Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Serological Analysis
2.2.1. Indirect Immunofluorescence Assay for Bacterial Pathogens
2.2.2. Indirect Immunofluorescence Assay for Leishmania
2.3. Molecular Analysis
2.3.1. DNA Extraction
2.3.2. DNA Amplification and Sequencing
2.4. Statistical Analysis
3. Results
3.1. Serological Analysis
3.2. Molecular Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Gerhold, R.W.; Jessup, D.A. Zoonotic diseases associated with free-roaming cats. Zoonoses Public Health 2013, 60, 189–195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giannelli, A.; Latrofa, M.S.; Nachum-Biala, Y.; Hodžić, A.; Greco, G.; Attanasi, A.; Annoscia, G.; Otranto, D.; Baneth, G. Three different Hepatozoon species in domestic cats from southern Italy. Tick Tick Borne Dis. 2017, 8, 721–724. [Google Scholar] [CrossRef] [Scilit]
- Mancianti, F.; Nardoni, S.; Mugnaini, L.; Zambernardi, L.; Guerrini, A.; Gazzola, V.; Papini, R.A. A retrospective molecular study of select intestinal protozoa in healthy pet cats from Italy. J. Feline Med. Surg. 2015, 17, 163–167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Otranto, D.; Napoli, E.; Latrofa, M.S.; Annoscia, G.; Tarallo, V.D.; Greco, G.; Lorusso, L.; Gulotta, L.; Falsone, L.; Solari Basano, F.; et al. Feline and canine leishmaniosis and other vector-borne diseases in the Aeolian Islands: Pathogen and vector circulation in a confined environment. Vet. Parasitol. 2017, 236, 144–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spada, E.; Proverbio, D.; Galluzzo, P.; Della Pepa, A.; Perego, R.; Bagnagatti De Giorgi, G.; Ferro, E. Molecular study on selected vector-borne infections in urban stray colony cats in northern Italy. J. Feline Med. Surg. 2014, 16, 684–688. [Google Scholar] [CrossRef] [Scilit]
- Spada, E.; Proverbio, D.; Galluzzo, P.; Perego, R.; Bagnagatti De Giorgi, G.; Roggero, N.; Caracappa, S. Frequency of piroplasms Babesia microti and Cytauxzoon felis in stray cats from northern Italy. BioMed. Res. Int. 2014, 943754. [Google Scholar]
- Morganti, G.; Veronesi, F.; Stefanetti, V.; Di Muccio, T.; Fiorentino, E.; Diaferia, M.; Santoro, A.; Passamonti, F.; Gramiccia, M. Emerging feline vector-borne pathogens in Italy. Parasites Vectors 2019, 12, 193. [Google Scholar] [CrossRef] [Scilit]
- Otranto, D.; Dantas-Torres, F. Canine and feline vector-borne diseases in Italy: Current situation and perspectives. Parasites Vectors 2010, 3, 2. [Google Scholar] [CrossRef] [Scilit]
- Maggi, R.G.; Krämer, F. A review on the occurrence of companion vector-borne diseases in pet animals in Latin America. Parasites Vectors 2019, 12, 1–37. [Google Scholar] [CrossRef] [Scilit]
- Tabar, M.D.; Movilla, R.; Serrano, L.; Altet, L.; Francino, O.; Roura, X. PCR evaluation of selected vector-borne pathogens in dogs with pericardial effusion. J. Small Anim. Pract. 2018, 59, 248–252. [Google Scholar] [CrossRef] [Scilit]
- Beugnet, F.; Marié, J.L. Emerging arthropod-borne diseases of companion animals in Europe. Vet. Parasitol. 2009, 163, 298–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diakou, A.; Di Cesare, A.; Accettura, P.M.; Barros, L.; Iorio, R.; Paoletti, B.; Frangipane di Regalbono, A.; Halos, L.; Beugnet, F.; Traversa, D. Intestinal parasites and vector-borne pathogens in stray and free-roaming cats living in continental and insular Greece. PLoS Negl. Trop. Dis. 2017, 11, e0005335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poli, A.; Abramo, F.; Barsotti, P.; Leva, S.; Gramiccia, M.; Ludovisi, A.; Mancianti, F. Feline leishmaniosis due to Leishmania infantum in Italy. Vet. Parasitol. 2002, 106, 181–191. [Google Scholar] [CrossRef] [Scilit]
