Specificity of Key Sex Determination Genes in a Mammal with Ovotestes: The European Mole Talpa europaea
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Karyotyping and Molecular Genetic Analysis
3. Results
3.1. Karyotyping Results
3.2. The Rspo1 Gene Analysis
3.3. Analysis of the Eif2s3x and Eif2s3y Genes
3.4. The Sry Gene Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stévant, I.; Nef, S. Genetic control of gonadal sex determination and development. Trends Genet. 2019, 35, 346–358. [Google Scholar] [CrossRef] [PubMed]
- Valenzuela, N.; Neuwald, J.L.; Literman, R. Transcriptional evolution underlying vertebrate sexual development. Dev. Dyn. 2013, 242, 307–319. [Google Scholar] [CrossRef] [PubMed]
- Nagahama, Y.; Chakraborty, T.; Paul-Prasanth, B.; Ohta, K.; Nakamura, M. Sex determination, gonadal sex differentiation, and plasticity in vertebrate species. Physiol. Rev. 2021, 101, 1237–1308. [Google Scholar] [CrossRef]
- Gubbay, J.; Collignon, J.; Koopman, P.; Capel, B.; Economou, A.; Münsterberg, A.; Vivian, N.; Goodfellow, P.; Lovell-Badge, R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 1990, 346, 245–250. [Google Scholar] [CrossRef]
- Koopman, P.; Gubbay, J.; Vivian, N.; Goodfellow, P.; Lovell-Badge, R. Male development of chromosomally female mice transgenic for Sry. Nature 1991, 351, 117–121. [Google Scholar] [CrossRef]
- Kashimada, K.; Koopman, P. Sry: The master switch in mammalian sex determination. Development 2010, 137, 3921–3930. [Google Scholar] [CrossRef]
- Wilhelm, D.; Palmer, S.; Koopman, P. Sex determination and gonadal development in mammals. Physiol. Rev. 2007, 87, 1–28. [Google Scholar] [CrossRef] [PubMed]
- Wilhelm, D.; Washburn, L.L.; Truong, V.; Fellous, M.; Eicher, E.M.; Koopman, P. Antagonism of the testis- and ovary-determining pathways during ovotestis development in mice. Mech. Dev. 2009, 126, 324–336. [Google Scholar] [CrossRef]
- Syryn, H.; Van De Vijver, K.; Cools, M. Ovotesticular difference of sex development: Genetic background, histological features, and clinical management. Horm. Res. Paediatr. 2023, 96, 180–189. [Google Scholar] [CrossRef]
- Tomaselli, S.; Megiorni, F.; De Bernardo, C.; Felici, A.; Marrocco, G.; Maggiulli, G.; Grammatico, B.; Remotti, D.; Saccucci, P.; Valentini, F.; et al. Syndromic true hermaphroditism due to an R-spondin1 (RSPO1) homozygous mutation. Hum. Mutat. 2008, 29, 220–226. [Google Scholar] [CrossRef]
- Cao, J.; El Mansouri, F.; Reynoso, S.; Liu, Z.; Zhu, J.; Taketo, T. Inefficient Sox9 upregulation and absence of Rspo1 repression lead to sex reversal in the B6. XY TIR mouse gonad. Biol. Reprod. 2024, 110, 985–999. [Google Scholar] [CrossRef] [PubMed]
- Just, W.; Rau, W.; Vogel, W.; Akhverdian, M.; Fredga, K.; Graves, J.A.; Lyapunova, E. Absence of Sry in species of the vole Ellobius. Nat. Genet. 1995, 11, 117–118. [Google Scholar] [CrossRef] [PubMed]
- Just, W.; Baumstark, A.; Süss, A.; Graphodatsky, A.; Rens, W.; Schäfer, N.; Bakloushinskaya, I.; Hameister, H.; Vogel, W. Ellobius lutescens: Sex determination and sex chromosome. Sex. Dev. 2007, 1, 211–221. [Google Scholar] [CrossRef] [PubMed]
