The Analysis of E-Cadherin, N-Cadherin, Vimentin, HER-2, CEA, CA15-3 and SF Expression in the Diagnosis of Canine Mammary Tumors
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Sampling
2.2. Clinical Examinations
2.2.1. Clinical Tumor Examinations
2.2.2. Imaging Exams
2.3. Pathology Examination—Hematoxylin and Eosin Staining
2.4. Hematology Examination
2.4.1. Blood Routine Examination
2.4.2. Blood Biochemical Examination
2.4.3. C-Reactive Protein (CRP) Examination
2.5. Serological Molecular Biological Detection-ELISA
2.6. Molecular Biological Detection
2.6.1. DNA Harvesting
2.6.2. Primer Design
2.6.3. Conventional PCR Amplification
2.6.4. Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. Clinical Examination
3.2. Histological Examination
3.3. Blood Analysis
3.4. Serological Molecular Biological Detection-ELISA
3.5. Molecular Biological Detection-qPCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rasotto, R.; Berlato, D.; Goldschmidt, M.H.; Zappulli, V. Prognostic Significance of Canine Mammary Tumor Histologic Subtypes: An Observational Cohort Study of 229 Cases. Vet. Pathol. 2017, 54, 571–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, T.-M.; Yang, I.S.; Seung, B.-J.; Lee, S.; Kim, D.; Ha, Y.-J.; Seo, M.-K.; Kim, K.-K.; Kim, H.S.; Cheong, J.-H.; et al. Cross-species oncogenic signatures of breast cancer in canine mammary tumors. Nat. Commun. 2020, 11, 3616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schabort, J.J.; Nam, A.-R.; Lee, K.-H.; Kim, S.W.; Lee, J.E.; Cho, J.-Y. ANK2 Hypermethylation in Canine Mammary Tumors and Human Breast Cancer. Int. J. Mol. Sci. 2020, 21, 8697. [Google Scholar] [CrossRef] [Scilit]
- Sorenmo, K. Canine mammary gland tumors. Vet. Clin. N. Am. Small Anim. Pract. 2003, 33, 573–596. [Google Scholar] [CrossRef] [Scilit]
- Feliciano, M.A.R.; Uscategui, R.A.R.; Maronezi, M.C.; Simões, A.P.R.; Silva, P.; Gasser, B.; Pavan, L.; Carvalho, C.F.; Canola, J.C.; Vicente, W.R.R. Ultrasonography methods for predicting malignancy in canine mammary tumors. PLoS ONE 2017, 12, e0178143. [Google Scholar] [CrossRef] [Scilit]
- Pavan, A.L.M.; Rosa, M.E.D.; Giacomini, G.; Neto, F.A.B.; Yamashita, S.; Vulcano, L.C.; Duarte, S.B.; Miranda, J.R.D.A.; de Pina, D.R. Homogeneous Canine Chest Phantom Construction: A Tool for Image Quality Optimization. PLoS ONE 2016, 11, e0154193. [Google Scholar] [CrossRef] [Scilit]
- Tagawa, M.; Kanai, E.; Shimbo, G.; Kano, M.; Kayanuma, H. Ultrasonographic evaluation of depth-width ratio (D/W) of benign and malignant mammary tumors in dogs. J. Vet. Med. Sci. 2016, 78, 521–524. [Google Scholar] [CrossRef] [Scilit]
- Goldschmidt, M.; Peña, L.; Rasotto, R.; Zappulli, V. Classification and grading of canine mammary tumors. Vet. Pathol. 2011, 48, 117–131. [Google Scholar] [CrossRef] [Scilit]
- Kwon, B.R.; Chang, J.M.; Kim, S.Y.; Lee, S.H.; Lee, S.M.; Cho, N.; Moon, W.K. Automated Breast Ultrasound System for Breast Cancer Evaluation: Diagnostic Performance of the Two-View Scan Technique in Women with Small Breasts. Korean J. Radiol. 2020, 21, 25–32. [Google Scholar] [CrossRef] [Scilit]
