Early Exposure to Environmental Pollutants: Imidacloprid Potentiates Cadmium Toxicity on Zebrafish Retinal Cells Death
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Zebrafish Maintenance and Embryo Collection
2.2. Survival Rate, Hatching Rate and Morphology Score
2.3. Gene Expression Analysis
2.4. Acridine Orange and Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL)
2.5. Morphological Assessment
2.6. Detection of Reactive Oxygen Species (ROS) and Lipid Peroxidation
2.7. Statistical Evaluation
3. Results
3.1. Survival Rate, Hatching Rate and Morphology
3.2. Cell Apoptosis
3.3. Gene Expression
3.4. Lipid Peroxidation and Reactive Oxygen Species(ROS) Formation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Van Dijk, T.C.; Van Staalduinen, M.A.; Van der Sluijs, J.P. Macro-invertebrate decline in surface water polluted with imidacloprid. PLoS ONE 2013, 8, e62374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simon-Delso, N.; Amaral-Rogers, V.; Belzunces, L.P.; Bonmatin, J.-M.; Chagnon, M.; Downs, C.; Furlan, L.; Gibbons, D.W.; Giorio, C.; Girolami, V. Systemic insecticides (neonicotinoids and fipronil): Trends, uses, mode of action and metabolites. Environ. Sci. Pollut. Res. 2015, 22, 5–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonmatin, J.-M.; Giorio, C.; Girolami, V.; Goulson, D.; Kreutzweiser, D.; Krupke, C.; Liess, M.; Long, E.; Marzaro, M.; Mitchell, E.A. Environmental fate and exposure; neonicotinoids and fipronil. Environ. Sci. Pollut. Res. 2015, 22, 35–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moschet, C.; Wittmer, I.; Simovic, J.; Junghans, M.; Piazzoli, A.; Singer, H.; Stamm, C.; Leu, C.; Hollender, J. How a complete pesticide screening changes the assessment of surface water quality. Environ. Sci. Technol. 2014, 48, 5423–5432. [Google Scholar] [CrossRef] [Scilit]
- Hayasaka, D.; Korenaga, T.; Suzuki, K.; Saito, F.; Sánchez-Bayo, F.; Goka, K. Cumulative ecological impacts of two successive annual treatments of imidacloprid and fipronil on aquatic communities of paddy mesocosms. Ecotoxicol. Environ. Saf. 2012, 80, 355–362. [Google Scholar] [CrossRef] [Scilit]
- Gibbons, D.; Morrissey, C.; Mineau, P. A review of the direct and indirect effects of neonicotinoids and fipronil on vertebrate wildlife. Environ. Sci. Pollut. Res. 2015, 22, 103–118. [Google Scholar] [CrossRef] [Scilit]
- Crosby, E.B.; Bailey, J.M.; Oliveri, A.N.; Levin, E.D. Neurobehavioral impairments caused by developmental imidacloprid exposure in zebrafish. Neurotoxicol. Teratol. 2015, 49, 81–90. [Google Scholar] [CrossRef] [Scilit]
- Paola, D.D.; Capparucci, F.; Natale, S.; Crupi, R.; Cuzzocrea, S.; Spanò, N.; Gugliandolo, E.; Peritore, A.F. Combined Effects of Potassium Perchlorate and a Neonicotinoid on Zebrafish Larvae (Danio rerio). Toxics 2022, 10, 203. [Google Scholar] [CrossRef] [Scilit]
- Key, P.; Chung, K.; Siewicki, T.; Fulton, M. Toxicity of three pesticides individually and in mixture to larval grass shrimp (Palaemonetes pugio). Ecotoxicol. Environ. Saf. 2007, 68, 272–277. [Google Scholar] [CrossRef] [Scilit]
- Grung, M.; Lin, Y.; Zhang, H.; Steen, A.O.; Huang, J.; Zhang, G.; Larssen, T. Pesticide levels and environmental risk in aquatic environments in China—A review. Environ. Int. 2015, 81, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Sillman, A.; Bolnick, D.; Bosetti, J.; Haynes, L.; Walter, A. The effects of lead and of cadmium on the mass photoreceptor potential: The dose-response relationship. Neurotoxicology 1982, 3, 179–194. [Google Scholar]
