Gastrointestinal Parasites in Non-Human Primates in Zoological Gardens in Northern Italy
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Traditional Copromicroscopic Analyses
2.3. Molecular Analyses
| Primer F (5′-3′) | Primer R (5′-3′) | Amplicon Size (bp) | ||
|---|---|---|---|---|
| Cryptosporidium spp. [16] | ||||
| 18S | 1st round | C1F TTCTAGAGCTAATACATGCG | C1R CCC TAA TCT TTC GAA ACA GGA | 1325 |
| 2nd round | C2F GGAAGGGTTGTATTTATTAGATAAAG | C2R AAGGAGTAAGGAACAACCTCCA | 850 | |
| Giardia spp. [18,19] | ||||
| β-giardine | G7 AAGCCCGACGACCTCACCCGCAGTGC | G759 GAGGCCGCCCTGGATCTTCGAGACGAC | 753 | |
| βGiar-F GAACGAACGAGATCGAGGTCCG | βGiar-R CTCGACGAGCTTCGTGTT | 511 | ||
| TPI | F1 AAATIATGCCTGCTCGTCG | R1 CAAACCTTITCCGCAAACC | 605 | |
| F2 CCCTTCATCGGIGGTAACTT | R2 GTGGCCACCACICCCGTGCC | 530 | ||
| Blastocystis [21] | ||||
| 18S | RD5 ATCTGGTTGATCCTGCCAGT | BhRDr GAGCTTTTTAACTGCAACAACG | 600 | |
| Primer F (5′-3′) | Primer R (5′-3′) | Probe (FAM-5′- 3′-TAMRA) | |
|---|---|---|---|
| Giardia spp. [17] | |||
| 18S | Giardia F GACGGCTCAGGACAACGGTT | Giardia R TTGCCAGCGGTGTCCG- | CCCGCGGCGGTCCCTGCTAG |
| Blastocystis hominis [20] | |||
| 18S | Blasto FWD F5 | Blasto R F2 | Probe (FAM-5′-MGBNFQ) |
| GGTCCGGTGAACACTTTGGATTT | CCTACGGAAACCTTGTTACGACTTCA | TCGTGTAAATCTTACCATTTAGAGGA | |
2.4. Statistical Analyses
3. Results
3.1. Copromicroscopic Analyses
3.2. Molecular Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Xiao, L.; Fayer, R. Molecular characterization of species and genotypes of Cryptosporidium and Giardia and assessment of zoonotic transmission. Int. J. Parasitol. 2008, 38, 1239–1255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y. Cryptosporidium in wild placental mammals. Exp. Parasitol. 2010, 124, 128–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Kiulia, N.M.; Mwenda, J.M.; Nyachieo, A.; Taylor, M.B.; Zhang, X. Cyclospora papionis, Cryptosporidium hominis, and human-pathogenic Enterocytozoon bieneusi in captive baboons in Kenya. J. Clin. Microbiol. 2011, 49, 4326–4329. [Google Scholar] [CrossRef] [Scilit]
- Ye, J.; Xiao, L.; Ma, J.; Guo, M.; Liu, L.; Feng, Y. Anthroponotic Enteric Parasites in Monkeys in Public Park, China. Emerg. Infect. Dis. 2012, 18, 1640–1643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Ryan, U.M.; Xiao, L. Genetic Diversity and Population Structure of Cryptosporidium. Trends Parasitol. 2018, 34, 997–1011. [Google Scholar] [CrossRef] [Scilit]
- Ryan, U.; Cacciò, S.M. Zoonotic potential of Giardia. Int. J. Parasitol. 2013, 43, 943–956. [Google Scholar] [CrossRef] [Scilit]
- Johnston, A.R.; Gillespie, T.R.; Rwego, I.B.; McLachlan, T.L.; Kent, A.D.; Goldberg, T.L. Molecular epidemiology of cross-species Giardia duodenalis transmission in western Uganda. PLoS Negl. Trop. Dis. 2010, 11, e683. [Google Scholar] [CrossRef] [Scilit]
- Sprong, H.; Cacciò, S.M.; van der Giessen, J.W.B.; ZOOPNET Network and Partners. Identification of Zoonotic Genotypes of Giardia duodenalis. PLoS Negl. Trop. Dis. 2009, 3, e558. [Google Scholar] [CrossRef] [Scilit]
