Prophylactic Feeding of Clostridium butyricum and Saccharomyces cerevisiae Were Advantageous in Resisting the Adverse Effects of Heat Stress on Rumen Fermentation and Growth Performance in Goats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Goats and Probiotic Feeding Experiment
2.2. Sampling and Measurements
2.3. Statistical Analysis
3. Results
3.1. Parameters for Evaluation of the Occurrence of Heat Stress in Goats
3.2. Prophylactic Feeding of Probiotics Improved Rumen Environment and Enhanced Rumen Fermentation of Heat-Stressed Goats
3.3. Prophylactic Feeding of Probiotics Improved Growth Performance of Heat-Stressed Goats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Uyeno, Y.; Shigemori, S.; Shimosato, T. Effects of prebiotics/prebiotics in cattle health and productivity: Minireview. Microbes Environ. 2015, 30, 126–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nie, L.; Zhang, A.Z.; Jiang, N.; Yang, Z.N. Application of probiotics in the production of juvenile ruminants. Feed. Rev. 2017, 9, 11–14. [Google Scholar]
- Zapata, O.; Cervantes, A.; Barreras, A.; Monge-Navarro, F.; González-Vizcarra, V.M.; Estrada-Angulo, A.; Urías-Estrada, J.; Corona, L.; Zinn, R.; Martínez-Alvarez, I.; et al. Effects of single or combined supplementation of probiotics and prebiotics on ruminal fermentation, ruminal bacteria and total tract digestion in lambs. Small Rumin. Res. 2021, 204, 106538. [Google Scholar] [CrossRef] [Scilit]
- Chu, J.; Liu, K.C.; He, Q.X.; Han, L.W. Mechanisms of yeast in monogastric animals and ruminants. Chin. Anim. Husband Vet. Med. 2009, 36, 14–17. [Google Scholar]
- Wu, D. Studies on Compound Microbial Feed Additives. Master’s Thesis, Lanzhou Jiaotong University, Lanzhou, China, 2015. [Google Scholar]
- Wang, R.Z.; Sun, Y.J.; Chen, W.; Huang, Y.Q.; Jiang, Z.H.; Yang, Q.F.; Meng, G.M.; Chen, X.P. Effects of clostridium butyricum on performance of breed ducks. J. Henan Agric. Sci. 2009, 10, 143–145. [Google Scholar]
- Cai, L.Y.; Yu, J.K.; Hartanto, R.; Qi, D.S. Dietary supplementation with Saccharomyces cerevisiae, Clostridium butyricum and their combination ameliorate rumen fermentation and growth performance of heat-stressed goats. Animals 2021, 11, 2116. [Google Scholar] [CrossRef] [Scilit]
- Retta, K.S. Role of probiotics in rumen fermentation and animal performance: A review. Int. J. Livestock Prod. 2016, 7, 24–32. [Google Scholar]
- Miller-Webster, T.; Hoover, W.H.; Holt, M.; Nocek, J.E. Influence of yeast culture on ruminal microbial metabolism in continuous culture. J. Dairy Sci. 2002, 85, 2009–2014. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.Y.; Rudy, H.; Zhang, J.; Qi, D.S. Clostridium butyricum improves rumen fermentation and growth performance of heat-stressed goats in vitro and in vivo. Animals 2021, 11, 3216. [Google Scholar] [CrossRef] [Scilit]
- Tajima, K.; Nonaka, I.; Higuchi, K.; Takusari, N.; Kurihara, M.; Takenaka, A.; Mitsumori, M.; Kajikawa, H.; Aminov, R.I. Influence of high temperature and humidity on rumen bacterial diversity in Holstein heifers. Anaerobe 2007, 2, 57–64. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.Y.; Yu, J.K.; Zhang, J.; Qi, D.S. The effects of slatted floors and manure scraper systems on the concentrations and emission rates of ammonia, methane and carbon dioxide in goat buildings. Small Rumin. Res. 2015, 132, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Maloiy, G.M.O.; Kanui, T.I.; Towett, P.K.; Wambugua, S.N.; Miarona, J.O.; Wanyoike, M.M. Effects of dehydration and heat stress on food intake and dry matter digestibility in East African ruminants. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2008, 2, 185–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yadav, B. Impact of heat stress on rumen functions. Vet. World 2013, 6, 992–996. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.Q. Application of yeast in dairy feed. Feed Res. 2011, 2, 22–24. [Google Scholar]
