Impact of Dietary Supplementation of Spice Extracts on Growth Performance, Nutrient Digestibility and Antioxidant Response in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Housing and Experimental Animals
2.2. Diets and Experimental Design
2.3. Productive Traits and Sampling
2.4. Apparent Ileal Digestibility Analysis
2.5. Chemical Analysis
2.6. Enzyme Activity and Plasma Analysis
2.7. Gene Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. Animal Performance and Mortality
3.2. Apparent Ileal Digestibility
3.3. Pancreatic Enzyme Activity
3.4. Plasma Alpha Tocopherol Concentration and Antioxidant Enzyme Activity
3.5. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gadde, U.; Kim, W.H.; Oh, S.T.; Lillehoj, H.S. Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: A review. Anim. Health Res. Rev. 2017, 18, 26–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puvača, N.; Ljubojević, D.; Kostadinović, L.J.; Lević, J.; Nikolova, N.; Miščević, B.; Könyves, T.; Lukač, D.; Popović, S. Spices and herbs in broilers nutrition: Hot red pepper (Capsicum annuum L.) and its mode of action. Worlds Poult. Sci. J. 2015, 71, 683–688. [Google Scholar] [CrossRef]
- Puvača, N.; Ljubojević, D.; Kostadinović, L.J.; Lukač, D.; Lević, J.; Popović, S.; Đuragić, O. Spices and herbs in broilers nutrition: Effects of garlic (Allium sativum L.) on broiler chicken production. Worlds Poult. Sci. J. 2015, 71, 533–538. [Google Scholar] [CrossRef]
- Platel, K.; Srinivasan, K. Digestive stimulant action of spices: A myth or reality? Indian J. Med. Res. 2004, 119, 167–179. [Google Scholar] [PubMed]
- Ding, X.; Yang, C.; Wang, P.; Yang, Z.; Ren, X. Effects of star anise (Illicium verum Hook. f) and its extractions on carcass traits, relative organ weight, intestinal development, and meat quality of broiler chickens. Poult. Sci. 2020, 99, 5673–5680. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, K. Biological activities of red pepper (Capsicum annuum) and its pungent principle capsaicin: A review. Crit. Rev. Food Sci. Nutr. 2016, 56, 1488–1500. [Google Scholar] [CrossRef]
- Ramakrishna, R.R.; Platel, K.; Srinivasan, K. In vitro influence of spices and spice-active principles on digestive enzymes of rat pancreas and small intestine. Nahrung 2003, 47, 408–412. [Google Scholar] [CrossRef]
- Puvača, N.; Ljubojević, D.; Lukač, D.; Kostadinović, L.J.; Stanaćev, V.; Popović, S.; Živkovbaloš, M.; Nikolova, N. Digestibility of fat in broiler chickens influenced by dietary addition of spice herbs. Maced. J. Anim. Sci. 2014, 4, 61–67. [Google Scholar] [CrossRef]
- Adaszek, Ł.; Gadomska, D.; Mazurek, Ł.; Łyp, P.; Madany, J.; Winiarczyk, S. Properties of capsaicin and its utility in veterinary and human medicine. Res.Vet. Sci. 2019, 123, 14–19. [Google Scholar] [CrossRef]
- Takooree, H.; Aumeeruddy, M.Z.; Rengasamy, K.R.; Venugopala, K.N.; Jeewon, R.; Zengin, G.; Mahomoodally, M.F. A systematic review on black pepper (Piper nigrum L.): From folk uses to pharmacological applications. Crit. Rev. Food Sci. Nutr. 2019, 59, S210–S243. [Google Scholar] [CrossRef]
- Abd El-Hack, M.E.; Alagawany, M.; Shaheen, H.; Samak, D.; Othman, S.I.; Allam, A.A.; Taha, A.E.; Khafaga, A.F.; Arif, M.; Osman, A.; et al. Ginger and its derivatives as promising alternatives to antibiotics in poultry feed. Animals 2020, 10, 452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Platel, K.; Rao, A.; Saraswathi, G.; Srinivasan, K. Digestive stimulant action of three Indian spice mixes in experimental rats. Food/Nahrung 2002, 46, 394–398. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, K. Black pepper and its pungent principle-piperine: A review of diverse physiological effects. Crit. Rev. Food Sci. Nutr. 2007, 47, 735–748. [Google Scholar] [CrossRef]
