Effect of a Plateau Environment on the Oxidation State of the Heart and Liver through AMPK/p38 MAPK/Nrf2-ARE Signaling Pathways in Tibetan and DLY Pigs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Pig and Experimental Design
2.2. Sample Collection
2.3. Analysis of the Oxidation Index
2.4. Analysis of Nrf2, AMPK and p38 MAPK Levels
2.5. Gene Expression Analysis
2.6. Statistical Analysis
3. Results
3.1. Effects of the Plateau Environment on MDA in TPs and DLY Pigs
3.2. Effects of the Plateau Environment on Antioxidant Activity in TPs and DLY Pigs
3.3. Effects of the Plateau Environment on mRNA levels of SOD, GSH-Px, and CAT in TPs and DLY Pigs
3.4. Effects of the Plateau Environment on mRNA and Protein Expression Levels of AMPK in TPs and DLY Pigs
3.5. Effects of the Plateau Environment on mRNA and Protein Expression Levels of p38 MAPK in TPs and DLY Pigs
3.6. Effects of the Plateau Environment on mRNA and Protein Expression Levels of Nrf2 in TPs and DLY Pigs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hao, Y.; Xing, M.; Gu, X. Research progress on oxidative stress and its nutritional regulation strategies in pigs. Animals 2021, 11, 1384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, S.; Chen, D.; Zhang, K. Effects of oxidative stress on growth performance, nutrient digestibilities and activities of antioxidative enzymes of weanling pigs. Asian-Australas. J. Anim. Sci. 2007, 20, 1600–1605. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Lu, X.; Cheng, Z.; Tian, M.; Qiangba, Y.; Fu, Q.; Ren, Z. Comparative proteomic analysis of Tibetan pig spermatozoa at high and low altitudes. BMC Genom. 2019, 20, 1–8. [Google Scholar]
- Dosek, A.; Ohno, H.; Acs, Z.; Taylor, A.W.; Radak, Z. High altitude and oxidative stress. Respir. Physiol. Neurobiol. 2007, 158, 128–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, P.; Giri, A.; Bharti, V.K.; Kumar, K.; Chaurasia, O.P. Evaluation of various biochemical stress markers and morphological traits in different goat breeds at high-altitude environment. Biol. Rhythm Res. 2021, 52, 261–272. [Google Scholar] [CrossRef] [Scilit]
- Venardos, K.M.; Kaye, D.M. Myocardial ischemia-reperfusion injury, antioxidant enzyme systems, and selenium: A review. Curr. Med. Chem. 2007, 14, 1539–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.Y.; Fu, Z.J.; Lo, A.C. Hypoxia-induced oxidative stress in ischemic retinopathy. Oxid. Med. Cell. Longev. 2012, 2012, 426769. [Google Scholar] [CrossRef] [Scilit]
- Ai, H.; Yang, B.; Li, J.; Xie, X.; Chen, H.; Ren, J. Population history and genomic signatures for high-altitude adaptation in Tibetan pigs. BMC Genom. 2014, 15, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.F.; Han, X.M.; Huang, C.P.; Zhong, L.; Adeola, A.C.; Irwin, D.M.; Xie, H.B.; Zhang, Y.P. Population genomics analysis revealed origin and high-altitude adaptation of Tibetan pigs. Sci. Rep. 2019, 9, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Zeng, B.; Zhang, S.; Xu, H.; Kong, F.; Yu, X.; Wang, P.; Yang, M.; Li, D.; Zhang, M.; Ni, Q.; et al. Gut microbiota of Tibetans and Tibetan pigs varies between high and low altitude environments. Microbiol. Res. 2020, 235, 126447. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Ren, Q.; Hua, L.; Chen, J.; Zhang, J.; Bai, H.; Li, H.; Xu, B.; Shi, Z.; Cao, H.; et al. Comprehensive analysis of differentially expressed mRNA, lncRNA and circRNA and their ceRNA networks in the longissimus dorsi muscle of two different pig breeds. Int. J. Mol. Sci. 2019, 20, 1107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Yan, X.L.; Liu, R.; Fu, Q.Q.; Zhou, G.H.; Zhang, W.G. Differences in calpain system, desmin degradation and water holding capacity between commercial Meishan and Duroc × Landrace × Yorkshire crossbred pork. Anim. Sci. J. 2016, 87, 109–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasper, C.; Ribeiro, D.; Almeida, A.M.D.; Larzul, C.; Liaubet, L.; Murani, E. Omics application in animal science—a special emphasis on stress response and damaging behaviour in pigs. Genes 2020, 11, 920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, B.; Chamba, Y.; Shang, P.; Wang, Z.; Ma, J.; Wang, L.; Zhang, H. Comparative transcriptomic and proteomic analyses provide insights into the key genes involved in high-altitude adaptation in the Tibetan pig. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Hasan, Y.M.; Evans, L.S.C.; Pinkas, G.A.; Dabkowski, E.R.; Stanley, W.C.; Thompson, L.P. Chronic hypoxia impairs cytochrome oxidase activity via oxidative stress in selected fetal Guinea pig organs. Reprod. Sci. 2013, 20, 299–307. [Google Scholar] [CrossRef] [Scilit]
- Majd, S.; Power, J.H.; Chataway, T.K.; Grantham, H.J. A comparison of LKB1/AMPK/mTOR metabolic axis response to global ischaemia in brain, heart, liver and kidney in a rat model of cardiac arrest. BMC Cell Biol. 2018, 19, 1–12. [Google Scholar] [CrossRef] [Scilit]
- China NY/T 65–2004; Feeding Standard of Swine, China. China Agricultural Publisher: Beijing, China, 2004.