- Levecke, B.; Geldhof, P.; Claerebout, E.; Dorny, P.; Vercammen, F.; Cacciò, S.M.; Vercruysse, J.; Geurden, T. Molecular characterisation of Giardia duodenalis in captive non-human primates reveals mixed assemblage A and B infections and novel polymorphisms. Int. J. Parasitol. 2009, 39, 1595–1601. [Google Scholar] [CrossRef] [Scilit]
- Brynildsrud, O.; Tysnes, K.R.; Robertson, L.J.; Debenham, J.J. Giardia duodenalis in primates: Classification and host specificity based on phylogenetic analysis of sequence data. Zoonoses Public Health 2018, 65, 637–647. [Google Scholar] [CrossRef] [Scilit]
- Hublin, J.S.Y.; Maloney, J.G.; Santin, M. Blastocystis in domesticated and wild mammals and birds. Res. Vet. Sci. 2021, 135, 260–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilík, V.; Kreisinger, J.; Modrý, D.; Schwarz, E.M.; Tagg, N.; Mbohli, D.; Nkombou, I.C.; Petrželková, K.J.; Pafčo, B. High diversity and sharing of strongylid nematodes in humans and great apes co-habiting an unprotected area in Cameroon. PLoS. Negl. Trop. Dis. 2023, 17, e0011499. [Google Scholar] [CrossRef] [Scilit]
- Barda, B.D.; Rinaldi, L.; Ianniello, D.; Zepherine, H.; Salvo, F.; Sadutshang, T.; Cringoli, G.; Clementi, M.; Albonico, M. Mini-FLOTAC, an innovative direct diagnostic technique for intestinal parasitic infections: Experience from the field. PLoS Negl. Trop. Dis. 2013, 7, e2344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cassini, R.; Parraga, M.A.; Signorini, M.; Frangipane di Regalbono, A.; Sturaro, E.; Rossi, L.; Ramanzin, M. Lungworms in Alpine Ibex (Capra ibex) in the Eastern Alps, Italy: An ecological approach. Vet. Parasitol. 2015, 214, 132–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Modrý, D.; Pafčo, B.; Petrželková, K.J.; Hasegawa, H. Parasites of Apes an Atlas of Coproscopic Diagnostics; Edition Chimaira: Frankfurt am Main, Germany, 2018; pp. 96–196. [Google Scholar]
- Vonfeld, I.; Prenant, T.; Polack, B.; Guillot, J.; Quintard, B. Gastrointestinal parasites in non-human primates in zoological institutions in France. Parasite 2022, 29, 43. [Google Scholar] [CrossRef] [Scilit]
- Galuppi, R.; Piva, S.; Castagnetti, C.; Iacono, E.; Tanel, S.; Pallaver, F.; Fioravanti, M.L.; Zanoni, R.G.; Tampieri, M.P.; Caffara, M. Epidemiological survey on Cryptosporidium in an Equine Perinatology Unit. Vet. Parasitol. 2015, 210, 10–18. [Google Scholar] [CrossRef] [Scilit]
- Ortolani, E.L. Standardization of modified Ziehl-Neelsen technique to stain oocysts of Cryptosporidium sp. Rev. Bras. Parasitol. Vet. 2000, 9, 29–31. [Google Scholar]
- Miller, W.A.; Gardner, I.A.; Atwill, E.R.; Leutenegger, C.M.; Miller, M.A.; Hedrick, R.P.; Melli, A.C.; Barnes, N.M.; Conrad, P.A. Evaluation of methods for improved detection of Cryptosporidium spp. in mussels (Mytilus californianus). J. Microbiol. Meth. 2006, 65, 367–379. [Google Scholar] [CrossRef] [Scilit]
- Verweij, J.J.; Schinkel, J.; Laeijendecker, D.; van Rooyen, M.A.; van Lieshout, L.; Polderman, A.M. Real-time PCR for the detection of Giardia lamblia. Mol. Cell. Probes. 2003, 17, 223–225. [Google Scholar] [CrossRef] [Scilit]
