Toll-like Receptor 3 in the Hybrid Yellow Catfish (Pelteobagrus fulvidraco ♀ × P. vachelli ♂): Protein Structure, Evolution and Immune Response to Exogenous Aeromonas hydrophila and Poly (I:C) Stimuli
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Gene Identification and Multiple Sequence Alignment
2.2. Data Processing and Bioinformatics Analysis
2.3. Phylogenetic and Natural Selection Analysis of TLR3 Genes
2.4. Fish Sampling and Immune Challenges
2.5. RNA Extraction, Reverse Transcription and Quantitative Real-Time PCR
2.6. Interaction of dsRNA Virus and Poly (I:C) with TLR3 in Yellow Catfish
2.7. Data Statistical Analysis
3. Results
3.1. Multiple Sequence Alignment of TLR3s from Different Fishes
3.2. Gene Structure, Collinearity and Protein Structure Analysis
3.3. Phylogenetic and Selection Analyses
3.4. Distribution of TLR3 in Different Tissues in Hybrid Yellow Catfish
3.5. Effects of Bacteria and Poly (I:C) on the Transcription Levels of Hybrid Yellow Catfish TLR3
3.6. Analysis of the Binding Site of Poly (I:C) and dsRNA Virus between TLR3-ECD
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Beutler, B. Toll-like receptors: How they work and what they do. Curr. Opin. Hematol. 2002, 9, 2–10. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. Signaling to NF-κB by Toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.L.; Moon, J.E.; Shu, J.H.; Yuan, L.; Newman, Z.R.; Schekman, R.; Barton, G.M. UNC93B1 mediates differential trafficking of endosomal TLRs. eLife 2013, 2, e00291. [Google Scholar] [CrossRef]
- Blasius, A.L.; Beutler, B. Intracellular toll-like receptors. Immunity 2010, 32, 305–315. [Google Scholar] [CrossRef]
- Tatematsu, M.; Nishikawa, F.; Seya, T.; Matsumoto, M. Toll-like receptor 3 recognizes incomplete stem structures in single-stranded viral RNA. Nat. Commun. 2013, 4, 1833. [Google Scholar] [CrossRef]
- Yu, M.; Levine, S.J. Toll-like receptor 3, RIG-I-like receptors and the NLRP3 inflammasome: Key modulators of innate immune responses to double-stranded RNA viruses. Cytokine Growth Factor Rev. 2011, 22, 63–72. [Google Scholar] [CrossRef]
- Liu, L.; Botos, I.; Wang, Y.; Leonard, J.N.; Shiloach, J.; Segal, D.M.; Davies, D.R. Structural basis of Toll-like receptor 3 signaling with double-stranded RNA. Science 2008, 320, 379–381. [Google Scholar] [CrossRef]
- Alexopoulou, L.; Holt, A.C.; Medzhitov, R.; Flavell, R.A. Recognition of double-stranded RNA and activation of NF-κB by Toll-like receptor 3. Nature 2001, 413, 732–738. [Google Scholar] [CrossRef]
- Alkie, T.N.; de Jong, J.; Jenik, K.; Klinger, K.M.; DeWitte-Orr, S.J. Enhancing innate antiviral immune responses in rainbow trout by double stranded RNA delivered with cationic phytoglycogen nanoparticles. Sci. Rep. 2019, 9, 13619. [Google Scholar] [CrossRef]
- Zhou, Z.-X.; Zhang, B.-C.; Sun, L. Poly(I:C) induces antiviral immune responses in Japanese flounder (Paralichthys olivaceus) that require TLR3 and MDA5 and is negatively regulated by Myd88. PLoS ONE 2014, 9, e112918. [Google Scholar] [CrossRef] [PubMed]
- Workenhe, S.T.; Rise, M.L.; Kibenge, M.J.T.; Kibenge, F.S.B. The fight between the teleost fish immune response and aquatic viruses. Mol. Immunol. 2010, 47, 2525–2536. [Google Scholar] [CrossRef] [PubMed]
- Sunyer, J.O. Fishing for mammalian paradigms in the teleost immune system. Nat. Immunol. 2013, 14, 320–326. [Google Scholar] [CrossRef] [PubMed]
