Effects of Chitosan Oligosaccharide on Production Performance, Egg Quality and Ovarian Function in Laying Hens with Fatty Liver Syndrome
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Diets and Experimental Design
2.2. Production Performance and Sample Collection
2.3. Egg Quality
2.4. Histopathological Examination
2.5. Determination of Ovarian Antioxidant Capacity
2.6. Quantitative Real-Time Polymerase Chain Reaction (PCR) Analysis
2.7. Statistical Analysis
3. Results
3.1. Production Performance
3.2. Egg Quality
3.3. Histopathology
3.4. Antioxidant Capacities of the Ovaries
3.5. The mRNA Expression of Inflammation-Related Genes in the Ovaries
3.6. The mRNA Expression of Apoptosis-Related Genes in the Ovaries
4. Discussion
4.1. Production Performance
4.2. Egg Quality
4.3. Ovarian Morphology
4.4. Ovarian Antioxidant Capacity
4.5. Ovarian Inflammation
4.6. Ovarian Apoptosis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shini, A.; Shini, S.; Bryden, W.L. Fatty liver haemorrhagic syndrome occurrence in laying hens: Impact of production system. Avian Pathol. 2019, 48, 25–34. [Google Scholar] [CrossRef] [PubMed]
- Trott, K.A.; Giannitti, F.; Rimoldi, G.; Hill, A.; Woods, L.; Barr, B.; Anderson, M.; Mete, A. Fatty liver hemorrhagic syndrome in the backyard chicken: A retrospective histopathologic case series. Vet. Pathol. 2014, 51, 787–795. [Google Scholar] [CrossRef] [PubMed]
- Squires, E.J.; Leeson, S. Aetiology of fatty liver syndrome in laying hens. Br. Vet. J. 1988, 144, 602–609. [Google Scholar] [CrossRef]
- Rozenboim, I.; Mahato, J.; Cohen, N.A.; Tirosh, O. Low protein and high-energy diet: A possible natural cause of fatty liver hemorrhagic syndrome in caged White Leghorn laying hens. Poult. Sci. 2016, 95, 612–621. [Google Scholar] [CrossRef]
- Jiang, S.; Cheng, H.W.; Cui, L.Y.; Zhou, Z.L.; Hou, J.F. Changes of blood parameters associated with bone remodeling following experimentally induced fatty liver disorder in laying hens. Poult. Sci. 2013, 92, 1443–1453. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.E.; McMurtry, J.P.; Walzem, R.L. Overfeeding-induced ovarian dysfunction in broiler breeder hens is associated with lipotoxicity. Poult. Sci. 2006, 85, 70–81. [Google Scholar] [CrossRef] [PubMed]
- Xing, C.; Wang, Y.; Dai, X.; Yang, F.; Luo, J.; Liu, P.; Zhang, C.; Cao, H.; Hu, G. The protective effects of resveratrol on antioxidant function and the mRNA expression of inflammatory cytokines in the ovaries of hens with fatty liver hemorrhagic syndrome. Poult. Sci. 2020, 99, 1019–1027. [Google Scholar] [CrossRef] [PubMed]
- Muanprasat, C.; Chatsudthipong, V. Chitosan oligosaccharide: Biological activities and potential therapeutic applications. Pharmacol. Ther. 2017, 170, 80–97. [Google Scholar] [CrossRef] [PubMed]
- Naveed, M.; Phil, L.; Sohail, M.; Hasnat, M.; Baig, M.; Ihsan, A.U.; Shumzaid, M.; Kakar, M.U.; Mehmood Khan, T.; Akabar, M.D.; et al. Chitosan oligosaccharide (COS): An overview. Int. J. Biol. Macromol. 2019, 129, 827–843. [Google Scholar] [CrossRef]
- Tao, W.; Wang, G.; Wei, J. The role of chitosan oligosaccharide in metabolic syndrome: A review of possible mechanisms. Mar. Drugs 2021, 19, 501. [Google Scholar] [CrossRef] [PubMed]