- Lalle, M.; Jimenez-Cardosa, E.; Cacciò, S.M.; Pozio, E. Genotyping of Giardia duodenalis from humans and dogs from Mexico using a beta-giardin nested polymerase chain reaction assay. J. Parasitol. 2005, 91, 203–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sulaiman, I.M.; Fayer, R.; Bern, C.; Gilman, R.H.; Trout, J.M.; Schantz, P.M.; Das, P.; Lal, A.A.; Xiao, L. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg. Infect. Dis. 2003, 9, 1444–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stensvold, C.R.; Ahmed, U.N.; Andersen, L.O.; Nielsen, H.V. Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. J. Clin. Microbiol. 2012, 50, 1847–1851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scicluna, S.M.; Tawari, B.; Clark, C.G. DNA Barcoding of Blastocystis. Protist 2006, 157, 77–85. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 24, 3–124. [Google Scholar] [CrossRef] [Scilit]
- Almeida Lourenco, M.F. Survey of Gastrointestinal Parasites of Non-Human Primates from Two Iberian Zoos and Perspectives of Their Integrated Control. Ph.D. Thesis, University of Lisbon, Lisbon, Portugal, 2023; pp. 1–107. [Google Scholar]
- Fagiolini, M.; Lia, R.P.; Laricchiuta, P.; Cavicchio, P.; Mannella, R.; Cafarchia, C.; Otranto, D.; Finotello, R.; Perrucci, S. Gastrointestinal parasites in mammals of two Italian zoological gardens. J. Zoo. Wildl. Med. 2010, 41, 662–670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rushmore, J.; Bisanzio, D.; Gillespie, T.R. Making New Connections: Insights from Primate-Parasite Networks. Trends Parasitol. 2017, 33, 547–560. [Google Scholar] [CrossRef] [Scilit]
- Berrilli, F.; Prisco, C.; Friedrich, K.G.; Di Cerbo, P.; Di Cave, D.; De Liberato, C. Giardia duodenalis assemblages and Entamoeba species infecting non-human primates in an Italian zoological garden: Zoonotic potential and management traits. Parasit. Vectors. 2011, 4, 199. [Google Scholar] [CrossRef] [Scilit]
- Rondón, S.; Cavallero, S.; Montalbano Di Filippo, M.; De Liberato, C.; Berrilli, F.; Capitani, N.; D’Amelio, S. Intestinal parasites infecting captive non-human primates in Italy. Front. Vet. Sci. 2024, 8, 1270202. [Google Scholar] [CrossRef] [Scilit]
- Galoș, F.; Anghel, M.; Ioan, A.; Ieșanu, M.I.; Boboc, C.; Boboc, A.A. Hymenolepis diminuta Infection in a Romanian Child from an Urban Area. Pathogens 2022, 11, 322. [Google Scholar] [CrossRef] [Scilit]
- Yao, C. Human infections by the rat tapeworm Hymenolepis diminuta in China. Trans. R. Soc. Trop. Med. Hyg. 2023, 117, 815–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marangi, M.; Zechini, B.; Fileti, A.; Quaranta, G.; Aceti, A. Hymenolepis diminuta infection in a child living in the urban area of Rome, Italy. J. Clin. Microbiol. 2003, 41, 3994–3995. [Google Scholar] [CrossRef] [Scilit]
- Guardone, L.; Macchioni, F.; Torracca, B.; Gabrielli, S.; Magi, M. Hymenolepis diminuta (rat tapeworm) infection in a dog in Liguria, northwest Italy. In Proceedings of the XXVI SoIPA (Società Italiana di Parassitologia) National Congress, Perugia, Italy, 22–25 June 2010. [Google Scholar]