- Verrier, E.R.; Langevin, C.; Benmansour, A.; Boudinot, P. Early antiviral response and virus-induced genes in fish. Dev. Comp. Immunol. 2011, 35, 1204–1214. [Google Scholar] [CrossRef]
- Falco, A.; Miest, J.J.; Pionnier, N.; Pietretti, D.; Forlenza, M.; Wiegertjes, G.F.; Hoole, D. β-Glucan-supplemented diets increase poly(I:C)-induced gene expression of Mx, possibly via Tlr3-mediated recognition mechanism in common carp (Cyprinus carpio). Fish Shellfish Immunol. 2014, 36, 494–502. [Google Scholar] [CrossRef]
- Huang, Y.; Huang, X.; Cai, J.; OuYang, Z.; Wei, S.; Wei, J.; Qin, Q. Identification of orange-spotted grouper (Epinephelus coioides) interferon regulatory factor 3 involved in antiviral immune response against fish RNA virus. Fish Shellfish Immunol. 2015, 42, 345–352. [Google Scholar] [CrossRef]
- Matsumoto, M.; Oshiumi, H.; Seya, T. Antiviral responses induced by the TLR3 pathway. Rev. Med. Virol. 2011, 21, 67–77. [Google Scholar] [CrossRef]
- Wang, P.; Zhao, C.; Wang, C.; Fan, S.; Yan, L.; Qiu, L. TLR3 gene in Japanese sea perch (Lateolabrax japonicus): Molecular cloning, characterization and expression analysis after bacterial infection. Fish Shellfish Immunol. 2018, 76, 347–354. [Google Scholar] [CrossRef]
- Wu, M.; Zhu, K.-C.; Guo, H.-Y.; Guo, L.; Liu, B.; Jiang, S.-G.; Zhang, D.-C. Characterization, expression and function analysis of the TLR3 gene in golden pompano (Trachinotus ovatus). Dev. Comp. Immunol. 2021, 117, 103977. [Google Scholar] [CrossRef]
- Liu, Q.-N.; Xin, Z.-Z.; Chai, X.-Y.; Jiang, S.-H.; Li, C.-F.; Zhang, D.-Z.; Zhou, C.-L.; Tang, B.-P. Identification of differentially expressed genes in the spleens of polyriboinosinic polyribocytidylic acid (poly I:C)-stimulated yellow catfish Pelteobagrus fulvidraco. Fish Shellfish Immunol. 2016, 56, 278–285. [Google Scholar] [CrossRef]
- Zhu, R.; Liu, X.-X.; Lv, X.; Li, S.-Y.; Li, Y.-D.; Yu, X.-J.; Wang, X.-G. Deciphering transcriptome profile of the yellow catfish (Pelteobagrus fulvidraco) in response to Edwardsiella ictaluri. Fish Shellfish Immunol. 2017, 70, 593–608. [Google Scholar] [CrossRef] [PubMed]
- Ikeya, T.; Güntert, P.; Ito, Y. Protein structure determination in living cells. Int. J. Mol. Sci. 2019, 20, 2442. [Google Scholar] [CrossRef] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Sachidanandam, R.; Stein, L. Comparative genomics between rice and Arabidopsis shows scant collinearity in gene order. Genome Res. 2001, 11, 2020–2026. [Google Scholar] [CrossRef] [PubMed]
- Gong, G.; Dan, C.; Xiao, S.; Guo, W.; Huang, P.; Xiong, Y.; Wu, J.; He, Y.; Zhang, J.; Li, X.; et al. Chromosomal-level assembly of yellow catfish genome using third-generation DNA sequencing and Hi-C analysis. GigaScience 2018, 7, giy120. [Google Scholar] [CrossRef] [PubMed]
- Bustamante, C.D.; Fledel-Alon, A.; Williamson, S.; Nielsen, R.; Todd Hubisz, M.; Glanowski, S.; Tanenbaum, D.M.; White, T.J.; Sninsky, J.J.; Hernandez, R.D.; et al. Natural selection on protein-coding genes in the human genome. Nature 2005, 437, 1153–1157. [Google Scholar] [CrossRef]
- Spielman, S.J.; Wilke, C.O. The relationship between dN/dS and scaled selection coefficients. Mol. Biol. Evol. 2015, 32, 1097–1108. [Google Scholar] [CrossRef]
- Nei, M. Selectionism and neutralism in molecular evolution. Mol. Biol. Evol. 2005, 22, 2318–2342. [Google Scholar] [CrossRef]
- Guo, S.; Wen, Z.; Zhang, X.; Li, F.; Cui, H.; Lin, X.; Shi, Q.; You, X. Characterization of five caspase genes and their transcriptional changes in response to exogenous iridescent virus challenge in the whiteleg shrimp (Litopenaeus vannamei). Aquaculture 2021, 534, 736192. [Google Scholar] [CrossRef]
