Potential Role of SdiA in Biofilm Formation and Drug Resistance in Avian Pathogenic Escherichia coli
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Culture Conditions
2.2. General DNA Manipulation
2.3. Construction of sdiA Deletion Mutant
2.4. Construction of the Complementary Strain
2.5. Bacterial Growth Curves
2.6. Biofilm Formation Assays
2.7. Motility Tests
2.8. RNA-seq, Library Generation, and Transcriptome Analysis
2.9. RNA Isolation, cDNA Synthesis, and Quantitative Real-Time PCR Analysis
2.10. Drug Susceptibility Assays
2.11. Statistical Analysis
3. Results
3.1. Influence of sdiA Deletion on Bacterial Growth
3.2. Transcriptional Profiling Analysis of the Strains APEC40 and APEC40/ΔsdiA
3.3. Effects of sdiA Inactivation on the Biofilm Formation of the Strain APEC40
3.4. Influence of sdiA Deletion on Motility of the Strain APEC40
3.5. Inactivation of sdiA Changes Multidrug Resistance of the Strain APEC40
3.6. The Deletion of sdiA Modifies the Expression of Virulence and Drug Resistance Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jang, J.; Hur, H.G.; Sadowsky, M.J.; Byappanahalli, M.N.; Yan, T.; Ishii, S. Environmental Escherichia coli: Ecology and public health implications—A review. J. Appl. Microbiol. 2017, 123, 570–581. [Google Scholar] [CrossRef] [PubMed]
- Roland, K.; Curtiss, R., 3rd; Sizemore, D. Construction and evaluation of a delta cya delta crp Salmonella typhimurium strain expressing avian pathogenic Escherichia coli O78 LPS as a vaccine to prevent airsacculitis in chickens. Avian Dis. 1999, 43, 429–441. [Google Scholar] [CrossRef] [PubMed]
- Tivendale, K.A.; Logue, C.M.; Kariyawasam, S.; Jordan, D.; Hussein, A.; Li, G.; Wannemuehler, Y.; Nolan, L.K. Avian-pathogenic Escherichia coli strains are similar to neonatal meningitis E. coli strains and are able to cause meningitis in the rat model of human disease. Infect. Immun. 2010, 78, 3412–3419. [Google Scholar] [CrossRef] [PubMed]
- Müller, A.; Schulze Bernd, K.; Seinige, D.; Braun, A.S.; Kumm, F.; Kehrenberg, C. Molecular characterization of Escherichia coli isolates recovered from broilers with cellulitis. Poult. Sci. 2024, 103, 103704. [Google Scholar] [CrossRef]
- Ozaki, H.; Yonehara, K.; Murase, T. Virulence of Escherichia coli Isolates Obtained from Layer Chickens with Colibacillosis Associated with Pericarditis, Perihepatitis, and Salpingitis in Experimentally Infected Chicks and Embryonated Eggs. Avian Dis. 2018, 62, 233–236. [Google Scholar] [CrossRef] [PubMed]
- Fancher, C.A.; Thames, H.T.; Colvin, M.G.; Smith, M.; Easterling, A.; Nuthalapati, N.; Zhang, L.; Kiess, A.; Dinh, T.T.N.; Theradiyil Sukumaran, A. Prevalence and Molecular Characteristics of Avian Pathogenic Escherichia coli in “No Antibiotics Ever” Broiler Farms. Microbiol. Spectr. 2021, 9, e0083421. [Google Scholar] [CrossRef] [PubMed]
- Dho-Moulin, M.; Fairbrother, J.M. Avian pathogenic Escherichia coli (APEC). Vet. Res. 1999, 30, 299–316. [Google Scholar] [PubMed]
- Soto-Aceves, M.P.; Diggle, S.P.; Greenberg, E.P. Microbial Primer: LuxR-LuxI Quorum Sensing. Microbiology 2023, 169, 001343. [Google Scholar] [CrossRef] [PubMed]
- Fuqua, C.; Winans, S.C.; Greenberg, E.P. Census and consensus in bacterial ecosystems: The LuxR-LuxI family of quorum-sensing transcriptional regulators. Annu. Rev. Microbiol. 1996, 50, 727–751. [Google Scholar] [CrossRef]
- Mayer, C.; Borges, A.; Flament-Simon, S.C.; Simões, M. Quorum sensing architecture network in Escherichia coli virulence and pathogenesis. FEMS Microbiol. Rev. 2023, 47, fuad031. [Google Scholar] [CrossRef]