- Di Paola, D.; Natale, S.; Iaria, C.; Crupi, R.; Cuzzocrea, S.; Spanò, N.; Gugliandolo, E.; Peritore, A.F. Environmental Co-Exposure to Potassium Perchlorate and Cd Caused Toxicity and Thyroid Endocrine Disruption in Zebrafish Embryos and Larvae (Danio rerio). Toxics 2022, 10, 198. [Google Scholar] [CrossRef] [Scilit]
- Di Paola, D.; Capparucci, F.; Lanteri, G.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S. Combined toxicity of xenobiotics Bisphenol A and heavy metals on zebrafish embryos (Danio rerio). Toxics 2021, 9, 344. [Google Scholar] [CrossRef] [Scilit]
- Buschmann, J. The OECD guidelines for the testing of chemicals and pesticides. Methods Mol. Biol. 2013, 947, 37–56. [Google Scholar] [CrossRef] [Scilit]
- Cheng, S.H.; Wai, A.W.K.; So, C.H.; Wu, R.S.S. Cellular and molecular basis of cadmium-induced deformities in zebrafish embryos. Environ. Toxicol. Chem. Int. J. 2000, 19, 3024–3031. [Google Scholar] [CrossRef]
- Parenti, C.C.; Ghilardi, A.; Della Torre, C.; Magni, S.; Del Giacco, L.; Binelli, A. Evaluation of the infiltration of polystyrene nanobeads in zebrafish embryo tissues after short-term exposure and the related biochemical and behavioural effects. Environ. Pollut. 2019, 254, 112947. [Google Scholar] [CrossRef] [Scilit]
- Di Paola, D.; Capparucci, F.; Abbate, J.M.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Genovese, T.; Impellizzeri, D. Environmental Risk Assessment of Oxaliplatin Exposure on Early Life Stages of Zebrafish (Danio rerio). Toxics 2022, 10, 81. [Google Scholar] [CrossRef] [Scilit]
- Di Paola, D.; Iaria, C.; Lanteri, G.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S. Sensitivity of Zebrafish Embryogenesis to Risk of Fotemustine Exposure. Fishes 2022, 7, 67. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.; Chen, R.; Liu, W.; Fu, Z. Effect of endocrine disrupting chemicals on the transcription of genes related to the innate immune system in the early developmental stage of zebrafish (Danio rerio). Fish Shellfish Immunol. 2010, 28, 854–861. [Google Scholar] [CrossRef] [Scilit]
- Varela, M.; Dios, S.; Novoa, B.; Figueras, A. Characterisation, expression and ontogeny of interleukin-6 and its receptors in zebrafish (Danio rerio). Dev. Comp. Immunol. 2012, 37, 97–106. [Google Scholar] [CrossRef] [Scilit]
- Di Paola, D.; Iaria, C.; Capparucci, F.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S. Aflatoxin B1 Toxicity in Zebrafish Larva (Danio rerio): Protective Role of Hericium erinaceus. Toxins 2021, 13, 710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Takagi, N.; Yuan, B.; Zhou, Y.; Si, N.; Wang, H.; Yang, J.; Wei, X.; Zhao, H.; Bian, B. The protection of indolealkylamines from LPS-induced inflammation in zebrafish. J. Ethnopharmacol. 2019, 243, 112122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hunt, R.F.; Hortopan, G.A.; Gillespie, A.; Baraban, S.C. A novel zebrafish model of hyperthermia-induced seizures reveals a role for TRPV4 channels and NMDA-type glutamate receptors. Exp. Neurol. 