- Athanasiou, L.V.; Tsokana, C.; Pardali, D.; Moraitou, K.A. Histograms of Complete Blood Counts in Dogs: Maximizing Diagnostic Information. Top. Companion Anim. Med. 2018, 33, 141–146. [Google Scholar] [CrossRef] [Scilit]
- Ressel, L.; Puleio, R.; Loria, G.R.; Vannozzi, I.; Millanta, F.; Caracappa, S.; Poli, A. HER-2 expression in canine morphologically normal, hyperplastic and neoplastic mammary tissues and its correlation with the clinical outcome. Res. Vet. Sci. 2013, 94, 299–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.-Q.; Wang, Z.; Leng, P. Aberrant N-cadherin expression in cancer. Biomed. Pharmacother. 2019, 118, 109320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reginato, A.; Girolami, D.; Menchetti, L.; Foiani, G.; Mandara, M. E-cadherin, N-cadherin Expression and Histologic Characterization of Canine Choroid Plexus Tumors. Vet. Pathol. 2016, 53, 788–791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amaral, C.B.; Leite, J.D.S.; Fonseca, A.B.M.; Ferreira, A.M.R. Vimentin, osteocalcin and osteonectin expression in canine primary bone tumors: Diagnostic and prognostic implications. Mol. Biol. Rep. 2018, 45, 1289–1296. [Google Scholar] [CrossRef] [Scilit]
- Campos, L.C.; Lavalle, G.E.; Estrela-Lima, A.; Melgaço de Faria, J.C.; Guimarães, J.E.; Dutra, Á.P.; Ferreira, E.; de Sousa, L.P.; Rabelo, É.M.L.; Vieira da Costa, A.F.D.; et al. CA15.3, CEA and LDH in dogs with malignant mammary tumors. J. Vet. Intern. Med. 2012, 26, 1383–1388. [Google Scholar] [CrossRef] [Scilit]
- Fan, Y.; Ren, X.; Liu, X.; Shi, D.; Xu, E.; Wang, S.; Liu, Y. Combined detection of CA15-3, CEA, and SF in serum and tissue of canine mammary gland tumor patients. Sci. Rep. 2021, 11, 6651. [Google Scholar] [CrossRef] [Scilit]
- Kaszak, I.; Ruszczak, A.; Kanafa, S.; Kacprzak, K.; Król, M.; Jurka, P. Current biomarkers of canine mammary tumors. Acta Vet. Scand. 2018, 60, 66. [Google Scholar] [CrossRef] [Scilit]
- Engvall, E. The ELISA, enzyme-linked immunosorbent assay. Clin. Chem. 2010, 56, 319–320. [Google Scholar] [CrossRef] [Scilit]
- Chocteau, F.; Abadie, J.; Loussouarn, D.; Nguyen, F. Proposal for a Histological Staging System of Mammary Carcinomas in Dogs and Cats. Part 1: Canine Mammary Carcinomas. Front. Vet. Sci. 2019, 6, 388. [Google Scholar] [CrossRef] [Scilit]
- Zheng, H.-H.; Du, C.-T.; Yu, C.; Zhang, Y.-Z.; Huang, R.-L.; Tang, X.-Y.; Xie, G.-H. Epidemiological Investigation of Canine Mammary Tumors in Mainland China between 2017 and 2021. Front. Vet. Sci. 2022, 9, 843390. [Google Scholar] [CrossRef] [Scilit]
- Peña, L.; de Andrés, P.J.; Clemente, M.; Cuesta, P.; Pérez-Alenza, M.D. Prognostic value of histological grading in noninflammatory canine mammary carcinomas in a prospective study with two-year follow-up: Relationship with clinical and histological characteristics. Vet. Pathol. 2013, 50, 94–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sleeckx, N.; de Rooster, H.; Kroeze, E.J.B.V.; van Ginneken, C.; van Brantegem, L. Canine mammary tumours, an overview. Reprod. Domest. Anim. 2011, 46, 1112–1131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clemente, M.; Pérez-Alenza, M.; Peña, L. Metastasis of canine inflammatory versus non-inflammatory mammary tumours. J. Comp. Pathol. 