- Zhang, J.F.; Bai, K.W.; Su, W.P.; Wang, A.A.; Zhang, L.L.; Huang, K.H.; Wang, T. Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of GSH-related antioxidant enzymes and Nrf2-mediated phase II detoxifying enzyme systems in broiler chickens. Poultry. Sci. 2018, 97, 1209–1219. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Beall, C.M. Tibetan and Andean patterns of adaptation to high-altitude hypoxia. Hum. Biol. 2000, 72, 201–228. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Li, D.; Gaur, U.; Chen, B.; Zhao, X.; Wang, Y.; Yin, H.; Zhu, Q. The comparison of blood characteristics in low-and high-altitude chickens. Ital. J. Anim. Sci. 2018, 17, 195–201. [Google Scholar] [CrossRef] [Scilit]
- Chawla, S.; Saxena, S. Physiology of high-altitude acclimatization. Resonance 2014, 19, 538–548. [Google Scholar] [CrossRef] [Scilit]
- Pena, E.; El-Alam, S.; Siques, P.; Brito, J.; El-Alam. Oxidative stress and diseases associated with high-altitude exposure. Antioxidants 2022, 11, 267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, B.; Ban, D.; Gou, X.; Zhang, Y.; Yang, L.; Chamba, Y.; Zhang, H. Genome-wide DNA methylation profiles in Tibetan and Yorkshire pigs under high-altitude hypoxia. J. Anim. Sci. Biotechnol. 2019, 10, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaur, P.; Prasad, S.; Kumar, B.; Sharma, S.K.; Vats, P. High-altitude hypoxia induced reactive oxygen species generation, signaling, and mitigation approaches. Int. J. Biometeorol. 2021, 65, 601–615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Y.; Zhao, X.; Yu, J.; Xie, J.; Li, C.; Liu, D.; Tang, C.; Wang, C. Lead-induced oxidative damage in rats/mice: A meta-analysis. J. Trace Elem. Med. Biol. 2020, 58, 126443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diao, H.; Yan, H.L.; Xiao, Y.; Yu, B.; Yu, J.; He, J.; Zheng, P.; Zeng, B.H.; Wei, H.; Mao, X.B.; et al. Intestinal microbiota could transfer host Gut characteristics from pigs to mice. BMC Microbiol. 2016, 16, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Prokić, M.D.; Petrović, T.G.; Gavrić, J.P.; Despotović, S.G.; Gavrilović, B.R.; Radovanović, T.B.; Faggio, C.; Saičić, Z.S. Comparative assessment of the antioxidative defense system in subadult and adult anurans: A lesson from the Bufotes viridis toad. Zoology 2018, 130, 30–37. [Google Scholar] [CrossRef] [Scilit]
- Tang, D.; Wu, J.; Jiao, H.; Wang, X.; Zhao, J.; Lin, H. The development of antioxidant system in the intestinal tract of broiler chickens. Poultry Sci. 2019, 98, 664–678. [Google Scholar] [CrossRef] [Scilit]
- Hu, H.; Bai, X.; Xu, K.; Zhang, C.; Chen, L. Effect of phloretin on growth performance, serum biochemical parameters and antioxidant profile in heat-stressed broilers. Poultry Sci. 2021, 100, 101217. [Google Scholar] [CrossRef] [Scilit]
- Zhao, M.; Zhu, P.; Fujino, M.; Zhuang, J.; Guo, H.; Sheikh, I.; Zhao, L.; Li, X. Oxidative stress in hypoxic-ischemic encephalopathy: Molecular mechanisms and therapeutic strategies. Int. J. Mol. Sci. 2016, 17, 2078. [Google Scholar] [CrossRef] [Scilit]