2012, 237, 199–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steenbergen, P.J.; Bardine, N. Antinociceptive effects of buprenorphine in zebrafish larvae: An alternative for rodent models to study pain and nociception? Appl. Anim. Behav. Sci. 2014, 152, 92–99. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.; Fu, X.; Liu, N.; Duan, D.; Wang, X.; Xu, J.; Gao, X. The synergistic anti-inflammatory activities of agaro-oligosaccharides with different degrees of polymerization. J. Appl. Phycol. 2019, 31, 2547–2558. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.; Zhou, B. The role of Nrf2 and MAPK pathways in PFOS-induced oxidative stress in zebrafish embryos. Toxicol. Sci. 2010, 115, 391–400. [Google Scholar] [CrossRef] [Scilit]
- Morrissey, C.A.; Mineau, P.; Devries, J.H.; Sanchez-Bayo, F.; Liess, M.; Cavallaro, M.C.; Liber, K. Neonicotinoid contamination of global surface waters and associated risk to aquatic invertebrates: A review. Environ. Int. 2015, 74, 291–303. [Google Scholar] [CrossRef] [Scilit]
- Anderson, J.; Dubetz, C.; Palace, V. Neonicotinoids in the Canadian aquatic environment: A literature review on current use products with a focus on fate, exposure, and biological effects. Sci. Total Environ. 2015, 505, 409–422. [Google Scholar] [CrossRef] [Scilit]
- Sreenivasa Rao, A.; Pillala, R.R. The concentration of pesticides in sediments from Kolleru Lake in India. Pest Manag. Sci. Former. Pestic. Sci. 2001, 57, 620–624. [Google Scholar] [CrossRef]
- Singh, S.K.; Singh, S.K.; Yadav, R.P. Toxicological and biochemical alterations of Cypermethrin (synthetic pyrethroids) against freshwater teleost Fish Colisa fasciatus at different season. World J. Zool 2010, 5, 25–32. [Google Scholar]
- Kosygin, L.; Dhamendra, H.; Gyaneshwari, R. Pollution status and conservation strategies of Moirang river, Manipur with a note on its aquatic bio-resources. J. Environ. Biol. 2007, 28, 669–673. [Google Scholar]
- Murthy, K.S.; Kiran, B.; Venkateshwarlu, M. A review on toxicity of pesticides in Fish. Int. J. Open Sci. Res. 2013, 1, 15–36. [Google Scholar]
- Wang, S.; Hong, H.; Wang, X. Bioenergetic responses in green lipped mussels (Perna viridis) as indicators of pollution stress in Xiamen coastal waters, China. Mar. Pollut. Bull. 2005, 51, 738–743. [Google Scholar] [CrossRef] [Scilit]
- Asharani, P.; Wu, Y.L.; Gong, Z.; Valiyaveettil, S. Toxicity of silver nanoparticles in zebrafish models. Nanotechnology 2008, 19, 255102. [Google Scholar] [CrossRef] [Scilit]
- Deng, J.; Yu, L.; Liu, C.; Yu, K.; Shi, X.; Yeung, L.W.; Lam, P.K.; Wu, R.S.; Zhou, B. Hexabromocyclododecane-induced developmental toxicity and apoptosis in zebrafish embryos. Aquat. Toxicol. 2009, 93, 29–36. [Google Scholar] [CrossRef] [Scilit]
- Pereira, S.; Bourrachot, S.; Cavalie, I.; Plaire, D.; Dutilleul, M.; Gilbin, R.; Adam-Guillermin, C. Genotoxicity of acute and chronic gamma-irradiation on zebrafish cells and consequences for embryo development. Environ. Toxicol. Chem. 2011, 30, 2831–2837. [Google Scholar] [CrossRef] [Scilit]
- Pereira, S.; Malard, V.; Ravanat, J.-L.; Davin, A.-H.; Armengaud, J.; Foray, N.; Adam-Guillermin, C. Low doses of gamma-irradiation induce an early bystander effect in zebrafish cells which is sufficient to radioprotect cells. PLoS ONE 2014, 9, e92974. [Google Scholar] [CrossRef] [Scilit]