- Cai, L.Y.; Yu, J.K.; Hartanto, R.; Zhang, J.C.; Yang, A.; Qi, D.S. Effects of heat challenge on growth performance, ruminal, blood and physiological parameters of Chinese crossbred goats. Small Rumin. Res. 2019, 174, 125–130. [Google Scholar] [CrossRef] [Scilit]
- Cai, L.Y.; Hartanto, R.; Xu, Q.B.; Zhang, J.; Qi, D.S. Saccharomyces cerevisiae and Clostridium butyricum could improve b-vitamin production in the rumen and growth performance of heat-stressed goats. Metabolites 2022, 12, 766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mo, F. Evaluation and Application of Nutritional Requirements of Ruminants and Nutritional Value of Feed; China Agricultural University Press: Beijing, China, 2011. [Google Scholar]
- Chaidanya, K.; Soren, N.M.; Sejian, V.; Bagath, M.; Manjunathareddy, G.B.; Kurien, K.E.; Varma, G.; Bhatta, R. Impact of heat stress, nutritional stress and combined (heat and nutritional) stresses on rumen associated fermentation characteristics, histopathology and HSP70 gene expression in goats. J. Anim. Behav. Biometeorol. 2017, 5, 36–48. [Google Scholar] [CrossRef] [Scilit]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef] [Scilit]
- Maitisaiyidi, T.; Yibureyimu, A.; Yang, K. Determination of ammonia-nitrogen in ruminal fluid treated with methanol by alkaline hypochlorite-phenol spectrophotometry. Xinjiang Agric. Sci. 2012, 3, 565–570. [Google Scholar]
- Yang, W.Z.; Beauchemin, K.A.; Rode, L.M. Effects of grain processing, forage to concentrate ratio, and forage particle size on rumen pH and digestion by dairy cows. J. Dairy Sci. 2001, 2, 203–216. [Google Scholar] [CrossRef] [Scilit]
- AOAC. Official Methods of Analysis, 18th ed.; AOAC Int.: Gaithersburg, MD, USA, 2005. [Google Scholar]
- Goering, H.K.; Van Soest, P.J. Forage Fiber Analysis (Apparatus, Reagents, Procedures and Some Applications); USDA Agricultural Handbook: Washington, DC, USA, 1970; p. 379. [Google Scholar]
- Uyeno, Y.; Sekiguchi, Y.; Tajima, K.; Takenaka, A.; Kurihar, M.; Kamagata, Y. An rRNA-based analysis for evaluating the effect of heat stress on the rumen microbial composition of Holstein heifers. Anaerobe 2010, 1, 27–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gan, F.; Ren, F.; Chen, X.X.; Lv, C.H.; Pan, C.L.; Ye, G.P.; Shi, J.; Shi, X.; Zhou, H.; Shituleni, S.A.; et al. Effects of selenium-enriched probiotics on heat shock protein mRNA levels in piglet under heat stress conditions. J. Agric. Food Chem. 2013, 61, 2385–2391. [Google Scholar] [CrossRef] [Scilit]
- Shah, M.; Zaneb, H.; Masood, S.; Khan, R.U.; Mobashar, M.; Khan, I.; Din, S.; Khan, M.S.; Rehman, H.U.; Tinelli, A. Single or combined applications of zinc and multi-strain probiotic on intestinal histomorphology of broilers under cyclic heat stress. Probiotics Antimicrob. Proteins 2020, 12, 473–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bach, A.; Iglesias, C.; Devant, M. Daily ruminal pH pattern of loose-housed dairy cattle as affected by feeding pattern and live yeast supplementation. Anim. Feed Sci. Technol. 2007, 1, 146–153. [Google Scholar] [CrossRef] [Scilit]