- D’Ovidio, D.; Noviello, E.; Pepe, P.; Del Prete, L.; Cringoli, G.; Rinaldi, L. Survey of Hymenolepis spp. in pet rodents in Italy. Parasitol. Res. 2015, 114, 4381–4384. [Google Scholar] [CrossRef] [Scilit]
- Cavallero, S.; Nejsum, P.; Cutillas, C.; Callejón, R.; Doležalová, J.; Modrý, D.; D’Amelio, S. Insights into the molecular systematics of Trichuris infecting captive primates based on mitochondrial DNA analysis. Vet. Parasitol. 2019, 272, 23–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavallero, S.; Montalbano Di Filippo, M.; Rondón, S.; Liberato, C.; D’Amelio, S.; Friedrich, K.G.; Berrilli, F. Nuclear and Mitochondrial Data on Trichuris from Macaca fuscata Support Evidence of Host Specificity. Life 2020, 11, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rivero, J.; Cutillas, C.; Callejón, R. Trichuris trichiura (Linnaeus, 1771) From Human and Non-human Primates: Morphology, Biometry, Host Specificity, Molecular Characterization, and Phylogeny. Front. Vet. Sci. 2021, 7, 626120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavallero, S.; De Liberato, C.; Friedrich, K.G.; Di Cave, D.; Masella, V.; D’Amelio, S.; Berrilli, F. Genetic heterogeneity and phylogeny of Trichuris spp. from captive non-human primates based on ribosomal DNA sequence data. Infect. Genet. Evol. 2015, 34, 450–456. [Google Scholar] [CrossRef] [Scilit]
- Helenbrook, W.D.; Wade, S.E.; Shields, W.M.; Stehman, S.V.; Whipps, C.M. Gastrointestinal Parasites of Ecuadorian Mantled Howler Monkeys (Alouatta palliata aequatorialis) Based on Fecal Analysis. J. Parasitol. 2015, 101, 341–350. [Google Scholar] [CrossRef] [Scilit]
- Justine, J.L. Capillaria brochieri n. sp. (Nematoda: Capillariinae) intestinal parasite of the chimpanzee (Pan paniscus) in Zaire. Ann. Parasitol. Hum. Comp. 1988, 63, 420–438. [Google Scholar] [CrossRef] [Scilit]
- Pizzi, R.; Gordon, J.C.; Flach, E.J.; Routh, A.D.; Clark, B.; Boardman, W.S. Capillaria hepatica (syn Calodium hepaticum) in primates in a zoological collection in the UK. Vet Rec. 2008, 163, 690–691. [Google Scholar] [PubMed]
- Fuehrer, H.P. An overview of the host spectrum and distribution of Calodium hepaticum (syn. Capillaria hepatica): Part 2—Mammalia (excluding Muroidea). Parasitol. Res. 2014, 113, 641–651. [Google Scholar] [CrossRef] [Scilit]
- Dini, F.M.; Caffara, M.; Galliani, M.; Cotignoli, C.; Capasso, M.; Tedesco, P.; Galuppi, R. Unveiling a novel parasitosis: Trichostrongylus colubriformis infection in captive ring-tailed lemurs (Lemur catta). Int. J. Parasitol. Parasites Wildl. 2023, 22, 300–304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pafčo, B.; Čížková, D.; Kreisinger, J.; Hasegawa, H.; Vallo, P.; Shutt, K.; Todd, A.; Petrželková, K.J.; Modrý, D. Metabarcoding analysis of strongylid nematode diversity in two sympatric primate species. Sci. Rep. 2018, 8, 5933. [Google Scholar] [CrossRef] [Scilit]