2010, 143, 157–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Planellas, M.; Bassols, A.; Siracusa, C.; Saco, Y.; Giménez, M.; Pato, R.; Pastor, J. Evaluation of serum haptoglobin and C-reactive protein in dogs with mammary tumors. Vet. Clin. Pathol. 2009, 38, 348–352. [Google Scholar] [CrossRef] [Scilit]
- Coventry, B.J.; Ashdown, M.L.; Quinn, M.A.; Markovic, S.N.; Yatomi-Clarke, S.L.; Robinson, A.P. CRP identifies homeostatic immune oscillations in cancer patients: A potential treatment targeting tool? J. Transl. Med. 2009, 7, 102. [Google Scholar] [CrossRef] [Scilit]
- Campos, L.C.; Silva, J.O.; Santos, F.S.; Araújo, M.R.; Lavalle, G.E.; Ferreira, E.; Cassali, G.D. Prognostic significance of tissue and serum HER2 and MUC1 in canine mammary cancer. J. Vet. Diagn. Investig. 2015, 27, 531–535. [Google Scholar] [CrossRef] [Scilit]
- Dutra, A.P.; Granja, N.V.M.; Schmitt, F.C.; Cassali, G.D. c-erbB-2 expression and nuclear pleomorphism in canine mammary tumors. Braz. J. Med. Biol. Res. 2004, 37, 1673–1681. [Google Scholar] [CrossRef] [Scilit]
- Hsu, W.-L.; Huang, H.-M.; Liao, J.-W.; Wong, M.-L.; Chang, S.-C. Increased survival in dogs with malignant mammary tumours overexpressing HER-2 protein and detection of a silent single nucleotide polymorphism in the canine HER-2 gene. Vet. J. 2009, 180, 116–123. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.; Im, K.; Kim, N.; Yhee, J.; Nho, W.; Sur, J. Expression of HER-2 and nuclear localization of HER-3 protein in canine mammary tumors: Histopathological and immunohistochemical study. Vet. J. 2011, 189, 318–322. [Google Scholar] [CrossRef] [Scilit]
- Gama, A.; Paredes, J.; Gärtner, F.; Alves, A.; Schmitt, F. Expression of E-cadherin, P-cadherin and beta-catenin in canine malignant mammary tumours in relation to clinicopathological parameters, proliferation and survival. Vet. J. 2008, 177, 45–53. [Google Scholar] [CrossRef] [Scilit]
- Matos, A.; Lopes, C.; Carvalheira, J.; Santos, M.; Rutteman, G.; Gärtner, F. E-cadherin expression in canine malignant mammary tumours: Relationship to other clinico-pathological variables. J. Comp. Pathol. 2006, 134, 182–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarli, G.; Preziosi, R.; Benazzi, C.; Castellani, G.; Marcato, P.S. Prognostic value of histologic stage and proliferative activity in canine malignant mammary tumors. J. Vet. Diagn. Investig. 2002, 14, 25–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Philibert, J.C.; Snyder, P.W.; Glickman, N.; Glickman, L.T.; Knapp, D.W.; Waters, D.J. Influence of host factors on survival in dogs with malignant mammary gland tumors. J. Vet. Intern. Med. 2003, 17, 102–106. [Google Scholar] [CrossRef]