- Aikpitanyi, K.U.; Igwe, R.O.; Egweh, N.O. Assessment of ginger and black pepper as feed additives on growth performance and carcass traits of broiler chickens. Int. J. Vet. Sci. Anim. Husb. 2019, 5, 033–038. [Google Scholar]
- Liu, S.J.; Wang, J.; He, T.F.; Liu, H.S.; Piao, X.S. Effects of natural capsicum extract on growth performance, nutrient utilization, antioxidant status, immune function, and meat quality in broilers. Poult. Sci. 2021, 100, 101301. [Google Scholar] [CrossRef] [PubMed]
- El-Hack, A.; El-Saadony, M.T.; Elbestawy, A.R.; Gado, A.R.; Nader, M.M.; Saad, A.M.; El-Tahan, A.M.; Taha, A.E.; Salem, H.M.; El-Tarabily, K.A. Hot red pepper powder as a safe alternative to antibiotics in organic poultry feed: An updated review. Poult. Sci. 2022, 101, 101684. [Google Scholar] [CrossRef] [PubMed]
- Ogbuewu, I.P.; Okoro, V.M.; Mbajiorgu, C.A. Meta-analysis of the influence of phytobiotic (pepper) supplementation in broiler chicken performance. Trop. Anim. Health Prod. 2020, 52, 17–30. [Google Scholar] [CrossRef]
- Al-Khalaifah, H.; Al-Nasser, A.; Al-Surrayai, T.; Sultan, H.; Al-Attal, D.; Al-Kandari, R.; Al-Saleem, H.; Al-Holi, A.; Dashti, F. Effect of Ginger Powder on Production Performance, Antioxidant Status, Hematological Parameters, Digestibility, and Plasma Cholesterol Content in Broiler Chickens. Animals 2022, 12, 901. [Google Scholar] [CrossRef]
- Menoyo, D.; Blanch, M.; De Blas, C.; Ibánez, M. The supplementation of broiler feeds with capsicum based additive improves animal performance. The results of a meta-analysis. In Proceedings of the 26th World’s Poultry Congress, Paris, France, 7–11 August 2022. [Google Scholar]
- Ipharraguerre, I.; Francesch, M.; Roura, E.; Javierre, J. Efecto de un aditivo botanico (Luctarom Convert) sobre la digestibilidad de grasa en pollos de engorde. In Proceedings of the 21st Latin American Congress on Poultry Farming, La Havana, Cuba, 6–9 October 2009. [Google Scholar]
- Boletín Oficial del Estado (BOE) Real Decreto 53/2013, 1 de febrero, por el que se establecen las normas básicas aplicables para la protección de los animales utilizados en experimentación y otros fines científicos, incluyendo docencia. Boletín Oficial del Estado 2013, 34, 11370–11421.
- Santomá, G.; Mateos, G.G. Necesidades Nutricionales para Avicultura, 2nd ed.; Fundación Española Desarrollo Nutrición Animal (FEDNA): Madrid, Spain, 2018. [Google Scholar]
- AOAC. Official Methods of Analysis of the Association of Official Agricultural Chemists, 18th ed.; AOAC International: Arlington, VA, USA, 2000. [Google Scholar]
- Short, F.J.; Gorton, P.; Wiseman, J.; Boorman, K.N. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
- Rey, A.I.; Daza, A.; López-Carrasco, C.; López-Bote, C.J. Quantitative study of the α- and γ-tocopherols accumulation in muscle and back fat from Iberian pigs kept free-range as affected by time of free-range feeding or weight gain. Anim. Sci. 2006, 82, 901–908. [Google Scholar] [CrossRef]
- Herrero-Encinas, J.; Menoyo, D.; Blanch, M.; Pastor, J.J.; Rochell, S.J. Response of broiler chickens fed diets supplemented with a bioactive olive pomace extract from Olea europaea to an experimental coccidial vaccine challenge. Poult. Sci. 2021, 100, 575–584. [Google Scholar] [CrossRef] [PubMed]