- Shimada, T.; Shimada, K.; Matsui, M.; Kitai, Y.; Igarashi, J.; Suga, H.; Ishihama, A. Roles of cell division control factor SdiA: Recognition of quorum sensing signals and modulation of transcription regulation targets. Genes Cells Devoted Mol. Cell. Mech. 2014, 19, 405–418. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Shu, Y.; Zhang, W.; Xu, Z.; Li, Y.; Li, S.; Li, Q.; Xiong, R.; Long, Y.; Liu, J.; et al. Quorum sensing N-acyl homoserine lactones-SdiA enhances the biofilm formation of E. coli by regulating sRNA CsrB expression. Heliyon 2023, 9, e21658. [Google Scholar] [CrossRef] [PubMed]
- Smith, J.L.; Fratamico, P.M.; Yan, X. Eavesdropping by bacteria: The role of SdiA in Escherichia coli and Salmonella enterica serovar Typhimurium quorum sensing. Foodborne Pathog. Dis. 2011, 8, 169–178. [Google Scholar] [CrossRef] [PubMed]
- Del Pozo, J.L. Biofilm-related disease. Expert Rev. Anti-Infect. Ther. 2018, 16, 51–65. [Google Scholar] [CrossRef] [PubMed]
- Gu, H.; Lee, S.W.; Carnicelli, J.; Jiang, Z.; Ren, D. Antibiotic Susceptibility of Escherichia coli Cells during Early-Stage Biofilm Formation. J. Bacteriol. 2019, 201, 10–1128. [Google Scholar] [CrossRef]
- Buck, L.D.; Paladino, M.M.; Nagashima, K.; Brezel, E.R.; Holtzman, J.S.; Urso, S.J.; Ryno, L.M. Temperature-Dependent Influence of FliA Overexpression on PHL628 E. coli Biofilm Growth and Composition. Front. Cell. Infect. Microbiol. 2021, 11, 775270. [Google Scholar] [CrossRef]
- Benyoussef, W.; Deforet, M.; Monmeyran, A.; Henry, N. Flagellar Motility during E. coli Biofilm Formation Provides a Competitive Disadvantage Which Recedes in the Presence of Co-Colonizers. Front. Cell. Infect. Microbiol. 2022, 12, 896898. [Google Scholar] [CrossRef]
- Lee, J.; Maeda, T.; Hong, S.H.; Wood, T.K. Reconfiguring the quorum-sensing regulator SdiA of Escherichia coli to control biofilm formation via indole and N-acylhomoserine lactones. Appl. Environ. Microbiol. 2009, 75, 1703–1716. [Google Scholar] [CrossRef]
- Sperandio, V. SdiA sensing of acyl-homoserine lactones by enterohemorrhagic E. coli (EHEC) serotype O157:H7 in the bovine rumen. Gut Microbes 2010, 1, 432–435. [Google Scholar] [CrossRef]
- Culler, H.F.; Couto, S.C.F.; Higa, J.S.; Ruiz, R.M.; Yang, M.J.; Bueris, V.; Franzolin, M.R.; Sircili, M.P. Role of SdiA on Biofilm Formation by Atypical Enteropathogenic Escherichia coli. Genes 2018, 9, 253. [Google Scholar] [CrossRef]
- Tarín-Pelló, A.; Suay-García, B.; Pérez-Gracia, M.T. Antibiotic resistant bacteria: Current situation and treatment options to accelerate the development of a new antimicrobial arsenal. Expert Rev. Anti-Infect. Ther. 2022, 20, 1095–1108. [Google Scholar] [CrossRef] [PubMed]
- Castronovo, C.; Agozzino, V.; Schirò, G.; Mira, F.; Di Bella, S.; Lastra, A.; Antoci, F.; Pennisi, M.; Giudice, E.; Guercio, A. Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Appl. Sci. 2023, 13, 442. [Google Scholar] [CrossRef]
- Benameur, Q.; Gervasi, T.; Dahloum, L.; Rechidi-Sidhoum, N.; Boutaiba Benklaouz, M.; Yakubu, A. Multidrug-resistant Escherichia coli isolated from cleaned and disinfected poultry houses prior to day-old chick placement. J. Environ. Qual. 2023, 52, 296–302. [Google Scholar] [CrossRef]
- Oliveira, J.M.; Cardoso, M.F.; Moreira, F.A.; Müller, A. Phenotypic antimicrobial resistance (AMR) of avian pathogenic Escherichia coli (APEC) from broiler breeder flocks between 2009 and 2018. Avian Pathol. 2022, 51, 388–394. [Google Scholar] [CrossRef] [PubMed]