- Moore, P.F. A review of histiocytic diseases of dogs and cats. Vet. Pathol. 2014, 51, 167–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, S.-C.; Chang, C.-C.; Chang, T.-J.; Wong, M.-L. Prognostic factors associated with survival two years after surgery in dogs with malignant mammary tumors: 79 cases (1998–2002). J. Am. Vet. Med. Assoc. 2005, 227, 1625–1629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, E.; Bertagnolli, A.C.; Cavalcanti, M.F.; Schmitt, F.C.; Cassali, G.D. The relationship between tumour size and expression of prognostic markers in benign and malignant canine mammary tumours. Vet. Comp. Oncol. 2009, 7, 230–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Araújo, M.; Campos, L.; Damasceno, K.; Gamba, C.; Ferreira, E.; Cassali, G. HER-2, EGFR, Cox-2 and Ki67 expression in lymph node metastasis of canine mammary carcinomas: Association with clinical-pathological parameters and overall survival. Res. Vet. Sci. 2016, 106, 121–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santos, A.A.; Lopes, C.C.; Ribeiro, J.R.; Martins, L.R.; Santos, J.C.; Amorim, I.F.; Gärtner, F.; Matos, A.J. Identification of prognostic factors in canine mammary malignant tumours: A multivariable survival study. BMC Vet. Res. 2013, 9, 1. [Google Scholar] [CrossRef] [Scilit]
- Alenza, M.D.P.; Pena, L.; del Castillo, N.; Nieto, A.I. Factors influencing the incidence and prognosis of canine mammary tumours. J. Small Anim. Pract. 2000, 41, 287–291. [Google Scholar] [CrossRef] [Scilit]
- Mobasheri, A.; Cassidy, J.P. Biomarkers in veterinary medicine: Towards targeted, individualised therapies for companion animals. Vet. J. 2010, 185, 1–3. [Google Scholar] [CrossRef] [Scilit]





| Name of Primer | Sequence (5′–3′) | Expected Product/Bp | Application |
|---|---|---|---|
| Vimentin-F | TACGCCAGCAATATGAAAGCG | 112 | Vimentin |
| Vimentin-R | AGGGCATCATTGTTCCGGTTA | ||
| E-cadherin-F | TCCTGGGCAGGGTGAGTT | 134 | E-cadherin |
| E-cadherin-R | GAGGCCGCTTGACTGTAATC | ||
| N-cadherin-F | AGCACCCTCCTCAGTCAACG | 126 | N-cadherin |
| N-cadherin-R | TGTCAACATGGTCCCAGCA | ||
| CA15-3-F | CTGCTGGTGCTGGTCTGTGTTCTG | 264 | CA15-3 |
| CA15-3-R | GGCTGCTGGGTTCGGGTTCAT | ||
| CEA-F | GCCAGATTCTAACGCTCACGGATAG | 165 | CEA |
| CEA-R | AATCATCTTCCACATCCAGCCTTACAG | ||
| HER-2-F | AAGTGCTGGATGATAGACTCTGAATGC | 157 | HER-2 |
| HER-2-R | GTAGTGAACGGTAGAAGGTGCTGTC | ||
| SF-F | GATGCTGCTTCTGGTATGTCCTATCTC | 146 | SF |
| SF-R | GAATACACTCCACCATCCTCTTGACG | ||
| GAPDH-F | ATGGTGAAGGTCGGAGTGAA | 163 | GAPDH |
| GAPDH-R | GGAATTTGCCGTGGGTAGAAT |
| Parameters | Min–Max | Unit | Reference Range | Value |
|---|---|---|---|---|
| White blood cells (WBC) | 9.59–26.73 | 109/L | 6.00–17.00 | 16.32 |
| Neutrophil (Neu#) | 6.79–18.84 | 109/L | 3.62–12.30 | 11.45 |
| Lymphocyte (Lym#) | 0.43–3.91 | 109/L | 0.83–4.91 | 44.31 |
| Monocyte (Mon#) | 0.13–2.66 | 109/L | 0.14–1.97 | 1.75 |
| Eosinophil (Eos#) | 0.05–1.50 | 109/L | 0.04–1.62 | 1.23 |
| Basophil (Bas#) | 0.00–0.08 | 109/L | 0.00–0.12 | 0.04 |
| Red blood cells (RBC) | 4.65–7.31 | 1012/L | 5.10–8.50 | 7.21 |
| Hemoglobin (HGB) | 125–183 | g/L | 110–190 | 165 |
| Red blood cell specific volume (HCT) | 39.9–56.5 | % | 33.0–56.0 | 51.3 |
| Mean corpuscular volume (MCV) | 62.4–70.8 | fL | 60.0–76.0 | 65.2 |