- Maroli, M.; Pennisi, M.G.; Di Muccio, T.; Khoury, C.; Gradoni, L.; Gramiccia, M. Infection of sandflies by a cat naturally infected with Leishmania infantum. Vet. Parasitol. 2007, 145, 357–360. [Google Scholar] [CrossRef] [Scilit]
- Penzhorn, B.L.; Oosthuizen, M.C. Babesia species of domestic cats: Molecular characterization has opened Pandora’s box. Front. Vet. Sci. 2020, 7, 134. [Google Scholar] [CrossRef] [Scilit]
- Adaszek, L.; Winiarczyk, S.; Lukaszewska, J.; Heile, C. Feline babesiosis. J. Small Anim. Prac. 2010, 55, 624–634. [Google Scholar]
- Moik, K.; Gothe, R. Babesia infections of the felids: A case description in a cat in Germany. Vet. Prac. 1997, 25, 532–535. [Google Scholar]
- Veronesi, F.; Ravagnan, S.; Cerquetella, M.; Carli, E.; Olivieri, E.; Santoro, A.; Pesaro, S.; Berardi, S.; Rossi, G.; Ragni, B.; et al. First detection of Cytauxzoon spp. infection in European wildcats (Felis silvestris silvestris) of Italy. Ticks Tick Borne Dis. 2016, 7, 853–858. [Google Scholar] [CrossRef] [Scilit]
- Sherrill, M.K.; Cohn, L.A. Cytauxzoonosis: Diagnosis and treatment of an emerging disease. J. Feline Med. Surg. 2015, 17, 940–948. [Google Scholar] [CrossRef] [Scilit]
- André, M.R.; Herrera, H.M.; de Jesus Fernandes, S.; de Sousa, K.C.M.; Goncalves, L.R.; Domingos, I.H.; de Macedo, G.C.; Machado, R.Z. Tick-borne agents in domesticated and stray cats from the city of Campo Grande state of Mato Grosso do Sul, midwestern Brazil. Ticks Tick Borne Dis. 2015, 6, 779–786. [Google Scholar] [CrossRef] [Scilit]
- Shock, B.C.; Murphy, S.M.; Patton, L.L.; Shock, P.M.; Olfenbutte, L.C.; Beringer, J.; Prange, S.; Grove, D.M.; Peek, M.; Butfiloski, J.W.; et al. Distribution and prevalence of Cytauxzoon felis in bobcats (Lynx rufus), the natural reservoir, and other wild felids in thirteen states. Vet. Parasitol. 2011, 175, 325–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.L.; Li, T.T.; Liu, G.H.; Zhu, X.Q.; Yao, C. Two tales of Cytauxzoon felis infections in domestic cats. Clin. Microbiol. Rev. 2017, 30, 861–885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haber, M.D.; Tucker, M.D.; Marr, H.S.; Levy, J.K.; Burgess, J.; Lappin, M.R.; Birkenheuer, A.J. The detection of Cytauxzoon felis in apparently healthy free-roaming cats in the USA. Vet. Parasitol. 2007, 146, 316–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagamori, Y.; Slovak, J.E.; Reichard, M.V. Prevalence of Cytauxzoon felis infection in healthy free roaming cats in North-Central Oklahoma and Central Iowa. J. Feline Med. Surg. Open Rep. 2016, 2, 1–4. [Google Scholar] [CrossRef] [Scilit]
- Rizzi, T.E.; Reichard, M.V.; Cohn, L.A.; Birkenheuer, A.J.; Taylor, J.D.; Meinkoth, J.H. Prevalence of Cytauxzoon felis infection in healthy cats from enzootic areas in Arkansas, Missouri, and Oklahoma. Parasites Vectors 2015, 8, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Alho, A.M.; Silva, J.; Fonseca, M.J.; Santos, F.; Nunes, C.; de Carvalho, L.M.; Rodrigues, M.; Cardoso, L. First report of Cytauxzoon sp. infection in a domestic cat from Portugal. Parasites Vectors 2016, 9, 220. [Google Scholar] [CrossRef] [Scilit]