- Di Paola, D.; Natale, S.; Gugliandolo, E.; Cordaro, M.; Crupi, R.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S. Assessment of 2-Pentadecyl-2-oxazoline Role on Lipopolysaccharide-Induced Inflammation on Early Stage Development of Zebrafish (Danio rerio). Life 2022, 12, 128. [Google Scholar] [CrossRef] [Scilit]
- Bladen, C.L.; Flowers, M.A.; Miyake, K.; Podolsky, R.H.; Barrett, J.T.; Kozlowski, D.J.; Dynan, W.S. Quantification of ionizing radiation-induced cell death in situ in a vertebrate embryo. Radiat. Res. 2007, 168, 149–157. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Yang, G.; Dai, D.; Xu, Z.; Cai, L.; Wang, Q.; Yu, Y. Individual and mixture effects of five agricultural pesticides on zebrafish (Danio rerio) larvae. Environ. Sci. Pollut. Res. 2017, 24, 4528–4536. [Google Scholar] [CrossRef] [Scilit]
- Blechinger, S.R.; Warren, J.T., Jr.; Kuwada, J.Y.; Krone, P.H. Developmental toxicology of cadmium in living embryos of a stable transgenic zebrafish line. Environ. Health Perspect. 2002, 110, 1041–1046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Samaee, S.M.; Rabbani, S.; Jovanovic, B.; Mohajeri-Tehrani, M.R.; Haghpanah, V. Efficacy of the hatching event in assessing the embryo toxicity of the nano-sized TiO2 particles in zebrafish: A comparison between two different classes of hatching-derived variables. Ecotoxicol. Environ. Saf. 2015, 116, 121–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Li, Y.; Coelhan, M.; Chan, H.M.; Ma, W.; Liu, L. Relative developmental toxicity of short-chain chlorinated paraffins in Zebrafish (Danio rerio) embryos. Environ. Pollut. 2016, 219, 1122–1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ismail, A.; Yusof, S. Effect of mercury and cadmium on early life stages of Java medaka (Oryzias javanicus): A potential tropical test fish. Mar. Pollut. Bull. 2011, 63, 347–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papiya, S.; Kanamadi, R. Effect of mercurial fungicide Emisan®-6 on the embryonic developmental stages of zebrafish, Brachydanio (Danio) rerio. J. Adv. Zool. 2000, 21, 12–18. [Google Scholar]
- Liu, C.; Yu, K.; Shi, X.; Wang, J.; Lam, P.K.; Wu, R.S.; Zhou, B. Induction of oxidative stress and apoptosis by PFOS and PFOA in primary cultured hepatocytes of freshwater tilapia (Oreochromis niloticus). Aquat. Toxicol. 2007, 82, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Li, S.-Y.; Sigmon, V.K.; Babcock, S.A.; Ren, J. Advanced glycation endproduct induces ROS accumulation, apoptosis, MAP kinase activation and nuclear O-GlcNAcylation in human cardiac myocytes. Life Sci. 2007, 80, 1051–1056. [Google Scholar] [CrossRef] [Scilit]
- Siracusa, R.; Impellizzeri, D.; Cordaro, M.; Gugliandolo, E.; Peritore, A.F.; Di Paola, R.; Cuzzocrea, S. Topical application of adelmidrol+ trans-traumatic acid enhances skin wound healing in a streptozotocin-induced diabetic mouse model. Front. Pharmacol. 2018, 9, 871. [Google Scholar] [CrossRef] [Scilit]
- Furutani-Seiki, M.; Jiang, Y.-J.; Brand, M.; Heisenberg, C.-P.; Houart, C.; Beuchle, D.; Van Eeden, F.; Granato, M.; Haffter, P.; Hammerschmidt, M. Neural degeneration mutants in the zebrafish, Danio rerio. Development 1996, 123, 229–239. [Google Scholar] [CrossRef] [Scilit]
- Lopez, E.; Figueroa, S.; Oset-Gasque, M.; Gonzalez, M. Apoptosis and necrosis: Two distinct events induced by cadmium in cortical neurons in culture. Br. J. Pharmacol. 2003, 138, 901–911. [Google Scholar] [CrossRef] [Scilit]