| Mean corpuscular hemoglobin (MCH) | 22.3–27.8 | pg | 20.0–27.0 | 25.9 |
| Mean corpuscular hemoglobin concentration (MCHC) | 315–368 | g/L | 300–380 | 345 |
| Red blood cell distribution width (RDW-CV) | 13.2–16.1 | % | 12.5–17.2 | 15.2 |
| Red blood cell distribution width-standard deviation (RDW-SD) | 33.6–47.2 | fL | 33.2–46.3 | 45.3 |
| Platelet count (PLT) | 98–482 | 109/L | 117–490 | 467 |
| Mean platelet volume (MPV) | 8.4–12.9 | fL | 8.0–14.1 | 11.6 |
| Platelet distribution width (PDW) | 12.7–16.8 | 12.0–17.5 | 15.7 | |
| Plateletcrit (PCT) | 0.12–0.53 | % | 0.090–0.580 | 0.49 |
| Parameters | Min–Max | Unit | Reference Range | Value |
|---|---|---|---|---|
| Total Protein (TP) | 54–78 | g/L | 52–82 | 71 |
| Albumin (ALB) | 25–35 | g/L | 22–44 | 29 |
| Globulin (GLO) | 33.8–50.6 | g/L | 23–52 | 47.5 |
| Alkaline phosphatase (ALP) | 12–55 | U/L | 40–300 | 41 |
| Total bilirubin (TBIL) | 2.22–51.29 | umol/L | 2–15 | 39.89 |
| Alanine transaminase (ALT) | 16–68 | U/L | 10–118 | 51 |
| γ-glutamyl transpeptidase (GGT) | 1.25–1.83 | U/L | 0–7 | 1.46 |
| Blood Urea Nitrogen (BUN) | 2.9–5.9 | mmol/L | 2.5–9.6 | 3.4 |
| Creatinine (CRE) | 38–82 | umol/L | 27–124 | 74 |
| Glutamic acid (GLU) | 4.35–7.22 | mmol/L | 3.89–7.95 | 6.32 |
| Calcium (Ca) | 2.12–2.86 | mmol/L | 1.98–2.95 | 2.64 |
| Grouping | c-CRP (mg/L) |
|---|---|
| Healthy | 5.858 ± 2.609 * |
| Benign | 9.883 ± 2.805 |
| Malignant | 14.58 ± 2.516 |
| Grouping | HER-2 (ng/mL) |
|---|---|
| Healthy | 2.48 ± 0.09005 |
| Benign | 2.573 ± 0.1445 |
| Malignant | 3.264 ± 0.1591 * |
| Grouping | HER-2 | CA15-3 | CEA | SF | Vimentin | E-Cadherin | N-Cadherin |
|---|---|---|---|---|---|---|---|
| Healthy | 0.864 ± 0.1603 * | 1.348 ± 0.0639 * | 1.655 ± 0.0451 * | 1.686 ± 0.0639 * | 0.327 ± 0.2146 * | 1.018 ± 0.1711 * | 0.0862 ± 0.0314 * |
| Benign | 1.104 ± 0.1871 | 1.587 ± 0.1667 | 1.898 ± 0.06784 | 1.929 ± 0.04963 | 2.307 ± 0.6025 | 0.157 ± 0.0661 | 0.3268 ± 0.1263 |
| Malignant | 2.307 ± 0.6374 | 4.024 ± 0.2801 | 5.728 ± 0.1618 | 3.511 ± 0.2836 | 8.706 ± 0.7283 | 0.052 ± 0.0267 | 1.226 ± 0.4087 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, C.; Zheng, H.; Liu, X.; Xie, G. The Analysis of E-Cadherin, N-Cadherin, Vimentin, HER-2, CEA, CA15-3 and SF Expression in the Diagnosis of Canine Mammary Tumors. Animals 2022, 12, 3050. https://doi.org/10.3390/ani12213050
Yu C, Zheng H, Liu X, Xie G. The Analysis of E-Cadherin, N-Cadherin, Vimentin, HER-2, CEA, CA15-3 and SF Expression in the Diagnosis of Canine Mammary Tumors. Animals. 2022; 12(21):3050. https://doi.org/10.3390/ani12213050
Chicago/Turabian StyleYu, Chao, Huihua Zheng, Xiangyu Liu, and Guanghong Xie. 2022. "The Analysis of E-Cadherin, N-Cadherin, Vimentin, HER-2, CEA, CA15-3 and SF Expression in the Diagnosis of Canine Mammary Tumors" Animals 12, no. 21: 3050. https://doi.org/10.3390/ani12213050
APA StyleYu, C., Zheng, H., Liu, X., & Xie, G. (2022). The Analysis of E-Cadherin, N-Cadherin, Vimentin, HER-2, CEA, CA15-3 and SF Expression in the Diagnosis of Canine Mammary Tumors. Animals, 12(21), 3050. https://doi.org/10.3390/ani12213050