- Deng, X.; Ye, Z.; Cao, H.; Bai, Y.; Che, Q.; Guo, J.; Su, Z. Chitosan oligosaccharide ameliorated obesity by reducing endoplasmic reticulum stress in diet-induced obese rats. Food Funct. 2020, 11, 6285–6296. [Google Scholar] [CrossRef]
- He, N.; Wang, S.; Lv, Z.; Zhao, W.; Li, S. Low molecular weight chitosan oligosaccharides (LMW-COSs) prevent obesity-related metabolic abnormalities in association with the modification of gut microbiota in high-fat diet (HFD)-fed mice. Food Funct. 2020, 11, 9947–9959. [Google Scholar] [CrossRef] [PubMed]
- Zheng, J.; Yuan, X.; Cheng, G.; Jiao, S.; Feng, C.; Zhao, X.; Yin, H.; Du, Y.; Liu, H. Chitosan oligosaccharides improve the disturbance in glucose metabolism and reverse the dysbiosis of gut microbiota in diabetic mice. Carbohydr. Polym. 2018, 190, 77–86. [Google Scholar] [CrossRef]
- Tao, W.; Sun, W.; Liu, L.; Wang, G.; Xiao, Z.; Pei, X.; Wang, M. Chitosan oligosaccharide attenuates nonalcoholic fatty liver disease induced by high fat diet through reducing lipid accumulation, inflammation and oxidative stress in C57BL/6 mice. Mar. Drugs 2019, 17, 645. [Google Scholar] [CrossRef] [PubMed]
- Qian, M.; Lyu, Q.; Liu, Y.; Hu, H.; Wang, S.; Pan, C.; Duan, X.; Gao, Y.; Qi, L.W.; Liu, W.; et al. Chitosan oligosaccharide ameliorates nonalcoholic fatty liver disease (NAFLD) in diet-induced obese mice. Mar. Drugs 2019, 17, 391. [Google Scholar] [CrossRef] [PubMed]
- Wan, J.; Yang, K.; Xu, Q.; Chen, D.; Yu, B.; Luo, Y.; He, J. Dietary chitosan oligosaccharide supplementation improves foetal survival and reproductive performance in multiparous sows. RSC Adv. 2016, 6, 70715–70722. [Google Scholar] [CrossRef]
- Cheng, L.K.; Wang, L.X.; Xu, Q.S.; Huang, L.J.; Zhou, D.S.; Li, Z.; Li, S.G.; Du, Y.G.; Yin, H. Chitooligosaccharide supplementation improves the reproductive performance and milk composition of sows. Livest. Sci. 2015, 174, 74–81. [Google Scholar] [CrossRef]
- Xu, Q.; Azzam, M.M.M.; Zou, X.; Dong, X. Effects of chitooligosaccharide supplementation on laying performance, egg quality, blood biochemistry, antioxidant capacity and immunity of laying hens during the late laying period. Ital. J. Anim. Sci. 2020, 19, 1181–1188. [Google Scholar] [CrossRef]
- Meng, Q.W.; Yan, L.; Ao, X.; Jang, H.D.; Cho, J.H.; Kim, I.H. Effects of chito-oligosaccharide supplementation on egg production, nutrient digestibility, egg quality and blood profiles in laying hens. Asian-Australas. J. Anim. Sci. 2010, 23, 1476–1481. [Google Scholar] [CrossRef]
- Xu, Q.; Qu, C.; Wan, J.; Cheng, G.; Yang, W.; Gong, C.; He, J.; Du, Y. Effect of dietary chitosan oligosaccharide supplementation on the pig ovary transcriptome. RSC Adv. 2018, 8, 13266–13273. [Google Scholar] [CrossRef]
- Gu, Y.F.; Chen, Y.P.; Jin, R.; Wang, C.; Wen, C.; Zhou, Y.M. Dietary chitooligosaccharide supplementation alleviates intestinal barrier damage, and oxidative and immunological stress in lipopolysaccharide-challenged laying hens. Poult. Sci. 2022, 101, 101701. [Google Scholar] [CrossRef] [PubMed]
- Lan, R.; Wei, L.; Chang, Q.; Wu, S.; Zhao, Z. Effects of dietary chitosan oligosaccharides on oxidative stress and inflammation response in liver and spleen of yellow-feather broilers exposed to high ambient temperature. Ital. J. Anim. Sci. 2020, 19, 1508–1517. [Google Scholar] [CrossRef]
