Functional Analysis of Two Novel Streptococcus iniae Virulence Factors Using a Zebrafish Infection Model
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Media, Growth Conditions and Electroporation
2.2. Allelic Exchange Mutagenesis
2.3. Green Fluorescence Labelling of Wild-Type S. iniae, Isogenic Mutants and Complementation Strains
2.4. DNA-Methyl Green Assay
2.5. Quantification and Visualization of NETs Destruction
2.6. Malachite Green Phosphate Colorimetric Assay
2.7. Zebrafish Maintenance
2.8. Preparation and Microinjection of S. iniae
2.9. S. iniae Enumeration From Infected Larvae
2.10. Mounting and Confocal Imaging of Infected Larvae
2.11. Immunofluorescence Detection of Innate Immune Cells in Infected Larvae
2.12. Statistical Analyses
3. Results
3.1. Deletion of SpnAi Decreases DNase Activity in S. iniae
3.2. SpnAi Promotes Degradation of NETs
3.3. Deletion of S5nAi Decreases Nucleotidase Activity in S. iniae
3.4. SpnAi and S5nAi Contribute to S. iniae Virulence in Zebrafish Larvae
3.5. SpnAi and S5nAi Support the Growth of S. iniae in Zebrafish Larvae
3.6. Wild-type S. iniae, but Not SpnAi and S5nAi Deletion Mutants Were Able to Proliferate and Disseminate in Zebrafish Larvae
3.7. Zebrafish Larvae Infected with S. iniae ∆SpnAi Showed an Increasing Number of Neutrophils at the Site of Infection over Time
3.8. Zebrafish Larvae Infected with S. iniae ∆S5nAi Showed an Increasing Number of Macrophages at the Site of Infection over Time
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Pier, G.B.; Madin, S.H. Streptococcus iniae sp. nov., a beta-hemolytic streptococcus isolated from an Amazon. freshwater dolphin, Inia geoffrensis. Int. J. Syst. Evol. Microbiol. 1976, 26, 545–553. [Google Scholar] [CrossRef] [Scilit]
- Agnew, W.; Barnes, A.C. Streptococcus iniae: An aquatic pathogen of global veterinary significance and a challenging candidate for reliable vaccination. Vet. Microbiol. 2007, 122, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shoemaker, C.A.; Klesius, P.H.; Evans, J.J. Prevalence of Streptococcus iniae in tilapia, hybrid striped bass, and channel catfish on commercial fish farms in the United States. Am. J. Vet. Res. 2001, 62, 174–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lau, S.K.; Woo, P.C.; Luk, W.-k.; Fung, A.M.; Hui, W.-t.; Fong, A.H.; Chow, C.-w.; Wong, S.S.; Yuen, K.-y. Clinical isolates of Streptococcus iniae from Asia are more mucoid and β-hemolytic than those from North. America. Diagn. Microbiol. Infect. Dis. 2006, 54, 177–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baiano, J.C.; Barnes, A.C. Towards control of Streptococcus iniae. Emerg. Infect. Dis. 2009, 15, 1891–1896. [Google Scholar] [CrossRef] [Scilit]
- McMillan, D.J.; Sanderson-Smith, M.L.; Smeesters, P.R.; Sriprakash, K.S. Molecular Markers for the Study of Streptococcal Epidemiology. In Host-Pathogen Interactions in Streptococcal Diseases; Springer: Berlin/Heidelberg, Germany, 2012; pp. 29–48. [Google Scholar]
- Sun, J.-R.; Yan, J.-C.; Yeh, C.-Y.; Lee, S.-Y.; Lu, J.-J. Invasive infection with Streptococcus iniae in Taiwan. J. Med. Microbiol. 2007, 56, 1246–1249. [Google Scholar] [CrossRef] [Scilit]
- Richards, V.P.; Palmer, S.R.; Bitar, P.D.P.; Qin, X.; Weinstock, G.M.; Highlander, S.K.; Town, C.D.; Burne, R.A.; Stanhope, M.J. Phylogenomics and the dynamic genome evolution of the genus Streptococcus. Genome Biol. Evol. 2014, 6, 741–753. [Google Scholar] [CrossRef] [Scilit]