- Díaz-Regañón, D.; Villaescusa, A.; Ayllón, T.; Rodríguez-Franco, F.; Baneth, G.; Calleja-Bueno, L.; García-Sancho, M.; Agulla, B.; Sainz, A. Molecular detection of Hepatozoon and Cytauxzoon sp. in domestic and stray cats from Madrid, Spain. Parasites Vectors 2017, 10, 112. [Google Scholar] [CrossRef] [Scilit]
- Legroux, J.P.; Halos, L.; René-Martellet, M.; Servonnet, M.; Pingret, J.L.; Bourdoiseau, G.; Baneth, G.; Chabanne, L. First clinical case report of Cytauxzoon sp. infection in a domestic cat in France. BMC Vet. Res. 2017, 13, 81. [Google Scholar] [CrossRef] [Scilit]
- Nentwig, A.; Meli, M.L.; Schrack, J.; Reichler, I.M.; Riond, B.; Gloor, C.; Howard, J.; Hofmann-Lehmann, R.; Willi, B. First report of Cytauxzoon sp. infection in domestic cats in Switzerland: Natural and transfusion-transmitted infections. Parasites Vectors 2018, 11, 292. [Google Scholar] [CrossRef] [Scilit]
- Panait, L.C.; Stock, G.; Globokar, M.; Balzer, J.; Groth, B.; Mihalca, A.D.; Pantchev, N. The first case of feline cytauxzoonosis in Germany: Clinical description and molecular confirmation. Res. Sq. 2020. preprint. [Google Scholar] [CrossRef] [Scilit]
- Baneth, G.; Sheiner, A.; Eyal, O.; Hahn, S.; Beaufils, J.P.; Anug, Y.; Talmi-Frank, D. Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasites Vectors 2013, 6, 102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kegler, K.; Nufer, U.; Alic, A.; Posthaus, H.; Olias, P.; Basso, W. Fatal infection with emerging apicomplexan parasite Hepatozoon silvestris in a domestic cat. Parasites Vectors 2013, 11, 428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Angelakis, E.; Billeter, S.A.; Breitschwerdt, E.B.; Chomel, B.B.; Raoult, D. Potential for tick-borne bartonelloses. Emerg. Infect. Dis. 2010, 16, 385. [Google Scholar] [CrossRef] [PubMed]
- Guptill, L. Bartonellosis. Vet. Microbiol. 2010, 140, 347–359. [Google Scholar] [CrossRef] [Scilit]
- Cairns, K.; Brewer, M.; Lappin, M.R. Prevalence of Coxiella burnetii DNA in vaginal and uterine samples from healthy cats of north-central Colorado. J. Feline Med. Surg. 2007, 9, 196–201. [Google Scholar] [CrossRef] [Scilit]
- Greene, C.E. Francisella and Coxiella infections. In Infectious Diseases of the Dog and Cat, 4th ed.; Greene, C.E., Ed.; Saunders: St Louis, MO, USA, 2012; pp. 476–484. [Google Scholar]
- Beaufils, J.P.; Martin-Granel, J.; Jumelle, P.; Barbault-Jumelle, M. Ehrlichiose probable chez le chat: Etude retrospective sur 21 cas. Prat. Méd. Chir. Anim. Cie. 1999, 34, 587–596. [Google Scholar]
- Stubbs, C.J.; Holland, C.J.; Reif, J.S.; Wheeler, S.; Lappin, R. Feline ehrlichiosis. Comp. Cont. Ed. Pract. Vet. 2000, 22, 307–318. [Google Scholar]
- Mugnaini, L.; Papini, R.; Gorini, G.; Passantino, A.; Merildi, V.; Mancianti, F. Pattern and predictive factors of endoparasitism in cats in Central Italy. Rev. Med. Vet. 2012, 163, 89–94. [Google Scholar]
- Spada, E.; Canzi, I.; Baggiani, L.; Perego, R.; Vitale, F.; Migliazzo, A.; Proverbio, D. Prevalence of Leishmania infantum and co-infections in stray cats in northern Italy. Comp. Immunol. Microbiol. Infect. Dis. 2016, 45, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Laflamme, D.P.; Kealy, R.D.; Schmidt, D.A. Estimation of body fat by body condition score. J. Vet. Int. Med. 1994, 8, 154. [Google Scholar]
- Kolonin, G.V. Fauna of Ixodid Ticks of the World (Acari, Ixodidae). 2009. Available online: http://www.kolonin.org/ (accessed on 27 October 2020).