- Chan, P.; Cheng, S. Cadmium-induced ectopic apoptosis in zebrafish embryos. Arch. Toxicol. 2003, 77, 69–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Satoh, M.; Koyama, H.; Kaji, T.; Kito, H.; Tohyama, C. Perspectives on cadmium toxicity research. Tohoku J. Exp. Med. 2002, 196, 23–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeBlack, S.S. Cigarette smoking as a risk factor for cataract and age-related macular degeneration: A review of the literature. Optometry 2003, 74, 99–110. [Google Scholar] [PubMed]
- Chow, E.S.H.; Hui, M.N.Y.; Cheng, C.W.; Cheng, S.H. Cadmium affects retinogenesis during zebrafish embryonic development. Toxicol. Appl. Pharmacol. 2009, 235, 68–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, G.; Wang, P.; Zhu, J.; Weng, X.; Lin, S.; Huang, J.; Xu, Y.; Zhou, F.; Zhang, H.; Tse, L.A. Joint toxicity of lead and cadmium on the behavior of zebrafish larvae: An antagonism. Aquat. Toxicol. 2021, 238, 105912. [Google Scholar] [CrossRef] [Scilit]
- Lu, K.; Qiao, R.; An, H.; Zhang, Y. Influence of microplastics on the accumulation and chronic toxic effects of cadmium in zebrafish (Danio rerio). Chemosphere 2018, 202, 514–520. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Ye, X.; He, B.; Liu, J. Cadmium potentiates toxicity of cypermethrin in zebrafish. Environ. Toxicol. Chem. 2016, 35, 435–445. [Google Scholar] [CrossRef] [Scilit]
- Yin, J.; Yang, J.-m.; Zhang, F.; Miao, P.; Lin, Y.; Chen, M.-l. Individual and joint toxic effects of cadmium sulfate and α-naphthoflavone on the development of zebrafish embryo. J. Zhejiang Univ.-Sci. B 2014, 15, 766–775. [Google Scholar] [CrossRef] [Scilit]
- Kusch, R.C.; Krone, P.H.; Chivers, D.P. Chronic exposure to low concentrations of waterborne cadmium during embryonic and larval development results in the long-term hindrance of antipredator behavior in zebrafish. Environ. Toxicol. Chem. Int. J. 2008, 27, 705–710. [Google Scholar] [CrossRef] [Scilit]
- Gugliandolo, E.; Peritore, A.F.; D’Amico, R.; Licata, P.; Crupi, R. Evaluation of neuroprotective effects of quercetin against aflatoxin B1-intoxicated mice. Animals 2020, 10, 898. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Zhang, Q.; Li, W.; Li, H.; Bao, J.; Yang, C.; Wang, A.; Wei, J.; Chen, S.; Jin, H. Role of Nrf2 in the antioxidation and oxidative stress induced developmental toxicity of honokiol in zebrafish. Toxicol. Appl. Pharmacol. 2019, 373, 48–61. [Google Scholar] [CrossRef] [Scilit]
- Okoye, C.N.; MacDonald-Jay, N.; Kamunde, C. Effects of bioenergetics, temperature and cadmium on liver mitochondria reactive oxygen species production and consumption. Aquat. Toxicol. 2019, 214, 105264. [Google Scholar] [CrossRef] [Scilit]
- Almroth, B.C.; de Souza, K.B.; Jönsson, E.; Sturve, J. Oxidative stress and biomarker responses in the Atlantic halibut after long term exposure to elevated CO2 and a range of temperatures. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2019, 238, 110321. [Google Scholar] [CrossRef] [Scilit]
- Esposito, E.; Campolo, M.; Casili, G.; Lanza, M.; Franco, D.; Filippone, A.; Peritore, A.F.; Cuzzocrea, S. Protective effects of xyloglucan in association with the polysaccharide gelose in an experimental model of gastroenteritis and urinary tract infections. Int. J. Mol. Sci. 2018, 19, 1844. [Google Scholar] [CrossRef] [Scilit]