- Dheilly, A.; Le Devendec, L.; Mourand, G.; Jouy, E.; Kempf, I. Antimicrobial resistance selection in avian pathogenic E. coli during treatment. Vet. Microbiol. 2013, 166, 655–658. [Google Scholar] [CrossRef]
- Rahmati, S.; Yang, S.; Davidson, A.L.; Zechiedrich, E.L. Control of the AcrAB multidrug efflux pump by quorum-sensing regulator SdiA. Mol. Microbiol. 2002, 43, 677–685. [Google Scholar] [CrossRef]
- Yu, L.; Wang, H.; Han, X.; Li, W.; Xue, M.; Qi, K.; Chen, X.; Ni, J.; Deng, R.; Shang, F.; et al. The two-component system, BasSR, is involved in the regulation of biofilm and virulence in avian pathogenic Escherichia coli. Avian Pathol. 2020, 49, 532–546. [Google Scholar] [CrossRef] [PubMed]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef]
- Yu, L.; Li, W.; Qi, K.; Wang, S.; Chen, X.; Ni, J.; Deng, R.; Shang, F.; Xue, T. McbR is involved in biofilm formation and H2O2 stress response in avian pathogenic Escherichia coli X40. Poult. Sci. 2019, 98, 4094–4103. [Google Scholar] [CrossRef]
- Kim, Y.J.; Im, S.Y.; Lee, J.O.; Kim, O.B. Potential Swimming Motility Variation by AcrR in Escherichia coli. J. Microbiol. Biotechnol. 2016, 26, 1824–1828. [Google Scholar] [CrossRef]
- Yu, L.; Li, W.; Liu, Z.; Yu, J.; Wang, W.; Shang, F.; Xue, T. Role of McbR in the regulation of antibiotic susceptibility in avian pathogenic Escherichia coli. Poult. Sci. 2020, 99, 6390–6401. [Google Scholar] [CrossRef] [PubMed]
- Sim, S.H.; Yeom, J.H.; Shin, C.; Song, W.S.; Shin, E.; Kim, H.M.; Cha, C.J.; Han, S.H.; Ha, N.C.; Kim, S.W.; et al. Escherichia coli ribonuclease III activity is downregulated by osmotic stress: Consequences for the degradation of bdm mRNA in biofilm formation. Mol. Microbiol. 2010, 75, 413–425. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zhang, S.; Xu, Z.; Li, H.; Xiao, Q.; Qiu, F.; Zhang, W.; Long, Y.; Zheng, D.; Huang, B.; et al. SdiA Improves the Acid Tolerance of E. coli by Regulating GadW and GadY Expression. Front. Microbiol. 2020, 11, 1078. [Google Scholar] [CrossRef] [PubMed]
- Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Yan, X.; Liu, B.; Jiang, T.; Zhou, Z.; Guo, F.; Zhang, Q.; Li, C.; Fang, T. SdiA Enhanced the Drug Resistance of Cronobacter sakazakii and Suppressed Its Motility, Adhesion and Biofilm Formation. Front. Microbiol. 2022, 13, 901912. [Google Scholar] [CrossRef] [PubMed]
- Pacheco, T.; Gomes AÉ, I.; Siqueira, N.M.G.; Assoni, L.; Darrieux, M.; Venter, H.; Ferraz, L.F.C. SdiA, a Quorum-Sensing Regulator, Suppresses Fimbriae Expression, Biofilm Formation, and Quorum-Sensing Signaling Molecules Production in Klebsiella pneumoniae. Front. Microbiol. 2021, 12, 597735. [Google Scholar] [CrossRef] [PubMed]
- de Brito, F.A.E.; de Freitas, A.P.P.; Nascimento, M.S. Multidrug-Resistant Biofilms (MDR): Main Mechanisms of Tolerance and Resistance in the Food Supply Chain. Pathogens 2022, 11, 1416. [Google Scholar] [CrossRef]
- Askoura, M.; Almalki, A.J.; Lila, A.S.A.; Almansour, K.; Alshammari, F.; Khafagy, E.-S.; Ibrahim, T.S.; Hegazy, W.A.H. Alteration of Salmonella enterica Virulence and Host Pathogenesis through Targeting sdiA by Using the CRISPR-Cas9 System. Microorganisms 2021, 9, 2564. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.; Lee, J.-M.; Smulski, D.R.; LaRossa, R.A. Global Impact of sdiA Amplification Revealed by Comprehensive Gene Expression Profiling of Escherichia coli. J. Bacteriol. 2001, 183, 2265–2272. [Google Scholar] [CrossRef]