- Nosková, E.; Sambucci, K.M.; Petrželková, K.J.; Červená, B.; Modrý, D.; Pafčo, B. Strongyloides in non-human primates: Significance for public health control. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 2024, 379, 20230006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stancampiano, L.; Morandi, F.; Usai, F.; Benazzi, C.; Pietra, M. An unusual case of fatal Strongyloides stercoralis hyperinfection. Veterinaria 2011, 25, 39–44. [Google Scholar]
- Ottino, L.; Buonfrate, D.; Paradies, P.; Bisoffi, Z.; Antonelli, A.; Rossolini, G.M.; Gabrielli, S.; Bartoloni, A.; Zammarchi, L. Autochthonous Human and Canine Strongyloides stercoralis Infection in Europe: Report of a Human Case in An Italian Teen and Systematic Review of the Literature. Pathogens 2020, 9, 439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paradies, P.; Iarussi, F.; Sasanelli, M.; Capogna, A.; Lia, R.P.; Zucca, D.; Greco, B.; Cantacessi, C.; Otranto, D. Occurrence of strongyloidiasis in privately owned and sheltered dogs: Clinical presentation and treatment outcome. Parasit. Vectors. 2017, 10, 345. [Google Scholar] [CrossRef] [Scilit]
- Pafčo, B.; Kreisinger, J.; Čížková, D.; Pšenková-Profousová, I.; Shutt-Phillips, K.; Todd, A.; Fuh, T.; Petrželková, K.J.; Modrý, D. Genetic diversity of primate strongylid nematodes: Do sympatric nonhuman primates and humans share their strongylid worms? Mol. Ecol. 2019, 28, 4786–4797. [Google Scholar] [CrossRef] [Scilit]
- Pérez Cordón, G.; Hitos Prados, A.; Romero, D.; Sánchez Moreno, M.; Pontes, A.; Osuna, A.; Rosales, M.J. Intestinal parasitism in the animals of the zoological garden “Peña Escrita” (Almuñecar, Spain). Vet. Parasitol. 2008, 156, 302–309. [Google Scholar] [CrossRef] [Scilit]
- Köster, P.C.; Dashti, A.; Bailo, B.; Muadica, A.S.; Maloney, J.G.; Santín, M.; Chicharro, C.; Migueláñez, S.; Nieto, F.J.; Cano-Terriza, D.; et al. Occurrence and Genetic Diversity of Protist Parasites in Captive Non-Human Primates, Zookeepers, and Free-Living Sympatric Rats in the Córdoba Zoo Conservation Centre, Southern Spain. Animals 2021, 11, 700. [Google Scholar] [CrossRef] [Scilit]
- Osman, M.; El Safadi, D.; Benamrouz-Vanneste, S.; Cian, A.; Moriniere, R.; Gantois, N.; Delgado-Viscogliosi, P.; Guyot, K.; Bosc, S.; Chabé, M.; et al. Prevalence, transmission, and host specificity of Cryptosporidium spp. in various animal groups from two French zoos. Parasitol. Res. 2017, 116, 3419–3422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gomez, M.S.; Gracenea, M.; Gosalbez, P.; Feliu, C.; Enseñat, C.; Hidalgo, R. Detection of oocysts of Cryptosporidium in several species of monkeys and in one prosimian species at the Barcelona zoo. Parasitol. Res. 1992, 78, 619–620. [Google Scholar] [CrossRef] [Scilit]
- Gómez, M.S.; Torres, J.; Gracenea, M.; Fernandez-Morán, J.; Gonzalez-Moreno, O. Further report on Cryptosporidium in Barcelona zoo mammals. Parasitol. Res. 2000, 86, 318–323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beck, R.; Sprong, H.; Bata, I.; Lucinger, S.; Pozio, E.; Cacciò, S.M. Prevalence and molecular typing of Giardia spp. in captive mammals at the zoo of Zagreb, Croatia. Vet. Parasitol. 2011, 175, 40–46. [Google Scholar] [CrossRef] [Scilit]