- Mulugeta, E.; Wassenaar, E.; Sleddens-Linkels, E.; van IJcken, W.F.; Heard, E.; Grootegoed, J.A.; Just, W.; Gribnau, J.; Baarends, W.M. Genomes of Ellobius species provide insight into the evolutionary dynamics of mammalian sex chromosomes. Genome Res. 2016, 26, 1202–1210. [Google Scholar] [CrossRef]
- Matveevsky, S.; Kolomiets, O.; Bogdanov, A.; Hakhverdyan, M.; Bakloushinskaya, I. Chromosomal evolution in mole voles Ellobius (Cricetidae, Rodentia): Bizarre sex chromosomes, variable autosomes and meiosis. Genes 2017, 8, 306. [Google Scholar] [CrossRef] [PubMed]
- Soullier, S.; Hanni, C.; Catzeflis, F.; Berta, P.; Laudet, V. Male sex determination in the spiny rat Tokudaia osimensis (Rodentia: Muridae) is not Sry dependent. Mamm. Genome 1998, 9, 590–592. [Google Scholar] [CrossRef]
- Kuroiwa, A.; Ishiguchi, Y.; Yamada, F.; Shintaro, A.; Matsuda, Y. The process of a Y-loss event in an XO/XO mammal, the Ryukyu spiny rat. Chromosoma 2010, 119, 519–526. [Google Scholar] [CrossRef] [PubMed]
- Hunter, J. Account of the free martin. Philos. Trans. R. Soc. Lond. 1779, 69, 279–293. [Google Scholar] [CrossRef]
- Lillie, F.R. The theory of the free-martin. Science 1916, 43, 611–613. [Google Scholar] [CrossRef]
- Murphy, S.; Deaville, R.; Monies, R.J.; Davison, N.; Jepson, P.D. True hermaphroditism: First evidence of an ovotestis in a cetacean species. J. Comp. Pathol. 2011, 144, 195–199. [Google Scholar] [CrossRef]
- Meyers-Wallen, V.N. Gonadal and sex differentiation abnormalities of dogs and cats. Sex. Dev. 2012, 6, 46–60. [Google Scholar] [CrossRef] [PubMed]
- Szczerbal, I.; Nowacka-Woszuk, J.; Nizanski, W.; Dzimira, S.; Ligocka, Z.; Jastrzebska, A.; Kabala, B.; Biernacik, M.; Przadka, P.; Switonski, M. Disorders of sex development are an emerging problem in French bulldogs: A description of six new cases and a review of the literature. Sex. Dev. 2020, 13, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Schlafer, D.H.; Valentine, B.; Fahnestock, G.; Froenicke, L.; Grahn, R.A.; Lyons, L.A.; Meyers-Wallen, V.N. A case of SRY-positive 38, XY true hermaphroditism (XY sex reversal) in a cat. Vet. Pathol. 2011, 48, 817–822. [Google Scholar] [CrossRef]
- Jiménez, R.; Barrionuevo, F.J.; Burgos, M. Natural exceptions to normal gonad development in mammals. Sex. Dev. 2013, 7, 147–162. [Google Scholar] [CrossRef]
- Jiménez, R.; Burgos, M.; Barrionuevo, F.J. The biology and evolution of fierce females (moles and hyenas). Annu. Rev. Anim. Biosci. 2023, 11, 141–162. [Google Scholar] [CrossRef] [PubMed]
- Jiménez, R.; Burgos, M.; Sánchez, A.; Sinclair, A.H.; Alarcón, F.J.; Marín, J.J.; Ortega, E.; Díaz de la Guardia, R. Fertile females of the mole Talpa occidentalis are phenotypic intersexes with ovotestes. Development 1993, 118, 1303–1311. [Google Scholar] [CrossRef] [PubMed]
- Sánchez, A.; Bullejos, M.; Burgos, M.; Hera, C.; Stamatopoulos, C.; de la Guardia, R.D.; Jiménez, R. Females of four mole species of genus Talpa (Insectivora, Mammalia) are true hermaphrodites with ovotestes. Mol. Reprod. Dev. Inc. Gamete Res. 1996, 44, 289–294. [Google Scholar] [CrossRef]