- De Boever, S.; Vangestel, C.; De Backer, P.; Croubels, S.; Sys, S.U. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet. Immunol. Immunopathol. 2008, 122, 312–317. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.H.; Ko, Y.H.; Chin, H.J.; Hsu, C.; Ding, S.T.; Chen, C.Y. The effect of feed restriction on expression of hepatic lipogenic genes in broiler chickens and the function of SREBP1. Comp. Biochem. Physiol. 2009, 153, 327–331. [Google Scholar] [CrossRef]
- Habashy, W.S.; Milfort, M.C.; Rekaya, R.; Aggrey, S.E. Expression of genes that encode cellular oxidant/antioxidant systems are affected by heat stress. Mol. Biol. Rep. 2018, 45, 389–394. [Google Scholar] [CrossRef] [PubMed]
- Orlowski, S.; Flees, J.; Greene, E.S.; Ashley, D.; Lee, S.O.; Yang, F.L.; Owens, C.M.; Kidd, M.; Anthony, N.; Dridi, S. Effects of phytogenic additives on meat quality traits in broiler chickens. J. Anim. Sci. 2018, 96, 3757–3767. [Google Scholar] [CrossRef]
- SAS. SAS/STAT Users Guide: Statistics; Version 6 ed.; SAS Inc.: Cary, NC, USA, 1990. [Google Scholar]
- Thiamhirunsopit, K.; Phisalaphong, C.; Boonkird, S.; Kijparkorn, S. Effect of chili meal (Capsicum frutescens LINN.) on growth performance, stress index, lipid peroxidation and ileal nutrient digestibility in broilers reared under high stocking density condition. Anim. Feed Sci. Technol. 2014, 192, 90–100. [Google Scholar] [CrossRef]
- Bravo, D.; Pirgozliev, V.; Rose, S.P. A mixture of carvacrol, cinnamaldehyde, and capsicum oleoresin improves energy utilization and growth performance of broiler chickens fed maize-based diet. J. Anim. Sci. 2014, 92, 1531–1536. [Google Scholar] [CrossRef] [Green Version]
- Pirgozliev, V.; Bravo, D.; Rose, S.P. Rearing conditions influence nutrient availability of plant extracts supplemented diets when fed to broiler chickens. J. Anim. Physiol. Anim. Nutr. 2014, 98, 667–671. [Google Scholar] [CrossRef]
- Abou-Elkhair, R.; Ahmed, H.A.; Selim, S. Effects of black pepper (Piper nigrum), turmeric powder (Curcuma longa) and coriander seeds (Coriandrum sativum) and their combinations as feed additives on growth performance, carcass traits, some blood parameters and humoral immune response of broiler chickens. Asian Australas J. Anim. Sci. 2014, 27, 847. [Google Scholar]
- Cardoso, V.S.; Lima, C.A.; Freire, M.E.; Dorneles, L.E.; Danelli, M.G. Piperine as a phytogenic additive in broiler diet. Poult. Sci. 2012, 47, 147–153. [Google Scholar] [CrossRef]
- Habibi, R.; Sadeghi, G.H.; Karimi, A. Effect of different concentrations of ginger root powder and its essential oil on growth performance, serum metabolites and antioxidant status in broiler chicks under heat stress. Br. Poult. Sci. 2014, 55, 228–237. [Google Scholar] [CrossRef] [PubMed]
- Wen, C.; Liu, Y.; Ye, Y.; Tao, Z.; Cheng, Z.; Wang, T.; Zhou, Y. Effects of gingerols-rich extract of ginger on growth performance, serum metabolites, meat quality and antioxidant activity of heat-stressed broilers. J. Therm. Biol. 2020, 89, 102544. [Google Scholar] [CrossRef] [PubMed]
- Abdelli, N.; Solà-Oriol, D.; Pérez, J.F. Phytogenic Feed Additives in Poultry: Achievements, Prospective and Challenges. Animals 2021, 11, 3471. [Google Scholar] [CrossRef] [PubMed]
- Prakash, U.N.; Srinivasan, K. Fat digestion and absorption in spice-pretreated rats. J. Sci. Food Agri. 2012, 92, 503–510. [Google Scholar] [CrossRef]