- Petersen, C.; Møller, L.B. The RihA, RihB, and RihC ribonucleoside hydrolases of Escherichia coli. Substrate specificity, gene expression, and regulation. J. Biol. Chem. 2001, 276, 884–894. [Google Scholar] [CrossRef]
- Cirz Ryan, T.; O’Neill Bryan, M.; Hammond Jennifer, A.; Head Steven, R.; Romesberg Floyd, E. Defining the Pseudomonas aeruginosa SOS Response and Its Role in the Global Response to the Antibiotic Ciprofloxacin. J. Bacteriol. 2006, 188, 7101–7110. [Google Scholar] [CrossRef] [PubMed]
- Korsak, D.; Liebscher, S.; Vollmer, W. Susceptibility to Antibiotics and β-Lactamase Induction in Murein Hydrolase Mutants of Escherichia coli. Antimicrob. Agents Chemother. 2005, 49, 1404–1409. [Google Scholar] [CrossRef] [PubMed]
Strains or Plasmids | Description | Reference or Source |
---|---|---|
E. coli | ||
APEC40 | Avian pathogenic E. coli (APEC) 40, wild-type | Laboratory |
APEC40/ΔsdiA | APEC40 sdiA-deletion mutant | This study |
APEC40/pSTV28 | APEC40 with the empty vector pSTV28, Cmr | This study |
ΔsdiA/pSTV28 | Mutant with the empty vector pSTV28, Cmr | This study |
ΔsdiA/pCsdiA | Mutant with the complement plasmid pCsdiA, Cmr | This study |
DH-5α | Clone host strain | Invitrogen |
Plasmids | ||
PKD46 | Expresses λ-Red recombinase Exo, Bet, and Gam, temperature sensitive, Ampr | [28] |
PKD3 | cat gene, template plasmid, Cmr Ampr | [28] |
Pcp20 | FLPλcI857 λ++pRRep(Ts), temperature sensitive, Cmr Ampr | [28] |
pSTV28 | Low copy number cloning vector, Cmr | Takara |
pCsdiA | pSTV28 with sdiA gene, Cmr | This study |
Primer Name | Oligonucleotide (5′–3′) |
---|---|
40-SdiA-F | ACTCTCAGGGGCGTTGCGGTTTACTATGCAGGATAAGGATTGTAGGCTGGAGCTGCTT |
40-SdiA-R | CTGGCACGCAGGACAGAAAAGAGATCAAATTAAGCCAGTATGAATATCCTCCTTAGTTC |
Check-SdiA-F | CTGGACGCCATTTCAAGC |
Check-SdiA-R | TGCCGAGAATAATCAAGAAC |
pC-sdiA-F | CCGGAATTCCTGCTTAACAAATCAGCAT |
pC-sdiA-R | CCCAAGCTTTCAAATTAAGCCAGTAGCG |
RT-cbrA-F | ACGGCTGGGAGCAACATA |
RT-cbrA-R | GGCACCGCCAAAGATAAA |
RT-eamB-F | GTGCTGGCAGGGATGAGT |
RT-eamB-R | GTCCGTCTTCCTTTGTTGG |
RT-bdm-F | TTGGTCAGCTCCATGAGA |
RT-bdm-R | AATTCAACAGCAGAACCC |
RT-yafP-F | ATGACCGCCAGTCAGCAT |
RT-yafP-R | GCGTCCACCGTAAGTTCG |
RT-motB-F | GGCTGCTTATTCACTTCCC |
RT-motB-R | CCGACTTTATGACTGCGATG |
RT-16s-F | TTTGAGTTCCCGGCC |
RT-16s-R | CGGCCGCAAGGTTAA |
Antibiotics | MIC (μg/mL) of Three E. coli Strains | ||
---|---|---|---|
APEC40 | APEC40/ΔsdiA | 40ΔsdiA/pCsdiA | |
Doxycycline | 6.25 | 6.25 | 6.25 |
Gentamycin | 0.5 | 0.5 | 0.5 |
Ofloxacin | 3.125 | 3.125 | 3.125 |
Ciprofloxacin | 3.125 | 3.125 | 3.125 |
Kanamycin | 15.625 | 15.625 | 15.625 |
Erythromycin | 56.8 | 56.8 | 56.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hai, H.; Yang, M.; Cheng, Z.; Ma, K.; Shang, F. Potential Role of SdiA in Biofilm Formation and Drug Resistance in Avian Pathogenic Escherichia coli. Animals 2024, 14, 2199. https://doi.org/10.3390/ani14152199
Hai H, Yang M, Cheng Z, Ma K, Shang F. Potential Role of SdiA in Biofilm Formation and Drug Resistance in Avian Pathogenic Escherichia coli. Animals. 2024; 14(15):2199. https://doi.org/10.3390/ani14152199
Chicago/Turabian StyleHai, Haowen, Mengyang Yang, Zhuo Cheng, Kai Ma, and Fei Shang. 2024. "Potential Role of SdiA in Biofilm Formation and Drug Resistance in Avian Pathogenic Escherichia coli" Animals 14, no. 15: 2199. https://doi.org/10.3390/ani14152199
APA StyleHai, H., Yang, M., Cheng, Z., Ma, K., & Shang, F. (2024). Potential Role of SdiA in Biofilm Formation and Drug Resistance in Avian Pathogenic Escherichia coli. Animals, 14(15), 2199. https://doi.org/10.3390/ani14152199