- Moallem, U.; Lehrer, H.; Livshitz, L.; Zachut, M.; Yakoby, S. The effects of live yeast supplementation to dairy cows during the hot season on production, feed efficiency, and digestibility. J. Dairy Sci. 2009, 92, 343–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thrune, M.; Bach, A.; Ruiz-Moreno, M.; Stern, M.D.; Linn, J.G. Effects of Saccharomyces cerevisiae on ruminal pH and microbial fermentation in dairy cows: Yeast supplementation on rumen fermentation. Livest. Sci. 2009, 124, 261–265. [Google Scholar] [CrossRef] [Scilit]
- Qadis, A.Q.; Goya, S.; Ikuta, K.; Yatsu, M.; Kimura, A.; Nakanishi, S.; Sato, S. Effects of a bacteria-based probiotic on ruminal ph, volatile fatty acids and bacterial flora of holstein calves. J. Vet. Med. Sci. 2004, 76, 877–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaucheyras-Durand, F.; Walker, N.D.; Bach, A. Effects of active dry yeasts on the rumen microbial ecosystem: Past, present and future. Anim. Feed Sci. Technol. 2008, 145, 5–26. [Google Scholar] [CrossRef] [Scilit]
- Galip, N. Effect of supplemental yeast culture and sodium bicarbonate on ruminal fermentation and blood variables in rams. J. Anim. Physiol. Anim. Nutr. 2006, 90, 446–452. [Google Scholar] [CrossRef] [Scilit]
- Lascano, G.J.; Zanton, G.I.; Heinrichs, A.J. Concentrate levels and Saccharomyces cerevisiae affect rumen fluid-associated bacteria numbers in dairy heifers. Livest. Sci. 2009, 126, 189–194. [Google Scholar] [CrossRef] [Scilit]
- Hossain, S.A.; Parnerkar, S.; Haque, N.; Gupta, R.S.; Kumar, D.; Tyagi, A.K. Influence of dietary Supplementation of live yeast (Saccharomyces cerevisiae) on nutrient utilization, ruminal and biochemical profiles of Kankrej calves. Int. J. Appl. Anim. Sci. 2012, 1, 30–38. [Google Scholar]
- Oeztuerk, H. Effects of live and autoclaved yeast cultures on ruminal fermentation in vitro. J. Anim. Feed Sci. 2009, 18, 142–150. [Google Scholar] [CrossRef] [Scilit]
- Schingoethe, D.J.; Linke, K.N.; Kalscheur, K.F.; Hippen, A.R.; Rennich, D.R.; Yoon, I. Feed efciency of mid-lactation dairy cows fed yeast culture during summer. J. Dairy Sci. 2004, 87, 4178–4181. [Google Scholar] [CrossRef] [Scilit]
- El-Waziry, A.M.; Ibrahim, H.R. Effect of Saccharomyces cerevisiae on cell wall constituents digestion in sheep fed berseem (Trifolium alexandrinum) hay and cellulase activity. In Proceedings of the International Conference on the Arabian Oryx in the Arabian Peninsula, Riyadh, Saudi Arabia, 20–22 August 2007; p. 142. [Google Scholar]
- Desnoyers, M.; Giger-Reverdin, S.; Bertin, G.; Duvaux-Ponter, C.; Sauvant, D. Meta-analysis of the influence of Saccharomyces cerevisiae supplementation on ruminal parameters and mile productuin of ruminant. J. Dairy Sci. 2009, 92, 1620–1632. [Google Scholar] [CrossRef] [Scilit]
- Ondarza, M.B.; Sniffen, C.J.; Dussert, L.; Chevaux, E.; Sullivan, J.; Walker, N. CASE STUDY: Multiple-study analysis of the effect of live yeast on milk yield, milk component content and yield, and feed efficiency. Prof. Anim. Sci. 2010, 26, 661–666. [Google Scholar] [CrossRef] [Scilit]
- Křižova, L.; Richter, M.; Třinacty, J.; Řiha, J.; Kumprechtová, D. The effect of feeding live yeast cultures on ruminal pH and redox potential in dry cows as continuously measured by a new wireless device. Czech J. Anim. Sci. 2011, 56, 37–45. [Google Scholar] [CrossRef] [Scilit]