- Giordano, F.J. Oxygen, oxidative stress, hypoxia, and heart failure. J. Clin. Investig. 2005, 115, 500–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maimaitiyiming, D.; Hu, G.; Aikemu, A.; Hui, S.W.; Zhang, X. The treatment of Uygur medicine Dracocephalum moldavica L on chronic mountain sickness rat model. Pharmacogn. Mag. 2014, 10, 477–482. [Google Scholar] [PubMed]
- Lee, S.Y.; Li, M.H.; Shi, L.S.; Chu, H.; Ho, C.W.; Chang, T.C. Rhodiola crenulata extract alleviates hypoxic pulmonary edema in rats. Evid. Based Complementary Altern. Med. 2013, 2013, 718739. [Google Scholar]
- Pu, X.; Lin, X.; Duan, X.; Wang, J.; Shang, J.; Yun, H.; Chen, Z. Oxidative and endoplasmic reticulum stress responses to chronic high-altitude exposure during the development of high-altitude pulmonary hypertension. High Alt. Med. Biol. 2020, 21, 378–387. [Google Scholar] [CrossRef] [Scilit]
- Lv, J.; Xie, M.; Zhao, S.; Qiu, W.; Wang, S.; Cao, M. Nestin is essential for cellular redox homeostasis and gastric cancer metastasis through the mediation of the Keap1–Nrf2 axis. Cancer Cell Int. 2021, 21, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Liang, M.; Wang, Z.; Li, H.; Cai, L.; Pan, J.; He, H.; Wu, Q.; Tang, Y.; Ma, J.; Yang, L. l-Arginine induces antioxidant response to prevent oxidative stress via stimulation of glutathione synthesis and activation of Nrf2 pathway. Food. Chem. Toxicol. 2018, 115, 315–328. [Google Scholar] [CrossRef] [Scilit]
- Auciello, F.R.; Ross, F.A.; Ikematsu, N.; Hardie, D.G. Oxidative stress activates AMPK in cultured cells primarily by increasing cellular AMP and/or ADP. FEBS Lett. 2014, 588, 3361–3366. [Google Scholar] [CrossRef] [Scilit]
- Rehman, S.U.; Ikram, M.; Ullah, N.; Alam, S.I.; Park, H.Y.; Badshah, H.; Choe, K.; Kim, M.O. Neurological enhancement effects of melatonin against brain injury-induced oxidative stress, neuroinflammation, and neurodegeneration via AMPK/CREB signaling. Cells 2019, 8, 760. [Google Scholar] [CrossRef] [Scilit]
- Mahmoud, A.D.; Lewis, S.; Juričić, L.; Udoh, U.A.; Hartmann, S.; Jansen, M.A.; Ogunbayo, O.A.; Puggioni, P.; Holmes, A.P.; Kumar, P.; et al. AMP-activated protein kinase deficiency blocks the hypoxic ventilatory response and thus precipitates hypoventilation and apnea. Am. J. Respir. Crit. Care Med. 2016, 193, 1032–1043. [Google Scholar] [CrossRef] [Scilit]
- Hao, Z.; Li, Z.; Huo, J.; Li, J.; Liu, F.; Yin, P. Effects of Chinese wolfberry and Astragalus extract on the antioxidant capacity of Tibetan pig liver. PLoS ONE 2021, 16, e0245749. [Google Scholar] [CrossRef] [Scilit]
- Mo, C.; Wang, L.; Zhang, J.; Numazawa, S.; Tang, H.; Tang, X.; Han, X.; Li, J.H.; Yang, M.; Wang, Z.; et al. The crosstalk between Nrf2 and AMPK signal pathways is important for the anti-inflammatory effect of berberine in LPS-stimulated macrophages and endotoxin-shocked mice. Antioxid. Redox Signal. 2014, 20, 574–588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Liu, W.Z.; Liu, T.; Feng, X.; Yang, N.; Zhou, H.F. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J. Recept. Signal Transduct. 