- Wen, Z.-Y.; Liu, T.; Qin, C.-J.; Zou, Y.-C.; Wang, J.; Li, R.; Tao, Y.-X. MRAP2 interaction with melanocortin-4 receptor in snakehead (Channa argus). Biomolecules 2021, 11, 481. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Hamyat, M.; Liu, C.; Ahmad, S.; Gao, X.; Guo, C.; Wang, Y.; Guo, Y. Identification and characterization of the WOX family genes in five Solanaceae species reveal their conserved roles in peptide signaling. Genes 2018, 9, 260. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021, 49, D458–D460. [Google Scholar] [CrossRef] [PubMed]
- Johnson, L.S.; Eddy, S.R.; Portugaly, E. Hidden Markov model speed heuristic and iterative HMM search procedure. BMC Bioinform. 2010, 11, 431. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Yang, Z. PAML 4: Phylogenetic Analysis by Maximum Likelihood. Mol. Biol. Evol. 2007, 24, 1586–1591. [Google Scholar] [CrossRef]
- Delport, W.; Poon, A.F.Y.; Frost, S.D.W.; Kosakovsky Pond, S.L. Datamonkey 2010: A suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics 2010, 26, 2455–2457. [Google Scholar] [CrossRef]
- Pond, S.L.K.; Frost, S.D.W. Datamonkey: Rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 2005, 21, 2531–2533. [Google Scholar] [CrossRef]
- Zhou, Q.; Jin, M.; Elmada, Z.C.; Liang, X.; Mai, K. Growth, immune response and resistance to Aeromonas hydrophila of juvenile yellow catfish, Pelteobagrus fulvidraco, fed diets with different arginine levels. Aquaculture 2015, 437, 84–91. [Google Scholar] [CrossRef]
- Sun, B.-Y.; He, W.; Yang, H.-X.; Tian, D.-Y.; Jian, P.-Y.; Wu, K.; Yang, C.-G.; Song, X.-H. Increased susceptibility to Aeromonas hydrophila infection in grass carp with antibiotic-induced intestinal dysbiosis. Aquaculture 2022, 552, 737969. [Google Scholar] [CrossRef]
- Sahoo, B.R.; Basu, M.; Swain, B.; Maharana, J.; Dikhit, M.R.; Jayasankar, P.; Samanta, M. Structural insights of rohu TLR3, its binding site analysis with fish reovirus dsRNA, poly I:C and zebrafish TRIF. Int. J. Biol. Macromol. 2012, 51, 531–543. [Google Scholar] [CrossRef] [PubMed]
- De Vries, S.J.; van Dijk, M.; Bonvin, A.M.J.J. The HADDOCK web server for data-driven biomolecular docking. Nat. Protoc. 2010, 5, 883–897. [Google Scholar] [CrossRef] [PubMed]
- Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Bian, C.; You, X.; Li, J.; Ye, L.; Wen, Z.; Lv, Y.; Zhang, X.; Xu, J.; Yang, S.; et al. Genome sequencing of the Japanese eel (Anguilla japonica) for comparative genomic studies on tbx4 and a tbx4 gene cluster in teleost fishes. Mar. Drugs 2019, 17, 426. [Google Scholar] [CrossRef]
- Sudhagar, A.; El-Matbouli, M.; Kumar, G. Identification and Expression Profiling of Toll-Like Receptors of Brown Trout (Salmo trutta) during Proliferative Kidney Disease. Int. J. Mol. Sci. 2020, 21, 3755. [Google Scholar] [CrossRef]
- Choe, J.; Kelker, M.S.; Wilson, I.A. Crystal structure of human toll-like receptor 3 (TLR3) ectodomain. Science 2005, 309, 581–585. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, L.; Davies, D.R.; Segal, D.M. Dimerization of Toll-like receptor 3 (TLR3) is required for ligand binding. J. Biol. Chem. 2010, 285, 36836–36841. [Google Scholar] [CrossRef]
- Astakhova, N.M.; Perelygin, A.A.; Zharkikh, A.A.; Lear, T.L.; Coleman, S.J.; MacLeod, J.N.; Brinton, M.A. Characterization of equine and other vertebrate TLR3, TLR7, and TLR8 genes. Immunogenetics 2009, 61, 529–539. [Google Scholar] [CrossRef]