- Platel, K.; Srinivasan, K. Srinivasan. Influence of dietary spices and their active principles on pancreatic digestive enzymes in albino rats. Nahrung 2000, 44, 42–46. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, J.; Wang, T.; Zhang, J.; Zhang, L.; Wang, T. Effects of Capsaicin on Growth Performance, Meat Quality, Digestive Enzyme Activities, Intestinal Morphology, and Organ Indexes of Broilers. Front. Vet. Sci. 2022, 9, 841231. [Google Scholar] [CrossRef]
- Long, S.; Liu, S.; Wang, J.; Mahfuz, S.; Piao, X. Natural capsicum extract replacing chlortetracycline enhances performance via improving digestive enzyme activities, antioxidant capacity, anti-inflammatory function, and gut health in weaned pigs. Anim. Nutr. 2021, 7, 305–314. [Google Scholar] [CrossRef]
- Amber, K.; Badawy, N.A.; El-Sayd, A.E.N.A.; Morsy, W.A.; Hassan, A.M.; Dawood, M.A. Ginger root powder enhanced the growth productivity, digestibility, and antioxidative capacity to cope with the impacts of heat stress in rabbits. J. Therm. Biol. 2021, 100, 103075. [Google Scholar] [CrossRef]
- Khan, R.U.; Naz, S.; Nikousefat, Z.; Tufarelli, V.; Javdani, M.; Qureshi, M.S.; Laudadio, V. Potential applications of ginger (Zingiber officinale) in poultry diets. Worlds Poult. Sci. J. 2012, 68, 245–252. [Google Scholar] [CrossRef] [Green Version]
- Meghwal, M.; Goswami, T.K. Piper nigrum and piperine: An update. Phytother. Res. 2013, 27, 1121–1130. [Google Scholar] [CrossRef] [PubMed]
- Oso, A.O.; Suganthi, R.U.; Reddy, G.B.M.; Malik, P.K.; Thirumalaisamy, G.; Awachat, V.B.; Selvaraju, S.; Arangasamy, A.; Bhatta, R. Effect of dietary supplementation with phytogenic blend on growth performance, apparent ileal digestibility of nutrients, intestinal morphology, and cecal microflora of broiler chickens. Poult. Sci. 2019, 98, 4755–4766. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.T.; Lin, W.C.; Yu, B.; Lee, T.T. Antioxidant capacity of phytochemicals and their potential effects on oxidative status in animals—A review. Asian Australas J. Anim. Sci. 2017, 30, 299. [Google Scholar] [CrossRef] [PubMed]
- Mishra, B.; Jha, R. Oxidative stress in the poultry gut: Potential challenges and interventions. Front. Vet. Sci. 2019, 6, 60. [Google Scholar] [CrossRef] [Green Version]
- Ognik, K.; Czech, A.; Stachyra, K. Effect of a natural versus a synthetic antioxidant, and sex and age on the redox profile in the blood of growing turkeys. S. Afr. J. Anim. Sci. 2013, 43, 473–481. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.T.; Lin, W.C.; Lee, T.T. Potential crosstalk of oxidative stress and immune response in poultry through phytochemicals-A review. Asian Australas J. Anim. Sci. 2019, 32, 309. [Google Scholar] [CrossRef]
- Mueller, K.; Blum, N.M.; Kluge, H.; Mueller, A.S. Influence of broccoli extract and various essential oils on performance and expression of xenobiotic and antioxidant enzymes in broiler chickens. Br. J. Nutr. 2012, 108, 588–602. [Google Scholar] [CrossRef]
Item | Basal Diet |
---|---|
Maize | 50.88 |
Soybean meal (46.5% CP) | 39.97 |
Lard | 4.00 |
Dicalcium phosphate | 1.97 |
Calcium carbonate | 1.11 |
Titanium dioxide | 0.50 |
Vitamins and Minerals 1 | 0.50 |
Sodium bicarbonate | 0.32 |
DL-methionine | 0.30 |
Sodium chloride | 0.23 |
L-lysine HCl | 0.16 |
L-threonine | 0.06 |
Calculated composition | |
AMEn 2 (kcal/kg) | 2950 |
Crude fiber | 2.91 |
Crude protein | 22.7 |
Lysine | 1.22 |
Methionine | 0.60 |
Methionine + cysteine | 0.90 |
Threonine | 0.79 |
Tryptophan | 0.24 |
Calcium | 1.02 |
Digestible phosphorus | 0.45 |
Sodium | 0.19 |
Analyzed composition (% DM) | |