- Patra, A.K. The use of live yeast products as microbial feed additives in ruminant nutrition. Asian J. Anim. Vet. Adv. 2012, 7, 366–375. [Google Scholar] [CrossRef] [Scilit]
- Lila, Z.A.; Mohammed, N.; Yasui, T.; Kurokawa, Y.; Kanda, S.; Itabashi, H. Effects of a twin strain of Sacchatromyces cerevisiae live cells on mixed ruminal microorganism fermentation in vitro. J. Anim. Sci. 2004, 82, 1847–1854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uyeno, Y.; Akiyama, K.; Hasunuma, T.; Yamamoto, H.; Yokokawa, H.; Yamaguchi, T.; Kawashima, K.; Itoh, M.; Kushibiki, S.; Hirako, M. Effects of supplementing an active dry yeast product on rumen microbial community composition and on subsequent rumen fermentation of lactating cows in the midâ toâ late lactation period. Anim. Sci. J. 2017, 88, 119–124. [Google Scholar] [CrossRef] [Scilit]
- Stella, A.V.; Paratte, R.; Valnegri, L.; Cigalino, G.; Soncini, G.; Chevaux, E.; Dell’Orto, V.; Savoini, G. Effect of administration of live Saccharomyces cerevisiae on milk production, milk composition, blood metabolites, and faecal flora in early lactating dairy goats. Small Rumin. Res. 2007, 67, 7–13. [Google Scholar] [CrossRef] [Scilit]
- Lesmeister, K.E.; Heinrichs, A.J. Effects of corn processing on growth characteristics, rumen development and rumen parameters in neonatal dairy calves. J. Dairy Sci. 2004, 87, 3439–3450. [Google Scholar] [CrossRef] [Scilit]
- Haddad, G.; Goussous, S.N. Effect of yeast culture supplementation on nutrient intake, digestibility and growth performance of Awassi lambs. Anim. Feed Sci. Technol. 2005, 118, 342–348. [Google Scholar] [CrossRef] [Scilit]
- Kawas, J.; García-Castillo, R.; Garza-Cazares, F.; Fimbres-Durazo, H.; Olivares-Sáenz, E.; Hernández-Vidal, G.; Lu, C. Effects of sodium bicarbonate and yeast on productive performance and carcass characteristics of light-weight lambs fed finishing diets. Small Rumin. Res. 2007, 67, 157–163. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.M.; Cao, G.T.; Ferket, R.R.; Liu, T.T.; Zhou, L.; Zhang, L.; Xiao, Y.P.; Chen, A.G. Effects of probiotic, Clostridium Butyricum on growth performance, immune function, and cecal microflora in broiler chickens. Poult. Sci. 2012, 91, 2121–2129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yi, Z.H. Advances in research and application of probiotic Clostridium butyrate. Feed Res. 2012, 2, 4–17. [Google Scholar]
- Soren, N.M.; Tripathi, M.K.; Bhatt, R.S.; Karim, S.A. Effect of yeast supplementation on the growth performance of Malpura lambs. Trop. Anim. Health Prod. 2013, 45, 547–554. [Google Scholar] [CrossRef] [Scilit]


| Ingredient | Content |
|---|---|
| Alfalfa | 552 |
| Ground corn | 274 |
| Soybean meal | 74 |
| Wheat barn | 63 |
| Ca2HPO4 | 7 |
| Premix * | 10 |
| Nutrition Level | |
| Dry matter | 946 |
| Organic matter | 858 |
| Crude protein | 177 |
| Neutral detergent fiber | 435 |
| Acid detergent fiber | 260 |
| Ca | 5.9 |
| P | 3.2 |
| Gene | Primer Sequence | Product Length | Annealing Temperature | GenBank Accession No. |
|---|---|---|---|---|
| B-actin | F: TCTGGCACCACACCTTCTAC R: TCTTCTCACGGTTGGGCCTTG | 102 | 60 | XM 018039831.1 |
| HSP 70 | F: TGGCTTTCACCGATACCGAG R: GTCGTTGATCACGCGGAAAG | 167 | 60 | NM 001285703.1 |
| HSPA 1 | F: CGACCAGGGAAACCGGCAC R: CGGGTCGCCGAACTTGC | 151 | 60 | NM 005677146.3 |
| HSPA 6 | F: TCTGCCGCAACAGGATAAA R: CGCCCACGCACGAGTAC | 239 | 60 | NM_001314233.1 |
| HSPA 8 | F: ACCTCTATTACCCGTGCCC R: CTCTTATTCAGTTCCTTCCCATT | 203 | 60 | XM 018039831.1 |