- Gao, Q.; Tang, Q.; Zhao, M.; Min, M.; Wang, Q.; Peng, S.; Ma, L. Molecular characterization of TLR3 and TRIL in silvery pomfret (Pampus argenteus) and their expression profiles in response to bacterial components. Int. J. Biol. Macromol. 2020, 155, 805–813. [Google Scholar] [CrossRef]
- Han, C.; Li, Q.; Zhang, Z.; Huang, J. Characterization, expression, and evolutionary analysis of new TLR3 and TLR5M genes cloned from the spiny eel Mastacembelus armatus. Dev. Comp. Immunol. 2017, 77, 174–187. [Google Scholar] [CrossRef]
- Massingham, T.; Goldman, N. Detecting amino acid sites under positive selection and purifying selection. Genetics 2005, 169, 1753–1762. [Google Scholar] [CrossRef] [PubMed]
- Baoprasertkul, P.; Peatman, E.; Somridhivej, B.; Liu, Z. Toll-like receptor 3 and TICAM genes in catfish: Species-specific expression profiles following infection with Edwardsiella ictaluri. Immunogenetics 2006, 58, 817–830. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.-N.; Wang, Z.-Y.; Yao, C.-L. Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol. 2011, 31, 98–106. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, M.F.; Wiens, G.D.; Purcell, M.K.; Palti, Y. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005, 57, 510–519. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen-Ivey, C.R.; Figueras, M.J.; McGarey, D.; Liles, M.R. Virulence factors of Aeromonas hydrophila: In the wake of reclassification. Front. Microbiol. 2016, 7, 1337. [Google Scholar] [CrossRef]
- Hossain, M.J.; Sun, D.; McGarey, D.J.; Wrenn, S.; Alexander, L.M.; Martino, M.E.; Xing, Y.; Terhune, J.S.; Liles, M.R.; Fusté, M.C.; et al. An Asian origin of virulent Aeromonas hydrophila responsible for disease epidemics in United States-farmed catfish. mBio 2014, 5, e00848-14. [Google Scholar] [CrossRef]
- Wang, S.; Li, X.; Zhang, M.; Wang, R.; Qian, Y.; Hong, M.; Li, M. Effects of fermented noni juice on growth, antioxidant status, immune response, intestinal microbiota and resistance to Aeromonas hydrophila of juvenile yellow catfish Pelteobagrus fulvidraco fed high-fat diet. Aquacult. Nutr. 2021, 27, 1290–1303. [Google Scholar] [CrossRef]
- Yuan, X.Y.; Zhang, X.T.; Xia, Y.T.; Zhang, Y.Q.; Wang, B.; Ye, W.W.; Ye, Z.F.; Qian, S.C.; Huang, M.M.; Yang, S.; et al. Transcriptome and 16S rRNA analyses revealed differences in the responses of largemouth bass (Micropterus salmoides) to early Aeromonas hydrophila infection and immunization. Aquaculture 2021, 541, 736759. [Google Scholar] [CrossRef]
- Meijer, A.H.; Verbeek, F.J.; Salas-Vidal, E.; Corredor-Adámez, M.; Bussman, J.; van der Sar, A.M.; Otto, G.W.; Geisler, R.; Spaink, H.P. Transcriptome profiling of adult zebrafish at the late stage of chronic tuberculosis due to Mycobacterium marinum infection. Mol. Immunol. 2005, 42, 1185–1203. [Google Scholar] [CrossRef]
- Phelan, P.E.; Mellon, M.T.; Kim, C.H. Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish (Danio rerio). Mol. Immunol. 2005, 42, 1057–1071. [Google Scholar] [CrossRef]
- Bengtsson, N.E.; Hall, J.K.; Odom, G.L.; Phelps, M.P.; Andrus, C.R.; Hawkins, R.D.; Hauschka, S.D.; Chamberlain, J.R.; Chamberlain, J.S. Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy. Nat. Commun. 2017, 8, 14454. [Google Scholar] [CrossRef] [PubMed]