Dry matter | 89.3 |
TiO2 | 0.46 |
Crude protein | 23.8 |
Ether extract | 6.50 |
Gross energy (kcal/kg) | 4035 |
Gene 1 | 5′-Primer Sequence Forward-3′ | 5′-Primer Sequence Reverse-3′ | Reference |
---|---|---|---|
UB | GGGATGCAGATCTTCGTGAAA | CTTGCCAGCAAAGATCAACCTT | [27] |
ACTB | GTGATGGACTCTGGTGATGG | TGGTGAAGCTGTAGCCTCTC | [28] |
CAT | GAGATGGTGAGGGCAGTTATT | GCCAATGTATGAGGAGGTTAGT | [29] |
GPx1 | CCACTTCGAGACCATCAAACT | GGTGCGGGCTTTCCTTTA | [29] |
SOD1 | TGGCTTCCATGTGCATGAAT | AGCACCTGCGCTGGTACAC | [30] |
Nrf2 | CAGAAGCTTTCCCGTTCATAGA | TGGGTGGCTGAGTTTGATTAG | [29] |
Item 2 | CONTROL | SPICY | p-Value |
---|---|---|---|
BW (g/bird) | |||
0 d | 42.5 ± 0.17 | 42.6 ± 0.18 | 0.55 |
7 d | 173 ± 1.36 | 177 ± 0.90 | 0.007 |
14 d | 494 ± 3.20 | 501 ± 3.89 | 0.15 |
20 d | 973 ± 4.64 | 982 ± 10.0 | 0.43 |
0’7 d | |||
ADG (g/bird/d) | 18.6 ± 0.18 | 19.3 ± 0.12 | 0.005 |
ADFI (g/bird/d) | 17.8 ± 0.19 | 17.9 ± 0.14 | 0.87 |
FCR (g/g) | 0.94 ± 0.004 | 0.93 ± 0.005 | 0.054 |
7’14 d | |||
ADG (g/bird/d) | 46.1 ± 0.19 | 46.3 ± 0.40 | 0.61 |
ADFI (g/bird/d) | 52.6 ± 0.36 | 53.4 ± 0.55 | 0.22 |
FCR (g/g) | 1.15 ± 0.006 | 1.15 ± 0.004 | 0.59 |
14’20 d | |||
ADG (g/bird/d) | 79.9 ± 0.69 | 80.3 ± 1.15 | 0.76 |
ADFI (g/bird/d) | 92.5 ± 0.78 | 93.6 ± 1.11 | 0.44 |
FCR (g/g) | 1.16 ± 0.005 | 1.17 ± 0.012 | 0.66 |
0’20 d | |||
ADG (g/bird/d) | 46.5 ± 0.23 | 47.0 ± 0.50 | 0.43 |
ADFI (g/bird/d) | 52.5 ± 0.30 | 53.0 ± 0.39 | 0.36 |
FCR (g/g) | 1.13 ± 0.004 | 1.13 ± 0.006 | 0.99 |
Item | CONTROL | SPICY | p-Value |
---|---|---|---|
Dry matter | 62.9 ± 1.15 | 66.3 ± 0.54 | 0.016 |
Gross energy | 67.2 ± 1.06 | 70.2 ± 0.50 | 0.022 |
Ether extract | 80.8 ± 1.10 | 82.1 ± 0.93 | 0.39 |
Crude protein | 79.2 ± 0.52 | 80.9 ± 0.54 | 0.031 |
Item | CONTROL | SPICY | p-Value |
---|---|---|---|
Amylase 2 (U/mL) | 174 ± 18 | 254 ± 35 | 0.063 |
Trypsin 3 (mU/mL) | 411 ± 47 | 415 ± 76 | 0.96 |
Lipase 4 (mU/mL) | 0.58 ± 0.14 | 0.66 ± 0.14 | 0.68 |
Item | CONTROL | SPICY | p-Value |
---|---|---|---|
α-tocopherol (µg/mL) | 6.09 ± 0.37 | 6.90 ± 0.40 | 0.16 |
GPx (mU/mL) 2 | 3283 ± 132 | 3329 ± 122 | 0.80 |
GST (mU/mL) 3 | 27.4 ± 1.17 | 30.4 ± 1.51 | 0.13 |
SOD (%) 4 | 43.5 ± 7.07 | 39.5 ± 3.61 | 0.59 |
CAT (U/mL) 5 | 1.54 ± 0.070 | 1.30 ± 0.080 | 0.041 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herrero-Encinas, J.; Huerta, A.; Blanch, M.; Pastor, J.J.; Morais, S.; Menoyo, D. Impact of Dietary Supplementation of Spice Extracts on Growth Performance, Nutrient Digestibility and Antioxidant Response in Broiler Chickens. Animals 2023, 13, 250. https://doi.org/10.3390/ani13020250
Herrero-Encinas J, Huerta A, Blanch M, Pastor JJ, Morais S, Menoyo D. Impact of Dietary Supplementation of Spice Extracts on Growth Performance, Nutrient Digestibility and Antioxidant Response in Broiler Chickens. Animals. 2023; 13(2):250. https://doi.org/10.3390/ani13020250
Chicago/Turabian StyleHerrero-Encinas, Javier, Almudena Huerta, Marta Blanch, José Javier Pastor, Sofia Morais, and David Menoyo. 2023. "Impact of Dietary Supplementation of Spice Extracts on Growth Performance, Nutrient Digestibility and Antioxidant Response in Broiler Chickens" Animals 13, no. 2: 250. https://doi.org/10.3390/ani13020250
APA StyleHerrero-Encinas, J., Huerta, A., Blanch, M., Pastor, J. J., Morais, S., & Menoyo, D. (2023). Impact of Dietary Supplementation of Spice Extracts on Growth Performance, Nutrient Digestibility and Antioxidant Response in Broiler Chickens. Animals, 13(2), 250. https://doi.org/10.3390/ani13020250