- Motohashi, H.; Yamamoto, M. Nrf2–Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef] [Scilit]
- Osburn, W.O.; Kensler, T.W. Nrf2 signaling: An adaptive response pathway for protection against environmental toxic insults. Mutat. Res./Rev. Mutat. Res. 2008, 659, 31–39. [Google Scholar] [CrossRef] [Scilit]





| Gene | Primer Orientation | Nucleotide Sequence |
|---|---|---|
| β-actin | forward | 5′- CTTCCAGCAGATGTGGATCA -3′ |
| reverse | 5′- GCCATTTAAGGTGGCAACA-3′ | |
| sod1 | forward | 5′- GGCCAACCGATAGTGTTAGA -3′ |
| reverse | 5′- CCAGCGTTGCCAGTTTTTAG -3′ | |
| cat | forward | 5′- AGGGCAACTGGGATCTTACA -3′ |
| reverse | 5′- TTTATGGGACCAGACCTTGG -3′ | |
| nrf2 | forward | 5-AAGCAGACGGAGGAGGAG -3 |
| reverse | 5′- GGAGGTGTTCAGGCAAGG-3′ | |
| ho-1 | forward | 5′- AAGCAAAGCGGCAGAGAAC-3′ |
| reverse | 5′- TGGAGCAGTCAGATGAAGTGT-3′ |
| Survival | Hatching | Morphology | |||||||
|---|---|---|---|---|---|---|---|---|---|
| 24 h | 48 h | 72 h | 96 h | 24 h | 48 h | 72 h | 96 h | 96 h | |
| CTRL | 100 ± 0 | 98.00 ± 1 | 97.67 ± 1.20 | 97.67 ± 1.20 | 0 | 22.67 ± 1.45 | 100 ± 0 | 100 ± 0 | ND |
| Cd 10 μM | 100 ± 0 | 98.00 ± 1 | 97.67 ± 1.20 | 97.67 ± 1.20 | 0 | 22.67 ± 1.45 | 99.67 ± 0.33 | 99.67 ± 0.33 | ND |
| Cd 50 μM | 100 ± 0 | 99.67 ± 0.33 | 99.67 ± 0.33 | 99.67 ± 0.33 | 0 | 22 ± 1.15 | 99.67 ± 0.33 | 99.67 ± 0.33 | ND |
| IMI 195 μM | 100 ± 0 | 99.67 ± 0.33 | 99.67 ± 0.33 | 99.67 ± 0.33 | 0 | 22.33 ± 1.76 | 99.67 ± 0.33 | 99.67 ± 0.33 | ND |
| Cd 10 μM + IMI 195 μM | 100 ± 0 | 97.33 ± 0.88 | 97.00 ± 1 | 97.00 ± 1 | 0 | 22.67 ± 1.45 | 99.67 ± 0.33 | 99.67± 0.33 | ND |
| Cd 50 μM + IMI 195 μM | 100 ± 0 | 95.00 ± 0.57 ** | 88.33 ± 1.45 *** | 83.33 ± 0.88 *** | 0 | 22.33 ± 1.45 | 80.67 ± 1.52 *** | 93.00 ± 1.73 *** | SC, YE |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Paola, D.; Gugliandolo, E.; Capparucci, F.; Cordaro, M.; Iaria, C.; Siracusa, R.; D’Amico, R.; Fusco, R.; Impellizzeri, D.; Cuzzocrea, S.; et al. Early Exposure to Environmental Pollutants: Imidacloprid Potentiates Cadmium Toxicity on Zebrafish Retinal Cells Death. Animals 2022, 12, 3484. https://doi.org/10.3390/ani12243484
Di Paola D, Gugliandolo E, Capparucci F, Cordaro M, Iaria C, Siracusa R, D’Amico R, Fusco R, Impellizzeri D, Cuzzocrea S, et al. Early Exposure to Environmental Pollutants: Imidacloprid Potentiates Cadmium Toxicity on Zebrafish Retinal Cells Death. Animals. 2022; 12(24):3484. https://doi.org/10.3390/ani12243484
Chicago/Turabian StyleDi Paola, Davide, Enrico Gugliandolo, Fabiano Capparucci, Marika Cordaro, Carmelo Iaria, Rosalba Siracusa, Ramona D’Amico, Roberta Fusco, Daniela Impellizzeri, Salvatore Cuzzocrea, and et al. 2022. "Early Exposure to Environmental Pollutants: Imidacloprid Potentiates Cadmium Toxicity on Zebrafish Retinal Cells Death" Animals 12, no. 24: 3484. https://doi.org/10.3390/ani12243484
APA StyleDi Paola, D., Gugliandolo, E., Capparucci, F., Cordaro, M., Iaria, C., Siracusa, R., D’Amico, R., Fusco, R., Impellizzeri, D., Cuzzocrea, S., Di Paola, R., Crupi, R., & Peritore, A. F. (2022). Early Exposure to Environmental Pollutants: Imidacloprid Potentiates Cadmium Toxicity on Zebrafish Retinal Cells Death. Animals, 12(24), 3484. https://doi.org/10.3390/ani12243484

