83.33 | |
| 62.5 | 30 | ND | 0 | |
| p-PRRSV | 500 | 30 | 33.72 | 100 |
| 250 | 30 | 35.07 | 100 | |
| 125 | 30 | 35.90 | 73.33 | |
| 62.5 | 30 | ND | 0 | |
| p-PRV | 500 | 30 | 33.59 | 100 |
| 250 | 30 | 34.66 | 100 | |
| 125 | 30 | 35.89 | 80.00 | |
| 62.5 | 30 | ND | 0 | |
| Plasmid | Concentration (Copies/μL) | Intra-Assay Ct Value | Inter-Assay Ct Value | ||||
|---|---|---|---|---|---|---|---|
| SD | CV (%) | SD | CV (%) | ||||
| p-ASFV | 107 | 15.579 | 0.038 | 0.25 | 15.552 | 0.147 | 0.95 |
| 105 | 21.189 | 0.03 | 0.14 | 21.185 | 0.187 | 0.88 | |
| 103 | 28.019 | 0.074 | 0.26 | 28.028 | 0.278 | 0.99 | |
| p-CSFV | 107 | 15.532 | 0.048 | 0.31 | 15.423 | 0.156 | 1.01 |
| 105 | 22.829 | 0.013 | 0.06 | 22.528 | 0.253 | 1.12 | |
| 103 | 28.174 | 0.13 | 0.46 | 28.106 | 0.247 | 0.88 | |
| p-PRRSV | 107 | 16.15 | 0.043 | 0.26 | 16.204 | 0.141 | 0.87 |
| 105 | 21.444 | 0.05 | 0.23 | 21.259 | 0.104 | 0.49 | |
| 103 | 28.541 | 0.047 | 0.17 | 28.579 | 0.120 | 0.42 | |
| p-PRV | 107 | 15.069 | 0.056 | 0.37 | 15.028 | 0.098 | 0.65 |
| 105 | 21.119 | 0.013 | 0.06 | 21.061 | 0.214 | 1.02 | |
| 103 | 27.945 | 0.042 | 0.15 | 27.967 | 0.247 | 0.88 | |
| City | Number | Number of Positive Specimen | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ASFV | CSFV | PRRSV | PRV | ASFV + CSFV + PRRSV | ASFV+ PRRSV + PRV | ASFV + CSFV | ASFV + PRRSV | ASFV + PRV | PRRSV + PRV | CSFV + PRRSV | ||
| Nanning | 357 | 1 | 2 | 49 | 6 | 0 | 0 | 0 | 1 | 0 | 1 | 0 |
| Guilin | 31 | 0 | 0 | 5 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Liuzhou | 370 | 101 | 8 | 46 | 5 | 0 | 0 | 1 | 6 | 1 | 0 | 4 |
| Beihai | 13 | 9 | 0 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Yulin | 561 | 149 | 8 | 107 | 21 | 1 | 2 | 1 | 23 | 3 | 5 | 2 |
| Wuzhou | 10 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Qinzhou | 10 | 0 | 1 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Baise | 588 | 1 | 5 | 40 | 5 | 0 | 0 | 0 | 0 | 0 | 2 | 0 |
| Hezhou | 72 | 1 | 2 | 23 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Guigang | 168 | 3 | 0 | 28 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hechi | 15 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Fangchenggang | 347 | 5 | 0 | 36 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Laibin | 80 | 5 | 0 | 8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Chongzuo | 494 | 63 | 0 | 114 | 2 | 0 | 0 | 0 | 5 | 0 | 0 | 0 |
| Total | 3116 | 338 | 25 | 465 | 43 | 1 | 2 | 2 | 35 | 4 | 8 | 6 |
| Positivity Rate (%) | 10.85% | 0.80% | 14.92% | 1.38% | 0.03% | 0.06% | 0.06% | 1.12% | 0.13% | 0.26% | 0.19% | |
| Source | Number | Number of Positive Specimen | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ASFV | CSFV | PRRSV | PRV | ASFV + CSFV + PRRSV | ASFV+ PRRSV + PRV | ASFV + CSFV | ASFV + PRRSV | ASFV + PRV | PRRSV + PRV | CSFV + PRRSV | ||