- Beolchini, F.; Rebecchi, L.; Bertolani, R.; Capanna, E. The gametogenetic cycle of two syntopic populations of moles: Talpa romana and Talpa europaea (Mammalia, Insectivora, Talpidae). Ital. J. Zool. 2003, 70, 109–113. [Google Scholar] [CrossRef]
- Rubenstein, N.M.; Cunha, G.R.; Wang, Y.Z.; Campbell, K.L.; Conley, A.J.; Catania, K.C.; Glickman, S.E.; Place, N.J. Variation in ovarian morphology in four species of New World moles with a peniform clitoris. Reproduction 2003, 126, 713–719. [Google Scholar] [CrossRef]
- Carmona, F.D.; Motokawa, M.; Tokita, M.; Tsuchiya, K.; Jiménez, R.; Sánchez-Villagra, M.R. The evolution of female mole ovotestes evidences high plasticity of mammalian gonad development. J. Exp. Zool. Part B Mol. Dev. Evol. 2008, 310, 259–266. [Google Scholar] [CrossRef]
- Barrionuevo, F.J.; Zurita, F.; Burgos, M.; Jiménez, R. Testis-like development of gonads in female moles. New insights on mammalian gonad organogenesis. Dev. Biol. 2004, 268, 39–52. [Google Scholar] [CrossRef]
- Carmona, F.D.; Lupiáñez, D.G.; Martín, J.E.; Burgos, M.; Jiménez, R.; Zurita, F. The spatio-temporal pattern of testis organogenesis in mammals-insights from the mole. Int. J. Dev. Biol. 2009, 53, 1035–1044. [Google Scholar] [CrossRef] [PubMed]
- Real, F.M.; Haas, S.A.; Franchini, P.; Xiong, P.; Simakov, O.; Kuhl, H.; Schöpflin, R.; Heller, D.; Moeinzadeh, M.-H.; Heinrich, V.; et al. The mole genome reveals regulatory rearrangements associated with adaptive intersexuality. Science 2020, 370, 208–214. [Google Scholar] [CrossRef]
- Ford, C.E.; Hamerton, J.L. A colchicine, hypotonic citrate, squash sequence for mammalian chromosomes. Stain Technol. 1956, 31, 247–251. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Lab. Press: New York, NY, USA, 1989. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Haeussler, M.; Zweig, A.S.; Tyner, C.; Speir, M.L.; Rosenbloom, K.R.; Raney, B.J.; Lee, C.M.; Lee, B.T.; Hinrichs, A.S.; Gonzalez, J.N. The UCSC Genome Browser database: 2019 update. Nucleic Acids Res. 2019, 47, D853–D858. [Google Scholar] [CrossRef]
- Gornung, E.; Volleth, M.; Capanna, E.; Castiglia, R. Comparative cytogenetics of moles (Eulipotyphla, Talpidae): Chromosomal differences in Talpa romana and T. europaea. Cytogenet. Genome Res. 2008, 121, 249–254. [Google Scholar] [CrossRef]
- Sánchez, A.; Bullejos, M.; Burgos, M.; Hera, C.; Jiménez, R.; Diaz de la Guardia, R. High sequence identity between the SRY HMG box from humans and insectivores. Mamm. Genome 1996, 7, 536–538. [Google Scholar] [CrossRef]
- Lundrigan, B.L.; Tucker, P.K. Evidence for multiple functional copies of the male sex-determining locus, Sry, in African murine rodents. J. Mol. Evol. 1997, 45, 60–65. [Google Scholar] [CrossRef][Green Version]
- Nagamine, C.M. The testis-determining gene, SRY, exists in multiple copies in Old World rodents. Genet. Res. 1994, 64, 151–159. [Google Scholar] [CrossRef]
- Murata, C.; Yamada, F.; Kawauchi, N.; Matsuda, Y.; Kuroiwa, A. Multiple copies of SRY on the large Y chromosome of the Okinawa spiny rat, Tokudaia muenninki. Chromosome Res. 2010, 18, 623–634. [Google Scholar] [CrossRef]