- Lan, R.; Li, Y.; Chang, Q.; Zhao, Z. Dietary chitosan oligosaccharides alleviate heat stress–induced intestinal oxidative stress and inflammatory response in yellow-feather broilers. Poult. Sci. 2020, 99, 6745–6752. [Google Scholar] [CrossRef] [PubMed]
- National Research Council. Nutrient Requirements of Poultry, 9th ed.; National Academy Press: Washington, DC, USA, 1994. [Google Scholar]
- Harms, R.H.; Russell, G.B.; Sloan, D.R. Performance of four strains of commercial layers with major changes in dietary energy. J. Appl. Poult. Res. 2000, 9, 535–541. [Google Scholar] [CrossRef]
- Wu, X.L.; Zou, X.Y.; Zhang, M.; Hu, H.Q.; Wei, X.L.; Jin, M.L.; Cheng, H.W.; Jiang, S. Osteocalcin prevents insulin resistance, hepatic inflammation, and activates autophagy associated with high-fat diet-induced fatty liver hemorrhagic syndrome in aged laying hens. Poult. Sci. 2021, 100, 73–83. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.F.; Kim, I.H. Effects of probiotic supplementation in different energy and nutrient density diets on performance, egg quality, excreta microflora, excreta noxious gas emission, and serum cholesterol concentrations in laying hens. J. Anim. Sci. 2013, 91, 4781–4787. [Google Scholar] [CrossRef]
- Jalal, M.A.; Scheideler, S.E.; Pierson, E.M. Strain response of laying hens to varying dietary energy levels with and without Avizyme supplementation. J. Appl. Poult. Res. 2007, 16, 289–295. [Google Scholar] [CrossRef]
- Mikulski, D.; Jankowski, J.; Mikulska, M.; Demey, V. Effects of dietary probiotic (Pediococcus acidilactici) supplementation on productive performance, egg quality, and body composition in laying hens fed diets varying in energy density. Poult. Sci. 2020, 99, 2275–2285. [Google Scholar] [CrossRef] [PubMed]
- Classen, H.L. Diet energy and feed intake in chickens. Anim. Feed Sci. Technol. 2017, 233, 13–21. [Google Scholar] [CrossRef]
- Yan, L.; Lee, J.H.; Meng, Q.W.; Ao, X.; Kim, I.H. Evaluation of dietary supplementation of delta-aminolevulinic acid and chito-oligosaccharide on production performance, egg quality and hematological characteristics in laying hens. Asian-Australas. J. Anim. Sci. 2010, 23, 1028–1033. [Google Scholar] [CrossRef]
- Jiao, Y.; Jha, R.; Zhang, W.L.; Kim, I.H. Effects of chitooligosaccharide supplementation on egg production, egg quality and blood profiles in laying hens. Indian, J. Anim. Res. 2019, 53, 1199–1204. [Google Scholar] [CrossRef]
- Mellouk, N.; Ramé, C.; Barbe, A.; Grandhaye, J.; Froment, P.; Dupont, J. Chicken is a useful model to investigate the role of adipokines in metabolic and reproductive diseases. Int. J. Endocrinol. 2018, 2018, 4579734. [Google Scholar] [CrossRef]
- Won, Y.B.; Seo, S.K.; Yun, B.H.; Cho, S.; Choi, Y.S.; Lee, B.S. Non-alcoholic fatty liver disease in polycystic ovary syndrome women. Sci. Rep. 2021, 11, 7085. [Google Scholar] [CrossRef]
- Walzem, R.L.; Simon, C.; Morishita, T.; Lowenstine, L.; Hansen, R.J. Fatty liver hemorrhagic syndrome in hens overfed a purified diet. Selected enzyme activities and liver histology in relation to liver hemorrhage and reproductive performance. Poult. Sci. 1993, 72, 1479–1491. [Google Scholar] [CrossRef]
- Devine, P.J.; Perreault, S.D.; Luderer, U. Roles of reactive oxygen species and antioxidants in ovarian toxicity. Biol. Reprod. 2012, 86, 27. [Google Scholar] [CrossRef]