- Martínez-Díaz, R.A.; Sansano-Maestre, J.; Martínez-Herrero, M.d.C.; Ponce-Gordo, F.; Gómez-Muñoz, M.T. Occurrence and genetic characterization of Giardia duodenalis from captive nonhuman primates by multi-locus sequence analysis. Parasitol. Res. 2011, 109, 539–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dixon, B.R. Giardia duodenalis in humans and animals—Transmission and disease. Res. Vet. Sci. 2021, 135, 283–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mravcová, K.; Štrkolcová, G.; Mucha, R.; Goldová, M. Zoonotic assemblages of Giardia duodenalis in captive non-human primates from the largest zoo in Slovakia. J. Parasit. Dis. 2021, 45, 302–305. [Google Scholar] [CrossRef] [Scilit]
- Karim, M.R.; Rongjun, Y.F.; Li, T.; Dong, H.; Li, D.; Zhang, L.; Li, J.; Jian, F.; Zhang, S.; Islam, R.F.; et al. Multi-locus analysis of Giardia duodenalis from nonhuman primates kept in zoos in China: Geographical segregation and host-adaptation of assemblage B isolates. Infect. Genet. Evol. 2015, 30, 82–88. [Google Scholar] [CrossRef] [Scilit]
- Köster, P.C.; Martínez-Nevado, E.; González, A.; Abelló-Poveda, M.T.; Fernández-Bellon, H.; de la Riva-Fraga, M.; Marquet, B.; Guéry, J.P.; Knauf-Witzens, T.; Weigold, A.; et al. Intestinal Protists in Captive Non-human Primates and Their Handlers in Six European Zoological Gardens. Molecular Evidence of Zoonotic Transmission. Front. Vet. Sci. 2022, 8, 819887. [Google Scholar] [CrossRef] [Scilit]
- Stensvold, C.R.; Alfellani, M.A.; Nørskov-Lauritsen, S.; Prip, K.; Victory, E.L.; Maddox, C.; Nielsen, H.V.; Clark, C.G. Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. Int. J. Parasitol. 2009, 39, 473–479. [Google Scholar] [CrossRef] [Scilit]
- Parkar, U.; Traub, R.J.; Vitali, S.; Elliot, A.; Levecke, B.; Robertson, I.; Geurden, T.; Steele, J.; Drake, B.; Thompson, R.C. Molecular characterization of Blastocystis isolates from zoo animals and their animal-keepers. Vet Parasitol. 2010, 169, 8–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfellani, M.A.; Jacob, A.S.; Perea, N.O.; Krecek, R.C.; Taner-Mulla, D.; Verweij, J.J.; Levecke, B.; Tannich, E.; Clark, C.G.; Stensvold, C.R. Diversity and distribution of Blastocystis sp. subtypes in non-human primates. Parasitology 2013, 140, 966–971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santín, M.; Gómez-Muñoz, M.T.; Solano-Aguilar, G.; Fayer, R. Development of a new PCR protocol to detect and subtype Blastocystis spp. from humans and animals. Parasitol. Res. 2011, 109, 205–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohammadpour, I.; Bozorg-Ghalati, F.; Gazzonis, A.L.; Manfredi, M.T.; Motazedian, M.H.; Mohammadpour, N. First molecular subtyping and phylogeny of Blastocystis sp. isolated from domestic and synanthropic animals (dogs, cats and brown rats) in southern Iran. Parasit. Vectors 2020, 13, 365. [Google Scholar] [CrossRef] [Scilit]
- Mohammad, N.A.; Al-Mekhlafi, H.M.; Anuar, T.S. Subtype distribution of Blastocystis isolated from humans and associated animals in an indigenous community with poor hygiene in Peninsular Malaysia. Trop. Biomed. 2018, 35, 849–860. [Google Scholar]