- Ebani, V.V.; Bertelloni, F.; Fratini, F. Occurrence of Bartonella henselae types I and II in Central Italian domestic cats. Res. Vet. Sci. 2012, 93, 63–66. [Google Scholar] [CrossRef] [Scilit]
- Ebani, V.V.; Bertelloni, F. Serological evidence of exposure to Ehrlichia canis and Anaplasma phagocytophilum in Central Italian healthy domestic cats. Ticks Tick Borne Dis. 2014, 5, 668–671. [Google Scholar] [CrossRef] [Scilit]
- Kilic, S.; Komiya, T.; Celebi, B.; Aydin, N.; Saito, J.; Toriniwa, H.; Karatepe, B.; Babur, C. Seroprevalence of Coxiella burnetii in stray cats in Central Anatolia. Turk. J. Vet. Anim. Sci. 2008, 32, 483–486. [Google Scholar]
- Mancianti, F.; Meciani, N. Specific serodiagnosis of canine leishmaniasis by indirect immunofluorescence, indirect hemagglutination, and counterimmunoelectrophoresis.is. Am. J. Vet. Res. 1988, 49, 1409. [Google Scholar]
- Bergmans, A.M.C.; Schellekens, J.F.P.; Van Embden, J.D.A.; Schouls, L.M. Predominance of two Bartonella henselae variants among cat scratch disease patients in The Netherlands. J. Clin. Microbiol. 1996, 34, 254–260. [Google Scholar] [CrossRef] [Scilit]
- D’Oliveira, C.; Van der Weide, M.; Jacquiet, P.; JongeJan, F. Detection of Theileria annulata by the PCR in ticks (Acari: Ixodidae) collected from cattle in Mauritania. Exp. Appl. Acarol. 1997, 21, 279–291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ebani, V.V.; Rocchigiani, G.; Nardoni, S.; Bertelloni, F.; Vasta, V.; Papini, R.A.; Verin, R.; Poli, A.; Mancianti, F. Molecular detection of tick-borne pathogens in wild red foxes (Vulpes vulpes) from Central Italy. Acta Trop. 2017, 172, 197–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rocchigiani, G.; Ebani, V.V.; Nardoni, S.; Bertelloni, F.; Bascherini, A.; Leoni, A.; Mancianti, F.; Poli, A. Molecular survey on the occurrence of arthropod-borne pathogens in wild brown hares (Lepus europaeus) from Central Italy. Infect. Genet. Evol. 2018, 59, 142–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Criado-Fornelio, A.; Buling, A.; Pingret, J.L.; Etievant, M.; Boucraut-Baralon, C.; Alongi, A.; Agnone, A.; Torina, A. Hemoprotozoa of domestic animals in France: Prevalence and molecular characterization. Vet. Parasitol. 2009, 159, 73–76. [Google Scholar] [CrossRef] [Scilit]
- Gallusová, M.; Jirsová, D.; Mihalca, A.D.; Gherman, C.M.; D’Amico, G.; Qablan, M.A.; Modrý, D. Cytauxzoon infections in wild felids from Carpathian-Danubian- Pontic space: Further evidence for a different Cytauxzoon species in European felids. J. Parasitol. 2016, 102, 377–380. [Google Scholar] [CrossRef] [Scilit]
- Millán, J.; Naranjo, V.; Rodríguez, A.; de la Lastra, J.M.; Mangold, A.J.; de la Fuente, J. Prevalence of infection and 18S rRNA gene sequences of Cytauxzoon species in Iberian lynx (Lynx pardinus) in Spain. Parasitology 2007, 134, 995–1001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ketz-Riley, C.J.; Reichard, M.V.; Van den Bussche, R.A.; Hoover, J.P.; Meinkoth, J.; Kocan, A.A. An intraerythrocytic small piroplasm in wild-caught Pallas’s cats (Otocolobus manul) from Mongolia. J. Wildl. Dis. 2003, 39, 424–430. [Google Scholar] [CrossRef] [Scilit]