- Monguió-Tortajada, M.; Franquesa, M.; Sarrias, M.-R.; Borràs, F.E. Low doses of LPS exacerbate the inflammatory response and trigger death on TLR3-primed human monocytes. Cell Death Dis. 2018, 9, 499. [Google Scholar] [CrossRef] [PubMed]
- Tecklenborg, J.; Clayton, D.; Siebert, S.; Coley, S.M. The role of the immune system in kidney disease. Clin. Exp. Immunol. 2018, 192, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Lewis, S.M.; Williams, A.; Eisenbarth, S.C. Structure and function of the immune system in the spleen. Sci. Immunol. 2019, 4, eaau6085. [Google Scholar] [CrossRef]
- Mebius, R.E.; Kraal, G. Structure and function of the spleen. Nat. Rev. Immunol. 2005, 5, 606–616. [Google Scholar] [CrossRef]
- Karikó, K.; Ni, H.; Capodici, J.; Lamphier, M.; Weissman, D. mRNA is an endogenous ligand for Toll-like receptor 3. J. Biol. Chem. 2004, 279, 12542–12550. [Google Scholar] [CrossRef]
- Karpala, A.J.; Lowenthal, J.W.; Bean, A.G. Activation of the TLR3 pathway regulates IFNβ production in chickens. Dev. Comp. Immunol. 2008, 32, 435–444. [Google Scholar] [CrossRef]
- Fan, Y.; Zhou, Y.; Zeng, L.; Jiang, N.; Liu, W.; Zhao, J.; Zhong, Q. Identification, structural characterization, and expression analysis of toll-like receptors 2 and 3 from gibel carp (Carassius auratus gibelio). Fish Shellfish Immunol. 2018, 72, 629–638. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) | Amplicon (bp) |
---|---|---|
beta-actin F | GGACCAATCAGACGAAGCGA | 105 |
beta-actin R | TCAGAGTGGCAGCTTAACCG | |
Toll-3 F | CCTGTTGCAAGTCCGAGACA | 119 |
Toll-3 R | CCAGCCAGGCCAGATTCTCT |
Species | Protein Accession Number | Percentage Similarity (%) |
---|---|---|
Acanthochromis polyacanthus | XP_022067302.1 | 65.5% |
Argyrosomus japonicus | QOS44501.1 | 66.8% |
Cheilinus undulatus | XP_041642339.1 | 65.8% |
Dicentrarchus labrax | CBN82176.1 | 38.2% |
Ictalurus punctatus | ABD93873.1 | 90.1% |
Megalops cyprinoides | XP_036372873.1 | 66.1% |
Oreochromis niloticus | XP_025764171.1 | 65.8% |
Salmo trutta | XP_029605762.1 | 69.8% |
Siniperca chuatsi | QEU52192.1 | 66.1% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, S.; Zeng, M.; Gao, W.; Li, F.; Wei, X.; Shi, Q.; Wen, Z.; Song, Z. Toll-like Receptor 3 in the Hybrid Yellow Catfish (Pelteobagrus fulvidraco ♀ × P. vachelli ♂): Protein Structure, Evolution and Immune Response to Exogenous Aeromonas hydrophila and Poly (I:C) Stimuli. Animals 2023, 13, 288. https://doi.org/10.3390/ani13020288
Guo S, Zeng M, Gao W, Li F, Wei X, Shi Q, Wen Z, Song Z. Toll-like Receptor 3 in the Hybrid Yellow Catfish (Pelteobagrus fulvidraco ♀ × P. vachelli ♂): Protein Structure, Evolution and Immune Response to Exogenous Aeromonas hydrophila and Poly (I:C) Stimuli. Animals. 2023; 13(2):288. https://doi.org/10.3390/ani13020288
Chicago/Turabian StyleGuo, Shengtao, Mengsha Zeng, Wenxue Gao, Fan Li, Xiuying Wei, Qiong Shi, Zhengyong Wen, and Zhaobin Song. 2023. "Toll-like Receptor 3 in the Hybrid Yellow Catfish (Pelteobagrus fulvidraco ♀ × P. vachelli ♂): Protein Structure, Evolution and Immune Response to Exogenous Aeromonas hydrophila and Poly (I:C) Stimuli" Animals 13, no. 2: 288. https://doi.org/10.3390/ani13020288
APA StyleGuo, S., Zeng, M., Gao, W., Li, F., Wei, X., Shi, Q., Wen, Z., & Song, Z. (2023). Toll-like Receptor 3 in the Hybrid Yellow Catfish (Pelteobagrus fulvidraco ♀ × P. vachelli ♂): Protein Structure, Evolution and Immune Response to Exogenous Aeromonas hydrophila and Poly (I:C) Stimuli. Animals, 13(2), 288. https://doi.org/10.3390/ani13020288