| Pig Farm | 369 | 2 | 6 | 49 | 11 | 0 | 0 | 1 | 4 | 0 | 1 | 1 |
| (0.54%) | (1.63%) | (13.28%) | (2.98%) | (0.27%) | (1.08%) | (0.27%) | (0.27%) | |||||
| Slaughterhouse | 1784 | 78 | 1 | 229 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| (4.37%) | (0.06%) | (12.84%) | (0.22%) | |||||||||
| Harmless Treatment Plant | 963 | 258 | 18 | 187 | 28 | 1 | 2 | 1 | 31 | 4 | 7 | 5 |
| (26.79%) | (1.87%) | (19.42%) | (2.91%) | (0.10%) | (0.21%) | (0.10%) | (3.22%) | (0.42%) | (0.73%) | (0.52%) | ||
| Total | 3116 | 338 | 25 | 465 | 43 | 1 | 2 | 2 | 35 | 4 | 8 | 6 |
| (10.85%) | (0.80%) | (14.92%) | (1.38%) | (0.03%) | (0.06%) | (0.06%) | (1.12%) | (0.13%) | (0.26%) | (0.19%) | ||
| The Established Quadruplex RT-qPCR | The Reference qPCR | Total | Diagnostic Sensitivity (95% CI) | Diagnostic Specificity (95% CI) | ||
|---|---|---|---|---|---|---|
| Positive | Negative | |||||
| ASFV | Positive | 330 | 8 | 338 | 99.10% (97.39–99.69%) | 99.71% (99.43–99.85%) |
| Negative | 3 | 2775 | 2778 | |||
| Total | 333 | 2783 | 3116 | |||
| CSFV | Positive | 23 | 2 | 25 | 95.83% (79.76–99.26%) | 99.94% (99.76–99.98%) |
| Negative | 1 | 3090 | 3091 | |||
| Total | 24 | 3092 | 3116 | |||
| PRRSV | Positive | 452 | 13 | 465 | 99.12% (97.77–99.66%) | 99.51% (99.17–99.71%) |
| Negative | 4 | 2647 | 2651 | |||
| Total | 456 | 2660 | 3116 | |||
| PRV | Positive | 39 | 4 | 43 | 97.50% (87.12–99.56%) | 99.87% (99.67–99.95%) |
| Negative | 1 | 3072 | 3073 | |||
| Total | 40 | 3076 | 3116 | |||
| Method | Number of Positive Sample | |||
|---|---|---|---|---|
| ASFV | CSFV | PRRSV | PRV | |
| The developed assay | 338/3116 (10.84%) | 25/3116 (0.80%) | 465/3116 (14.92%) | 43/3116 (1.38%) |
| The reference assay | 333/3116 (10.69%) | 24/3116 (0.77%) | 456/3116 (14.63%) | 40/3116 (1.28%) |
| Coincidence rate | 99.65% | 99.90% | 99.45% | 99.84% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feng, Z.; Shi, K.; Yin, Y.; Shi, Y.; Feng, S.; Long, F.; Wei, Z.; Si, H. A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus. Animals 2024, 14, 3551. https://doi.org/10.3390/ani14233551
Feng Z, Shi K, Yin Y, Shi Y, Feng S, Long F, Wei Z, Si H. A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus. Animals. 2024; 14(23):3551. https://doi.org/10.3390/ani14233551
Chicago/Turabian StyleFeng, Zhuo, Kaichuang Shi, Yanwen Yin, Yuwen Shi, Shuping Feng, Feng Long, Zuzhang Wei, and Hongbin Si. 2024. "A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus" Animals 14, no. 23: 3551. https://doi.org/10.3390/ani14233551
APA StyleFeng, Z., Shi, K., Yin, Y., Shi, Y., Feng, S., Long, F., Wei, Z., & Si, H. (2024). A Quadruplex RT-qPCR for the Detection of African Swine Fever Virus, Classical Swine Fever Virus, Porcine Reproductive and Respiratory Syndrome Virus, and Porcine Pseudorabies Virus. Animals, 14(23), 3551. https://doi.org/10.3390/ani14233551