- Liu, X.; Lin, X.; Mi, Y.; Li, J.; Zhang, C. Grape seed proanthocyanidin extract prevents ovarian aging by inhibiting oxidative stress in the hens. Oxidative Med. Cell. Longev. 2018, 2018, 9390810. [Google Scholar] [CrossRef]
- Wang, J.; Jia, R.; Gong, H.; Celi, P.; Zhuo, Y.; Ding, X.; Bai, S.; Zeng, Q.; Yin, H.; Xu, S.; et al. The effect of oxidative stress on the chicken ovary: Involvement of microbiota and melatonin interventions. Antioxidants 2021, 10, 1422. [Google Scholar] [CrossRef]
- Yang, Z.; Hong, W.; Zheng, K.; Feng, J.; Hu, C.; Tan, J.; Zhong, Z.; Zheng, Y. Chitosan oligosaccharides alleviate H2O2-stimulated granulosa cell damage via HIF-1α signaling pathway. Oxidative Med. Cell. Longev. 2022, 2022, 4247042. [Google Scholar] [CrossRef]
- Luci, C.; Bourinet, M.; Leclère, P.S.; Anty, R.; Gual, P. Chronic inflammation in non-alcoholic steatohepatitis: Molecular mechanisms and therapeutic strategies. Front. Endocrinol. 2020, 11, 597648. [Google Scholar] [CrossRef]
- Velez, L.M.; Seldin, M.; Motta, A.B. Inflammation and reproductive function in women with polycystic ovary syndrome. Biol. Reprod. 2021, 104, 1205–1217. [Google Scholar] [CrossRef]
- Lee, H.J.; Bahr, J.M.; Bitterman, P.; Basu, S.; Sharma, S.; Abramowicz, J.S.; Barua, A. Polycystic ovarian condition may be a risk factor for ovarian tumor development in the laying hen model of spontaneous ovarian cancer. J. Immunol. Res. 2018, 2018, 2590910. [Google Scholar] [CrossRef] [PubMed]
- Baker, R.G.; Hayden, M.S.; Ghosh, S. NF-κB, inflammation, and metabolic disease. Cell Metab. 2011, 13, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhang, H.; Bai, S.; Zeng, Q.; Su, Z.; Zhuo, Y.; Mao, X.; Yin, H.; Feng, B.; Liu, J.; et al. Dietary tributyrin improves reproductive performance, antioxidant capacity, and ovary function of broiler breeders. Poult. Sci. 2021, 100, 101429. [Google Scholar] [CrossRef]
- Birkinshaw, R.W.; Czabotar, P.E. The BCL-2 family of proteins and mitochondrial outer membrane permeabilisation. Semin. Cell Dev. Biol. 2017, 72, 152–162. [Google Scholar] [CrossRef]
- Boice, A.; Bouchier-Hayes, L. Targeting apoptotic caspases in cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118688. [Google Scholar] [CrossRef]
Items (%, Unless Otherwise Indicated) | Basal Diet | High-Energy Low-Protein Diet |
---|---|---|
Ingredients | ||
Corn | 63.00 | 66.00 |
Soybean meal | 24.00 | 17.20 |
Limestone | 8.00 | 8.00 |
Soybean oil | 0.00 | 3.80 |
Premix 1 | 5.00 | 5.00 |
Total | 100.00 | 100.00 |
Nutrient levels 2 | ||
Metabolic energy (kcal/kg) | 2602.20 | 2854.34 |
Crude protein | 15.65 | 12.88 |
Lysine | 0.79 | 0.62 |
Methionine | 0.35 | 0.32 |
Calcium | 3.41 | 3.39 |
Total phosphorus | 0.43 | 0.40 |
Gene | Primer Sequences (5′–3′) | Size (bp) |
---|---|---|
GAPDH | F: TGCTGCCCAGAACATCATCC R: ACGGCAGGTCAGGTCAACAA | 142 |
NF-κB | F: TCAACGCAGGACCTAAAGACAT R: GCAGATAGCCAAGTTCAGGATG | 162 |
TNF-α | F: GCCCTTCCTGTAACCAGATG R: ACACGACAGCCAAGTCAACG | 71 |
IL-1β | F: ACTGGGCATCAAGGGCTA R: GGTAGAAGATGAAGCGGGTC | 131 |
IL-6 | F: AGGACGAGATGTGCAAGAAGT R: TTGGGCAGGTTGAGGTTGTT | 79 |
caspase 3 | F: AAAGATGGACCACGCTCAGG R: TGAACGAGATGACAGTCCGG | 204 |
caspase 8 | F: AGTGAACAACTATCGGTGCAT R: CTTCCTGCCCATCAACACCA | 107 |
caspase 9 | F: TATGGTGGAGGACATGCAGA R: AATATTGGGAAGGCCTGCTT | 99 |
Bax | F: GTACGTCAATGTGGTCACCC R: TGGGATAATGCTGGGGTTGA | 210 |