- Carli, E.; Trotta, M.; Chinelli, R.; Drigo, M.; Sinigoi., L.; Tosolini, P.; Furlanello, T.; Millotti, A.; Caldin, M.; Solano-Gallego, L. Cytauxzoon sp. infection in the first endemic focus described in domestic cats in Europe. Vet. Parasitol. 2012, 183, 343–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carli, E.; Trotta, M.; Bianchi, E.; Furlanello, T.; Caldin, M.; Pietrobelli, M.; Solano-Gallego, L. Cytauxzoon sp. infection in two free ranging young cats: Clinicopathological findings, therapy and follow up. Türkiye Parazitol. Derg. 2014, 38, 185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Relman, D.A.; Falkow, S.; Lepp, P.W.; Schmidt, T.M. The causative agent of bacillary angiomatosis is closely related to Bartonella bacilliformis. In Programs and Abstracts of the 31st Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, Illinois, 29 September–2 October 1991; American Society for Microbiology: Chicago, IL, USA, 1991; Abstract Number 443. [Google Scholar]
- Berri, M.; Rekiki, A.; Boumedine, A.; Rodolakis, A. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum, and Coxiella burnetii from aborted ruminant’s clinical samples using multiplex PCR. BMC Microbiol. 2009, 9, 130. [Google Scholar] [CrossRef] [Scilit]
- Kocan, A.A.; Levesque, G.C.; Whitworth, L.C.; Murphy, G.L.; Ewing, S.A.; Barker, R.W. Naturally occurring Ehrlichia chaffeensis infection in coyotes from Oklahoma. Emerg. Infect. Dis. 2000, 6, 477. [Google Scholar] [CrossRef] [Scilit]
- Van Eys, G.J.J.M.; Schoone, G.J.; Kroon, N.C.; Ebeling, S.B. Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasites. Mol. Biochem. Parasitol. 1992, 51, 133–142. [Google Scholar]
- Beck, R.; VoJta, L.; MrlJak, V.; Marinculić, A.; Beck, A.; Živičnjak, T.; Cacciò, S.M. Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia. Int. J. Parasitol. 2009, 39, 843–848. [Google Scholar] [CrossRef] [Scilit]
- Olmeda, A.S.; Armstrong, P.M.; Rosenthal, B.M.; Valladares, B.; Del Castillo, A.; De Armas, F.; Miguelez, M.; Gonzalez, A.; Rodrıguez Rodrıguez, J.A.; Spielman, A.; et al. A subtropical case of human babesiosis. Acta Trop. 1997, 67, 229–234. [Google Scholar] [CrossRef] [Scilit]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef] [Scilit]
- Reichard, M.V.; Van Den Bussche, R.A.; Meinkoth, J.H.; Hoover, J.P.; Kocan, A.A. A new species of Cytauxzoon from Pallas’ cats caught in Mongolia and comments on the systematics and taxonomy of piroplasmids. J. Parasitol. 2005, 91, 420–426. [Google Scholar] [CrossRef] [Scilit]
- Pennisi, M.G.; Lupo, T.; Malara, D.; Masucci, M.; Migliazzo, A.; Lombardo, G. Serological and molecular prevalence of Leishmania infantum infection in cats from southern Italy. J. Feline Med. Surg. 2012, 14, 656–657. [Google Scholar]
- Pennisi, M.G.; Persichetti, M.F. Feline leishmaniosis: Is the cat a small dog? Vet. Parasitol. 2018, 251, 131–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Persichetti, M.F.; Solano-Gallego, L.; Serrano, L.; Altet, L.; Reale, S.; Masucci, M.; Pennisi, M.G. Detection of vector-borne pathogens in cats and their ectoparasites in southern Italy. Parasites Vectors 2016, 9, 247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Persichetti, M.F.; Pennisi, M.G.; Vullo, A.; Masucci, M.; Migliazzo, A.; Solano-Gallego, L. Clinical evaluation of outdoor cats exposed to ectoparasites and associated risk for vector-borne infections in southern Italy. Parasites Vectors 2018, 11, 136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Latrofa, M.S.; Iatta, R.; Toniolo, F.; Furlanello, T.; Ravagnan, S.; Capelli, G.; Schunack, B.; Chomel, B.; Zatelli, A.; Mendoza-Roldan, J.; et