- Katsumata, M.; Yoshikawa, H.; Tokoro, M.; Mizuno, T.; Nagamoto, T.; Hendarto, J.; Asih, P.B.S.; Rozi, I.E.; Kimata, I.; Takami, K.; et al. Molecular phylogeny of Blastocystis isolates from wild rodents captured in Indonesia and Japan. Parasitol. Res. 2018, 117, 2841–2846. [Google Scholar] [CrossRef] [Scilit]
- Cian, A.; El Safadi, D.; Osman, M.; Moriniere, R.; Gantois, N.; Benamrouz-Vanneste, S.; Delgado-Viscogliosi, P.; Guyot, K.; Li, L.-L.; Monchy, S.; et al. Molecular Epidemiology of Blastocystis sp. in Various Animal Groups from Two French Zoos and Evaluation of Potential Zoonotic Risk. PLoS ONE 2017, 12, e0169659. [Google Scholar] [CrossRef] [Scilit]
- Marangi, M.; Boughattas, S.; De Nittis, R.; Pisanelli, D.; Delli Carri, V.; Lipsi, M.R.; La Bella, G.; Serviddio, G.; Niglio, M.; Lo Caputo, S.; et al. Prevalence and genetic diversity of Blastocystis sp. among autochthonous and immigrant patients in Italy. Microb. Pathog. 2023, 185, 106377. [Google Scholar] [CrossRef] [Scilit]
- Mattiucci, S.; Crisafi, B.; Gabrielli, S.; Paoletti, M.; Cancrini, G. Molecular epidemiology and genetic diversity of Blastocystis infection in humans in Italy. Epidemiol. Infect. 2016, 144, 635–646. [Google Scholar] [CrossRef] [Scilit]

| Copromicroscopic Analyses | Molecular Analyses | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Host | Tested Samples | Tric. | Cap. | Str. | H.d. | Giardia spp. | Giardia duodenalis | Giardia Assemblages | Blastocystis sp. | Blastocystis Subtypes | |
| NWM | animal groups | 12 | 1 | 6 | 3 | 1 | Neg | 9 | B | 11 | ST4, ST8 |
| feces | 42 | 1 | 6 | 3 | 1 | Neg | 17 | 16 | |||
| OWM | animal groups | 5 | 2 | 1 | Neg | 1 | Neg | 3 | B | 1 | nd |
| feces | 20 | 5 | 3 | Neg | 1 | Neg | 4 | 3 | |||
| Lemurs | animal groups | 8 | 3 | Neg | 2 | Neg | 1 | 4 | B | 8 | ST4 |
| feces | 30 | 6 | Neg | 5 | Neg | 1 | 11 | 22 | |||
| Apes | animal groups | 1 | Neg | Neg | Neg | Neg | Neg | Neg | - | 1 | nd |
| feces | 4 | Neg | Neg | Neg | Neg | Neg | Neg | 1 | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marchiori, E.; Bono, L.; Voltan, L.; Dotto, G.; Tessarin, C.; Marcer, F. Gastrointestinal Parasites in Non-Human Primates in Zoological Gardens in Northern Italy. Animals 2024, 14, 2607. https://doi.org/10.3390/ani14172607
Marchiori E, Bono L, Voltan L, Dotto G, Tessarin C, Marcer F. Gastrointestinal Parasites in Non-Human Primates in Zoological Gardens in Northern Italy. Animals. 2024; 14(17):2607. https://doi.org/10.3390/ani14172607
Chicago/Turabian StyleMarchiori, Erica, Lucia Bono, Laura Voltan, Giorgia Dotto, Cinzia Tessarin, and Federica Marcer. 2024. "Gastrointestinal Parasites in Non-Human Primates in Zoological Gardens in Northern Italy" Animals 14, no. 17: 2607. https://doi.org/10.3390/ani14172607
APA StyleMarchiori, E., Bono, L., Voltan, L., Dotto, G., Tessarin, C., & Marcer, F. (2024). Gastrointestinal Parasites in Non-Human Primates in Zoological Gardens in Northern Italy. Animals, 14(17), 2607. https://doi.org/10.3390/ani14172607