2015, 35, 600–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arunachalam, S.; Nagoor-Meeran, M.F.; Azimullah, S.; Sharma, C.; Goyal, S.N.; Ojha, S. Nerolidol attenuates oxidative stress, inflammation, and apoptosis by modulating Nrf2/MAPK signaling pathways in doxorubicin-induced acute cardiotoxicity in rats. Antioxidants 2021, 10, 984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tormos, A.M.; Talens-Visconti, R.; Nebreda, A.R.; Sastre, J. p38 MAPK: A dual role in hepatocyte proliferation through reactive oxygen species. Free Radical Res. 2013, 47, 905–916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herlaar, E.; Brown, Z. p38 MAPK signalling cascades in inflammatory disease. Mol. Med. Today 1999, 5, 439–447. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.Y.; Tan, M.G.; Wong, P.T.; Herr, D.R.; Lai, M.K. Andrographolide induces Nrf2 and heme oxygenase 1 in astrocytes by activating p38 MAPK and ERK. J. Neuroinflamm. 2016, 13, 1–12. [Google Scholar] [CrossRef] [Scilit]






| Items | Content (%) |
|---|---|
| Corn | 42.00 |
| Soybean meal | 11.50 |
| Naked barley | 13.00 |
| Wheat bran | 29.5 |
| L-lysine hydrochloride | 0.31 |
| DL- Methionine | 0.01 |
| L-Threonine | 0.03 |
| CaHPO4•2H2O | 0.85 |
| NaCl | 0.12 |
| Limestone | 1.68 |
| Vitamin and mineral premix | 1.00 |
| Total | 100.00 |
| Nutrient levels | |
| Digestible energy, MJ/kg | 11.70 |
| Crude protein | 14.01 |
| Calcium | 0.60 |
| Phosphorus | 0.40 |
| Lysine | 0.87 |
| Methionine | 0.24 |
| Gene | Forward Primer | Reverse Primer | Size (bp) | Accession No. |
|---|---|---|---|---|
| SOD | ATTCTGTGATCGCCCTCT | CTTTCTTCATTTCCACCTCT | 100 | NM_001190422.1 |
| GSH-Px | TTGCCAAGTCCTTCTACGA | GAAGCCAAGAACCACCAG | 188 | NM_001115136.1 |
| CAT | CGAAGGCGAAGGTGTT | CCACGAGGGTCACGAA | 109 | NM_214301.2 |
| AMPK | TTGACTCGGCCCCATCCT | GTATGGCGTGCCCTTGGA | 65 | NM_001167633.1 |
| p38 MAPK | ACAAGACAATCTGGGAGGTA | CACTGCAACACGTAACCC | 116 | XM_013977842.2 |
| Nrf2 | CACCACCTCAGGGTAATA | GCGGCTTGAATGTTTGTC | 125 | XM_021075133.1 |
| β-actin | CTGCGGCATCCACGAAACT | AGGGCCGTGATCTCCTTCTG | 147 | DQ845171.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, H.; Li, Y.; Yang, Y.; Xu, K.; Yang, L.; Qiao, S.; Pan, H. Effect of a Plateau Environment on the Oxidation State of the Heart and Liver through AMPK/p38 MAPK/Nrf2-ARE Signaling Pathways in Tibetan and DLY Pigs. Animals 2022, 12, 1219. https://doi.org/10.3390/ani12091219
Hu H, Li Y, Yang Y, Xu K, Yang L, Qiao S, Pan H. Effect of a Plateau Environment on the Oxidation State of the Heart and Liver through AMPK/p38 MAPK/Nrf2-ARE Signaling Pathways in Tibetan and DLY Pigs. Animals. 2022; 12(9):1219. https://doi.org/10.3390/ani12091219
Chicago/Turabian StyleHu, Hong, Yongxiang Li, Yuting Yang, Kexing Xu, Lijie Yang, Shiyan Qiao, and Hongbin Pan. 2022. "Effect of a Plateau Environment on the Oxidation State of the Heart and Liver through AMPK/p38 MAPK/Nrf2-ARE Signaling Pathways in Tibetan and DLY Pigs" Animals 12, no. 9: 1219. https://doi.org/10.3390/ani12091219
APA StyleHu, H., Li, Y., Yang, Y., Xu, K., Yang, L., Qiao, S., & Pan, H. (2022). Effect of a Plateau Environment on the Oxidation State of the Heart and Liver through AMPK/p38 MAPK/Nrf2-ARE Signaling Pathways in Tibetan and DLY Pigs. Animals, 12(9), 1219. https://doi.org/10.3390/ani12091219