Bcl-2 | F: ACCATGAATGAAACCGTGCC R: TTGTCGTAGCCTCTTCTCCC | 181 |
Items 1 | NC | HELP | HELPLC | HELPMC | HELPHC | SEM | p-Values |
---|---|---|---|---|---|---|---|
1st to 4th week | |||||||
Laying rate (%) | 94.79 a | 92.07 b | 94.21 ab | 95.66 a | 95.54 a | 0.430 | 0.042 |
Daily feed intake (g/hen/d) | 111.45 | 111.49 | 111.53 | 111.68 | 111.56 | 0.041 | 0.461 |
Feed-to-egg ratio | 2.08 | 2.15 | 2.12 | 2.06 | 2.07 | 0.011 | 0.054 |
5th to 8th week | |||||||
Laying rate (%) | 92.88 a | 86.34 b | 90.80 a | 92.77 a | 92.48 a | 0.620 | <0.001 |
Daily feed intake (g/hen/d) | 111.07 | 111.05 | 111.14 | 111.16 | 111.16 | 0.023 | 0.416 |
Feed-to-egg ratio | 2.10 b | 2.27 a | 2.16 b | 2.10 b | 2.11 b | 0.017 | 0.002 |
9th to 12th week | |||||||
Laying rate (%) | 90.97 a | 83.00 b | 86.34 ab | 88.08 a | 89.06 a | 0.795 | 0.011 |
Daily feed intake (g/hen/d) | 107.63 | 108.27 | 107.24 | 106.99 | 106.98 | 0.233 | 0.379 |
Feed-to-egg ratio | 2.11 b | 2.37 a | 2.25 ab | 2.20 b | 2.15 b | 0.027 | 0.016 |
1st to 12th week | |||||||
Laying rate (%) | 92.88 a | 87.14 b | 90.45 a | 92.17 a | 92.36 a | 0.568 | 0.002 |
Daily feed intake (g/hen/d) | 110.05 | 110.27 | 109.97 | 109.94 | 109.90 | 0.080 | 0.650 |
Feed-to-egg ratio | 2.10 b | 2.26 a | 2.18 ab | 2.12 b | 2.11 b | 0.018 | 0.012 |
Items 1 | NC | HELP | HELPLC | HELPMC | HELPHC | SEM | p-Values |
---|---|---|---|---|---|---|---|
Egg weight (g) | 55.74 | 55.84 | 55.62 | 55.31 | 55.72 | 0.211 | 0.955 |
Egg shape index | 1.33 | 1.33 | 1.33 | 1.33 | 1.34 | 0.003 | 0.844 |
Yolk color | 6.21 | 6.63 | 6.33 | 6.48 | 6.25 | 0.075 | 0.376 |
Yolk weight ratio (%) | 26.66 | 26.91 | 27.47 | 26.92 | 26.99 | 0.134 | 0.447 |
Eggshell strength (N) | 44.98 | 48.32 | 47.74 | 47.58 | 48.42 | 0.557 | 0.288 |
Eggshell thickness (μm) | 363.45 | 361.85 | 360.83 | 363.33 | 363.47 | 1.465 | 0.975 |
Albumen height (mm) | 6.89 ab | 6.44 c | 6.65 bc | 6.88 ab | 7.15 a | 0.070 | 0.008 |
Haugh unit | 84.02 ab | 80.79 c | 82.45 bc | 84.05 ab | 85.58 a | 0.445 | 0.003 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tao, W.; Jin, F.; Fan, Q.; Zhao, N.; Wang, G.; Du, E.; Chen, F.; Guo, W.; Huang, S.; Chen, M.; et al. Effects of Chitosan Oligosaccharide on Production Performance, Egg Quality and Ovarian Function in Laying Hens with Fatty Liver Syndrome. Animals 2022, 12, 2465. https://doi.org/10.3390/ani12182465
Tao W, Jin F, Fan Q, Zhao N, Wang G, Du E, Chen F, Guo W, Huang S, Chen M, et al. Effects of Chitosan Oligosaccharide on Production Performance, Egg Quality and Ovarian Function in Laying Hens with Fatty Liver Syndrome. Animals. 2022; 12(18):2465. https://doi.org/10.3390/ani12182465
Chicago/Turabian StyleTao, Wenjing, Feng Jin, Qiwen Fan, Na Zhao, Geng Wang, Encun Du, Fang Chen, Wanzheng Guo, Shaowen Huang, Mingxin Chen, and et al. 2022. "Effects of Chitosan Oligosaccharide on Production Performance, Egg Quality and Ovarian Function in Laying Hens with Fatty Liver Syndrome" Animals 12, no. 18: 2465. https://doi.org/10.3390/ani12182465
APA StyleTao, W., Jin, F., Fan, Q., Zhao, N., Wang, G., Du, E., Chen, F., Guo, W., Huang, S., Chen, M., & Wei, J. (2022). Effects of Chitosan Oligosaccharide on Production Performance, Egg Quality and Ovarian Function in Laying Hens with Fatty Liver Syndrome. Animals, 12(18), 2465. https://doi.org/10.3390/ani12182465