- Bullejos, M.; Sánchez, A.; Burgos, M.; Hera, C.; Jiménez, R.; Díaz de La Guardia, R. Multiple, polymorphic copies of SRY in both males and females of the vole Microtus cabrerae. Cytogenet. Genome Res. 1997, 79, 167–171. [Google Scholar] [CrossRef]
- Turner, M.E.; Martin, C.; Martins, A.S.; Dunmire, J.; Farkas, J.; Ely, D.L.; Milsted, A. Genomic and expression analysis of multiple Sry loci from a single Rattus norvegicus Y chromosome. BMC Genet. 2007, 8, 11. [Google Scholar] [CrossRef] [PubMed]
- Miyawaki, S.; Kuroki, S.; Maeda, R.; Okashita, N.; Koopman, P.; Tachibana, M. The mouse Sry locus harbors a cryptic exon that is essential for male sex determination. Science 2020, 370, 121–124. [Google Scholar] [CrossRef] [PubMed]
- Marchal, J.A.; Acosta, M.J.; Bullejos, M.; de la Guardia, R.D.; Sánchez, A. Origin and spread of the SRY gene on the X and Y chromosomes of the rodent Microtus cabrerae: Role of L1 elements. Genomics 2008, 91, 142–151. [Google Scholar] [CrossRef] [PubMed]
- Carmona, F.D.; Lupiáñez, D.G.; Real, F.M.; Burgos, M.; Zurita, F.; Jiménez, R. SOX9 is not required for the cellular events of testicular organogenesis in XX mole ovotestes. J. Exp. Zool. Part B Mol. Dev. Evol. 2009, 312, 734–748. [Google Scholar] [CrossRef]
- Zurita, F.; Barrionuevo, F.J.; Berta, P.; Ortega, E.; Burgos, M.; Jimenez, R. Abnormal sex-duct development in female moles: The role of anti-Mullerian hormone and testosterone. Int. J. Dev. Biol. 2003, 47, 451–458. [Google Scholar] [PubMed]
- Chen, Y.S.; Racca, J.D.; Phillips, N.B.; Weiss, M.A. Inherited human sex reversal due to impaired nucleocytoplasmic trafficking of SRY defines a male transcriptional threshold. Proc. Natl. Acad. Sci. USA 2013, 110, E3567–E3576. [Google Scholar] [CrossRef] [PubMed]
- Ferner, K.; Siniza, S.; Zeller, U. The placentation of Eulipotyphla—Reconstructing a morphotype of the mammalian placenta. J. Morphol. 2014, 275, 1122–1144. [Google Scholar] [CrossRef]
- Szczerbal, I.; Nowacka-Woszuk, J.; Dzimira, S.; Matuszczyk, A.; Iskrzak, P.; Switonski, M. Elevated incidence of freemartinism in pigs detected by droplet digital PCR and cytogenetic techniques. Livest. Sci. 2019, 219, 52–56. [Google Scholar] [CrossRef]
- Jost, A.; Vigier, B.; Prepin, J. Freemartins in cattle: The first steps of sexual organogenesis. Reproduction 1972, 29, 349–379. [Google Scholar] [CrossRef] [PubMed]
- Lindtke, D.; Seefried, F.R.; Drögemüller, C.; Neuditschko, M. Increased heterozygosity in low-pass sequencing data allows identification of blood chimeras in cattle. Anim. Genet. 2023, 54, 613–618. [Google Scholar] [CrossRef] [PubMed]
- Peters, H.E.; Konig, T.E.; Verhoeven, M.O.; Schats, R.; Mijatovic, V.; Ket, J.C.; Lambalk, C.B. Unusual twinning resulting in chimerism: A systematic review on monochorionic dizygotic twins. Twin Res. Hum. Genet. 2017, 20, 161–168. [Google Scholar] [CrossRef]
- Mittelbrunn, M.; Sánchez-Madrid, F. Intercellular communication: Diverse structures for exchange of genetic information. Nat. Rev. Mol. Cell Biol. 2012, 13, 328–335. [Google Scholar] [CrossRef] [PubMed]
- Morales-Prieto, D.M.; Favaro, R.R.; Markert, U.R. Placental miRNAs in feto-maternal communication mediated by extracellular vesicles. Placenta 2020, 102, 27–33. [Google Scholar] [CrossRef]