| Periods | ||||
|---|---|---|---|---|
| Parameters | Control | Heat Stress | SEM | p Values |
| Rectal temperature (°C) | 39.51 a | 39.44 b | 0.11 | 0.232 |
| Skin temperature (°C) | 33.11 a | 36.54 b | 1.23 | 0.047 |
| Pulse (beats/min) | 76.30 a | 85.12 b | 6.53 | 0.002 |
| Respiratory rate (breaths/min) | 25.43 a | 33.1 b | 4.25 | 0.032 |
| Treatment | SEM | p Value | ||||||
|---|---|---|---|---|---|---|---|---|
| Parameters | Control | CB | SC | Mix | SC | CB | Mix | |
| pH | 6.54 a | 6.87 b | 6.80 b | 6.83 b | 0.17 | <0.001 | <0.001 | <0.001 |
| ORP (mV) | −161.3 a | −191.0 b | −193.4 b | −197.1 b | 8.24 | 0.044 | <0.001 | 0.022 |
| NH3-N (mg 100 mL−1) | 9.17 a | 10.89 ab | 12.23 b | 13.81 b | 1.47 | 0.041 | 0.021 | 0.041 |
| TVFA (mmol L−1) | 32.84 a | 51.22 b | 52.68 b | 52.98 b | 6.45 | 0.043 | <0.001 | <0.001 |
| Acetic acid (mmol L−1) | 14.38 a | 24.12 b | 24.77 b | 25.59 b | 3.08 | 0.009 | <0.001 | <0.001 |
| Propionic acid (mmol L−1) | 10.08 a | 15.22 b | 16.24 b | 15.73 b | 3.44 | 0.004 | 0.023 | <0.001 |
| Butyric acid (mmol L−1) | 8.38 a | 11.90 b | 11.67 b | 11.69 b | 2.68 | 0.044 | 0.040 | 0.056 |
| A/P ratio | 1.43 a | 1.59 b | 1.53 b | 1.63 b | 0.55 | 0.007 | 0.049 | 0.022 |
| Avicelase (IU mL−1) | 1.30 a | 1.56 b | 1.61 b | 1.81 b | 0.02 | 0.040 | <0.001 | <0.001 |
| CMCase (IU mL−1) | 1.34 a | 2.51 b | 2.58 c | 3.12 b | 0.01 | <0.001 | <0.001 | <0.001 |
| Cellobiase (IU mL−1) | 2.44 a | 4.43 b | 4.51 b | 4.73 b | 0.05 | <0.001 | <0.001 | <0.001 |
| Xylanase (IU mL−1) | 4.54 a | 6.43 b | 7.21 c | 7.62 b | 0.10 | <0.001 | <0.021 | 0.043 |
| Groups | p Value | |||||||
|---|---|---|---|---|---|---|---|---|
| Parameters | Control | CB | SC | Mix | SEM | SC | CB | Mix |
| DMI (kg) | 0.70 a | 0.85 b | 0.85 c | 0.88 b | 0.12 | 0.045 | <0.001 | <0.001 |
| ADG (kg) | 0.08 a | 0.15 b | 0.17 b | 0.19 b | 0.04 | 0.005 | <0.001 | 0.004 |
| Digestibility of | ||||||||
| DM (%) | 51.57 a | 59.48 b | 60.64 c | 63.34 b | 6.63 | 0.002 | <0.001 | <0.001 |
| NDF (%) | 39.23 a | 47.40 b | 50.31 b | 51.02 b | 3.09 | <0.001 | <0.001 | 0.040 |
| ADF (%) | 35.28 a | 45.30 b | 48.60 b | 49.29 b | 3.47 | <0.001 | <0.001 | <0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xue, L.; Wang, D.; Zhang, F.; Cai, L. Prophylactic Feeding of Clostridium butyricum and Saccharomyces cerevisiae Were Advantageous in Resisting the Adverse Effects of Heat Stress on Rumen Fermentation and Growth Performance in Goats. Animals 2022, 12, 2455. https://doi.org/10.3390/ani12182455
Xue L, Wang D, Zhang F, Cai L. Prophylactic Feeding of Clostridium butyricum and Saccharomyces cerevisiae Were Advantageous in Resisting the Adverse Effects of Heat Stress on Rumen Fermentation and Growth Performance in Goats. Animals. 2022; 12(18):2455. https://doi.org/10.3390/ani12182455
Chicago/Turabian StyleXue, Ligang, Dan Wang, Fangyu Zhang, and Liyuan Cai. 2022. "Prophylactic Feeding of Clostridium butyricum and Saccharomyces cerevisiae Were Advantageous in Resisting the Adverse Effects of Heat Stress on Rumen Fermentation and Growth Performance in Goats" Animals 12, no. 18: 2455. https://doi.org/10.3390/ani12182455
APA StyleXue, L., Wang, D., Zhang, F., & Cai, L. (2022). Prophylactic Feeding of Clostridium butyricum and Saccharomyces cerevisiae Were Advantageous in Resisting the Adverse Effects of Heat Stress on Rumen Fermentation and Growth Performance in Goats. Animals, 12(18), 2455. https://doi.org/10.3390/ani12182455