al. A molecular survey of vector-borne pathogens and haemoplasmas in owned cats across Italy. Parasites Vectors 2020, 13, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, G.C.; Norris, J.M.; Mathews, K.O.; Chandra, S.; Šlapeta, J.; Bosward, K.L.; Ward, M.P. New insights on the epidemiology of Coxiella burnetii in pet dogs and cats from New South Wales, Australia. Acta Trop. 2020, 105416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knap, N.; Žele, D.; Biškup, U.G.; Avšič-Županc, T.; Vengušt, G. The prevalence of Coxiella burnetii in ticks and animals in Slovenia. BMC Vet. Res. 2019, 15, 368. [Google Scholar] [CrossRef] [Scilit]
- Meerburg, B.G.; Reusken, C.B.E.M. The role of wild rodents in spread and transmission of Coxiella burnetii needs further elucidation. Wildl. Res. 2011, 38, 617–625. [Google Scholar] [CrossRef] [Scilit]
- Little, S.F. Ehrlichiosis and anaplasmosis in dogs and cats. Vet. Clin. Small Anim. 2010, 40, 1121–1140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chomel, B.B.; Kasten, R.W.; Henn, J.B.; Molia, S. Bartonella infection in domestic cats and wild felids. Ann. N. Y. Acad. Sci. 2006, 1078, 410–415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouchouicha, R.; Durand, B.; Monteil, M.; Chomel, B.B.; Berrich, M.; Arvand, M.; Birtles, R.J.; Breitschwerdt, E.B.; Koehler, J.E.; Maggi, R.; et al. Molecular epidemiology of feline and human Bartonella henselae isolates. Emerg. Infect. Dis. 2009, 15, 813–816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woestyn, S.; Olivé, N.; Bigaignon, G.; Avesani, V.; Delmee, M. Study of genotypes and virB4 secretion gene of Bartonella henselae strains from patients with clinically defined cat scratch disease. J. Clin. Microbiol. 2004, 42, 1420–1427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pennisi, M.G.; Cardoso, L.; Baneth, G.; Bourdeau, P.; Koutinas, A.; Miró, G.; Oliva, G.; Solano-Gallego, L. LeishVet update and recommendations on feline leishmaniosis. Parasites Vectors 2015, 4, 302. [Google Scholar] [CrossRef] [Scilit]
- Chatzis, M.K.; Leontides, L.; Athanasiou, L.V.; Papadopoulos, E.; Kasabalis, D.; Mylonakis, M.; Rallis, T.; Koutinas, A.F.; Andreadou, M.; Ikonomopoulos, J.; et al. Evaluation of indirect immunofluorescence antibody test and enzyme-linked immunosorbent assay for the diagnosis of infection by Leishmania infantum in clinically normal and sick cats. Exp. Parasitol. 2014, 147, 54–59. [Google Scholar] [CrossRef] [Scilit]
- Mollicone, E.; Battelli, G.; Gramiccia, M.; Maroli, M.; Baldellii, R. A stable focus of canine leishmaniosis in the Bologna Province, Italy. Parassitologia 2003, 45, 85–88. [Google Scholar]
- Urbani, L.; Tirolo, A.; Salvatore, D.; Tumbarello, M.; Segatore, S.; Battilani, M.; Balboni, A.; Dondi, F. Serological, molecular and clinicopathological findings associated with Leishmania infantum infection in cats in Northern Italy. J. Feline Med. Surg. 2020, 22, 935–943. [Google Scholar] [CrossRef] [Scilit]
- Spada, E.; Perego, R.; Vitale, F.; Bruno, F.; Castelli, G.; Tarantola, G.; Baggiani, L.; Magistrelli, S.; Proverbio, D. Feline Leishmania spp. Infection in a non-endemic area of Northern Italy. Animals 2020, 10, 817. [Google Scholar] [CrossRef] [Scilit]