Genes and Their Fragments | Primer Sequences, 5′–3′ (Opposite Primers Are Represented in Different Columns) | ||
---|---|---|---|
Rspo1 | I fragment (initial) | Rspo1-3T-Fext CAGGCAAGTCGAATCTGCAACGGT | Rspo1-3T-Rext ACTGACCCAGCCCCGGAGGCGTTA |
II fragment (intermediate) | Rspo1-2T-Fext GTGGGTGGGATATCTCAGGTTGTC | Rspo1-2T-Rext GGGGCTCTTGCTGCAGGCGTCTAT | |
III fragment (final) | Rspo1-1T-Fext (external) CGTTGACATCCGAGGAATAGAAGT Rspo1-1T-F3ex ATGGTGCCGTTGGCTGCTGTAGAG Rspo1F-Talp CACTGTGCACCTCCGGGTCTCCTT Rspo1-1T-Fint CTGCTGCTGGCCCTTGCGTCTC | Rspo1-1T-Rext (external) GGGTTGCATTGGGTTGGTTTTTGG Rspo1-1T-R3ex CGAGGCCTGCTTCAGCCACAAC Rspo1-1T-R4ex AGCACAATGTGAAATGAGCGA Rspo1-1T-Rint AAGGTGCACGGTGATAAGGACTCC Rspo1-1T-R5ex AGGGCCGGCGGGAGAATGCCAACA | |
Eif2s3x | Eif2s3x-TF GTCATGTAGCTCATGGGAAGTCC | Eif2s3x-TR CTGTAGGAAACTCATCAGGTGTG | |
Eif2s3y | Eif2s3y-TF GGTCATGTTGCTCATGGAAAATCT | Eif2s3y-TR CTGTAGGAAACTCATCAGGTGTA | |
Sry | SRY-TFext (external) AAGTGTAAGTGCAGTGGAAATAAG SRY-TFint2 TACTACAACATGGAAAAACATTAT SRY-Fi2 GACAACGACAGTCCATTACAAG SRY-Fi1 CCTCTTTATGAACACGGACTT SRY-TFint1 AGGTCGATATTTATAGCCCGGGTA SRY-TFint TTAGTTGGCTGTGTTCATGCACT SRY-Fet CAAAACCGTGGCATCATTACAGAA | SRY-TRext (external) TGCCCTTTAAATATCACTAAGGTC SRY-TRst ACCCACTGACTCCAAAACCACAAC SRY-TRint GAATGCATTCATGGTTTGGTCTCG SRY-TRint2 TGAGGTAGCATAAGGGAGAACTGA |
Genes and Their Fragments | Primer Combination | Annealing Temperatures | |
---|---|---|---|
Rspo1 | I fragment (initial) | Rspo1-3T-Fext/Rspo1-3T-Rext | 67 °C |
II fragment (intermediate) | Rspo1-2T-Fext/Rspo1-2T-Rext | 67 °C | |
III fragment (final) | Rspo1-1T-Fext/Rspo1-1T-Rext | 60 °C | |
Rspo1-1T-Fext/Rspo1-1T-Rint | 60 °C | ||
Rspo1-1T-Fint/Rspo1-1T-R4ex | 60 °C | ||
Rspo1-1T-Fint/Rspo1-1T-Rext | 63 °C | ||
Eif2s3x | Eif2s3x-TF/Eif2s3x-TR | 63 °C | |
Eif2s3y | Eif2s3y-TF/Eif2s3y-TR | 63 °C | |
Sry | SRY-TFext/SRY-TRext | 63 °C | |
SRY-TFint2/SRY-TRext | 60 °C | ||
SRY-Fi1/SRY-TRext | 60 °C | ||
SRY-TFint/SRY-TRext | 63 °C | ||
SRY-TFint/SRY-TRint | 67 °C | ||
SRY-TFint2/SRY-TRst | 60 °C | ||
SRY-TFext/SRY-TRint | 63 °C | ||
SRY-TFext/SRY-TRint2 | 63 °C | ||
SRY-Fet/SRY-TRint2 | 63 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bogdanov, A.; Sokolova, M.; Bakloushinskaya, I. Specificity of Key Sex Determination Genes in a Mammal with Ovotestes: The European Mole Talpa europaea. Animals 2024, 14, 2180. https://doi.org/10.3390/ani14152180
Bogdanov A, Sokolova M, Bakloushinskaya I. Specificity of Key Sex Determination Genes in a Mammal with Ovotestes: The European Mole Talpa europaea. Animals. 2024; 14(15):2180. https://doi.org/10.3390/ani14152180
Chicago/Turabian StyleBogdanov, Alexey, Maria Sokolova, and Irina Bakloushinskaya. 2024. "Specificity of Key Sex Determination Genes in a Mammal with Ovotestes: The European Mole Talpa europaea" Animals 14, no. 15: 2180. https://doi.org/10.3390/ani14152180
APA StyleBogdanov, A., Sokolova, M., & Bakloushinskaya, I. (2024). Specificity of Key Sex Determination Genes in a Mammal with Ovotestes: The European Mole Talpa europaea. Animals, 14(15), 2180. https://doi.org/10.3390/ani14152180