- Barandika, J.F.; Espí, A.; Oporto, B.; Del Cerro, A.; Barral, M.; Povedano, I.; García-Pérez, A.L.; Hurtado, A. Occurrence and genetic diversity of piroplasms and other apicomplexa in wild carnivores Parasitol. Open 2016, 2, 6. [Google Scholar]
- Hodžić, A.; Alić, A.; Duscher, G.G. High diversity of blood-associated parasites and bacteria in European wild cats in Bosnia and Herzegovina: A molecular study. Ticks Tick Borne Dis. 2018, 9, 589–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, H.M.; Berghaus, R.D.; Latimer, K.S.; Britt, J.O.; Rakich, P.M.; Peterson, D.S. Genetic variability of Cytauxzoon felis from 88 infected domestic cats in Arkansas and Georgia. J. Vet. Diagn. Investig. 2009, 21, 59–63. [Google Scholar] [CrossRef] [Scilit]
- Schreeg, M.E.; Marr, H.S.; Griffith, E.H.; Tarigo, J.L.; Bird, D.M.; Reichard, M.V.; Cohn, L.A.; Levy, M.G.; Birkenheuer, A.J. PCR amplification of a multi-copy mitochondrial gene (Cox3) improves detection of Cytauxzoon felis infection as compared to a ribosomal gene (18S). Vet. Parasitol. 2016, 225, 123–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duplan, F.; Davies, S.; Filler, S.; Abdullah, S.; Keyte, S.; Newbury, H.; Helps, C.R.; Wall, R.; Tasker, S. Anaplasma phagocytophilum, Bartonella spp., haemoplasma species and Hepatozoon spp. in ticks infesting cats: A large-scale survey. Parasites Vectors 2018, 11, 201. [Google Scholar] [CrossRef] [Scilit]
- Vilhena, H.; Martinez-Díaz, V.L.; Cardoso, L.; Vieira, L.; Altet, L.; Francino, O.; Pastor, J.; Silvestre-Ferreira, A.C. Feline vector-borne pathogens in the north and centre of Portugal. Parasites Vectors 2013, 6, 99. [Google Scholar] [CrossRef] [Scilit]
- Hodžić, A.; Alić, A.; Prašović, S.; Otranto, D.; Baneth, G.; Duscher, G.G. Hepatozoon silvestris sp. nov.: Morphological and molecular characterization of a new species of Hepatozoon (Adeleorina: Hepatozoidae) from the European wild cat (Felis silvestris silvestris). Parasitology 2017, 144, 650–661. [Google Scholar] [CrossRef] [Scilit]
- Ortuño, A.; Castellà, J.; Criado-Fornelio, A.; Buling, A.; Barba-Carretero, J.C. Molecular detection of a Hepatozoon species in stray cats from a feline colony in North-eastern Spain. Vet. J. 2008, 177, 134–135. [Google Scholar] [CrossRef] [Scilit]
- Basso, W.; Görner, D.; Globokar, M.; Keidel, A.; Pantchev, N. First autochthonous case of clinical Hepatozoon felis infection in a domestic cat in Central Europe. Parasitol. Int. 2019, 72, 101945. [Google Scholar] [CrossRef] [Scilit]

| Pathogen | Gene Target and Amplicon Length (bp) | Primers’ Name and Sequence | PCR Conditions | References |
|---|---|---|---|---|
| Anaplasma phagocytophilum | 16S rRNA 1 932 bp (First PCR) | GE3a CACATGCAAGTCGAACGGATTATTC GE10r TTCCGTTAAGAAGGATCTAATCTCC | 95 °C–30′’ 55 °C–30′’ 72 °C–1′ | [58] |
| 16S rRNA 1 546 bp (Second PCR) | GE9f AACGGATTATTCTTTATAGCTTGCT GE2 GGCAGTATTAAAAGCAGCTCAGGG | 95 °C–30′’ 55 °C–30′’ 72 °C–1′ | ||
| Bartonella spp. | 16S rRNA 1 296bp | P24E CCTCCTTCAGTTAGGCTGG P12B GAGATGGCTTTTGGAGATTA | 95 °C–1′ 57 °C–1′ 72 °C–1′ | [59] |
| Coxiella burnetii | IS1111a 2 687bp | TRANS-1 TATGTATCCACCGTAGCCAGT TRANS-2 CCCAACAACACCTCCTTATTC | 95 °C–30′’ 64 °C–1′ 72 °C–1′ | [60] |
| Ehrlichia canis | 16S rRNA 1 152 bp (First PCR) | ECCf AGAACGAACGCTGGCGGCAAGC ECBr CGTATTACCGCGGCTGCTGGCA | 94 °C–1′ 55 °C–2′ 72 °C–1.5′ | [61] |
| 16S rRNA 1 395bp (Second PCR) | ECAN5 CAATTATTTATAGCCTCTGGCTATAGGA HE3r TATAGGTACCGTCATTATCTTCCCTAT | 94 °C–1′ 55 °C–2′ 72 °C–1.5′ | ||
| Leishmania spp. | 18S rRNA 3 603 bp (First PCR) | R221 GGTTCCTTTCCTGATTTACG R332 GGCCGGTAAAGGCCGAATAG | 94 °C–30′’ 60 °C–30′’ 72 °C–30′’ | [62] |
| 350 bp (Second PCR) | R223 TCCCATCGCAACCTCGCTT R333 AAAGCGGGCGCGGTGCTG | 94 °C–30′’ 65 °C–30′’ 72 °C–30′’ | ||
| Babesia/Theileria spp. | 18S rRNA 3 560 bp | Mic1 GTCTTGTAATTGGAATGATGG Mic2 CCAAAGACTTTGATTTCTCTC | 94 °C–30′’ 50 °C–30′’ 72 °C–1′ | [63] |
| Cytauxzoon spp. | 18S rRNA 3 408 bp | Piro-A AATACCCAATCCTGACACAGGG Piro-B TTAAATACGAATGCCCCCAAC | 94 °C–30′’ 56 °C–30′’ 72 °C–45′’ | [64] |
| Hepatozoon spp. | 18S rRNA 3 625 bp | Hep-F ATACATGAGCAAAATCTCAAC Hep-R CTTATTATTCCATGCTGCAG | 94 °C–30′’ 57 °C–30′’ 72 °C–1′ | [65] |
| Pathogen | IFA | PCR | ||
|---|---|---|---|---|
| N Positive | Seropositivity Rate (%), 95% CI | N Positive | Detection Rate (%), 95% CI | |
| Anaplasma phagocytophilum | 4 | 4.7, 95% CI 2–9.2 | 0 | 0 |
| Bartonella henselae | 39 | 45.9, 95% CI 35.3–56.5 | 23 | 27.1, 95% CI 17.6–36.5 |
| Coxiella burnetii | 32 | 37.6, 95% CI 27.3–47.9 | 25 | 29.4, 95% CI 19.7–39.1 |
| Ehrlichia canis | 12 | 14.1, 95% CI 6.7–21.5 | 2 | 2.4, 95% CI 0–5.6 |
| Leishmania spp. | 2 | 2.4, 95% CI 0–5.6 | 5 | 5.9, 95% CI 0.9–10.9 |
| Babesia/Theileria spp. | - | - | 0 | 0 |
| Cytauxzoon sp. | - | - | 2 | 2.4, 95% CI 0–5.6 |
| Hepatozoon sp. | - | - | 0 | 0 |
| Cat ID | Cox Serol | Cox PCR | Bart Serol | Bart PCR | Anapl Serol | Anapl PCR | Ehr Serol | Ehr PCR | Hep PCR | Piro PCR | Cytaux PCR | Leish Serol | Leish PCR |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 22 | pos | pos | |||||||||||
| 30 | pos | pos | pos | ||||||||||
| 31 | pos | pos | pos | pos | pos | ||||||||
| 38 | pos | pos | pos | ||||||||||
| 40 | pos | pos | pos | pos | |||||||||
| 44 | pos | pos | pos | pos | |||||||||
| 45 | pos | pos | |||||||||||
| 50 | pos | pos | |||||||||||
| 52 | pos | pos | pos | ||||||||||
| 54 | pos | pos | pos | ||||||||||
| 62 | pos | pos | pos | ||||||||||
| 72 | pos | pos | pos | ||||||||||
| 75 | pos | pos | pos | ||||||||||
| 77 | pos | pos | |||||||||||
| 88 | pos | pos | pos | ||||||||||
| 90 | pos | pos | pos | pos | |||||||||
| 95 | pos | pos | pos | ||||||||||
| 97 | pos | pos | pos | pos | |||||||||
| 100 | pos | pos | pos | pos | |||||||||
| 101 | pos | pos | pos | ||||||||||
| 111 | pos | pos | pos |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ebani, V.V.; Guardone, L.; Marra, F.; Altomonte, I.; Nardoni, S.; Mancianti, F. Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey. Animals 2020, 10, 2334. https://doi.org/10.3390/ani10122334
Ebani VV, Guardone L, Marra F, Altomonte I, Nardoni S, Mancianti F. Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey. Animals. 2020; 10(12):2334. https://doi.org/10.3390/ani10122334
Chicago/Turabian StyleEbani, Valentina Virginia, Lisa Guardone, Federica Marra, Iolanda Altomonte, Simona Nardoni, and Francesca Mancianti. 2020. "Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey" Animals 10, no. 12: 2334. https://doi.org/10.3390/ani10122334
APA StyleEbani, V. V., Guardone, L., Marra, F., Altomonte, I., Nardoni, S., & Mancianti, F. (2020). Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey. Animals, 10(12), 2334. https://doi.org/10.3390/ani10122334