- Baiano, J.C.; Tumbol, R.A.; Umapathy, A.; Barnes, A.C. Identification and molecular characterisation of a fibrinogen binding protein from Streptococcus iniae. BMC Microbiol. 2008, 8, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Locke, J.B.; Aziz, R.K.; Vicknair, M.R.; Nizet, V.; Buchanan, J.T. Streptococcus iniae M-like protein contributes to virulence in fish and is a target for live attenuated vaccine development. PLoS ONE 2008, 3, e2824. [Google Scholar] [CrossRef] [Scilit]
- Locke, J.B.; Colvin, K.M.; Datta, A.; Patel, S.K.; Naidu, N.N.; Neely, M.N.; Nizet, V.; Buchanan, J.T. Streptococcus iniae Capsule Impairs Phagocytic Clearance and Contributes to Virulence in Fish. J. Bacteriol. 2006, 189, 1279–1287. [Google Scholar] [CrossRef] [Scilit]
- Lowe, B.A.; Miller, J.D.; Neely, M.N. Analysis of the polysaccharide capsule of the systemic pathogen Streptococcus iniae and its implications in virulence. Infect. Immun. 2007, 75, 1255–1264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, J.D.; Neely, M.N. Large-scale screen highlights the importance of capsule for virulence in the zoonotic pathogen Streptococcus iniae. Infect. Immun. 2005, 73, 921–934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolotin, S.; Fuller, J.D.; Bast, D.J.; de Azavedo, J.C. The two-component system sivS/R regulates virulence in Streptococcus iniae. FEMS Immunol. Med. Microbiol. 2007, 51, 547–554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuller, J.D.; Camus, A.C.; Duncan, C.L.; Nizet, V.; Bast, D.J.; Thune, R.L.; Low, D.E.; de Azavedo, J.C. Identification of a streptolysin S-associated gene cluster and its role in the pathogenesis of Streptococcus iniae disease. Infect. Immun. 2002, 70, 5730–5739. [Google Scholar] [CrossRef] [Scilit]
- Chang, A.; Khemlani, A.; Kang, H.; Proft, T. Functional analysis of Streptococcus pyogenes nuclease A (SpnA), a novel group A streptococcal virulence factor. Molec. Microbiol. 2011, 79, 1629–1642. [Google Scholar] [CrossRef] [Scilit]
- Zheng, L.; Khemlani, A.; Lorenz, N.; Loh, J.M.; Langley, R.J.; Proft, T. Streptococcal 5′-Nucleotidase A (S5nA), a novel Streptococcus pyogenes virulence factor that facilitates immune evasion. J. Biol. Chem. 2015, 290, 31126–31137. [Google Scholar] [CrossRef] [Scilit]
- Soh, K.Y.; Loh, J.M.S.; Proft, T. Orthologues of Streptococcus pyogenes nuclease A (SpnA) and Streptococcal 5′-nucleotidase A (S5nA) found in Streptococcus iniae. J. Biochem. 2018, 164, 165–171. [Google Scholar] [CrossRef] [Scilit]
- Berends, E.T.; Horswill, A.R.; Haste, N.M.; Monestier, M.; Nizet, V.; von Köckritz-Blickwede, M. Nuclease expression by Staphylococcus aureus facilitates escape from neutrophil extracellular traps. J. Innate Immun. 2010, 2, 576–586. [Google Scholar] [CrossRef] [Scilit]
- Buchanan, J.T.; Simpson, A.J.; Aziz, R.K.; Liu, G.Y.; Kristian, S.A.; Kotb, M.; Feramisco, J.; Nizet, V. DNase expression allows the pathogen group A Streptococcus to escape killing in neutrophil extracellular traps. Curr. Biol. 2006, 16, 396–400. [Google Scholar] [CrossRef] [Scilit]
- Beiter, K.; Wartha, F.; Albiger, B.; Normark, S.; Zychlinsky, A.; Henriques-Normark, B. An endonuclease allows Streptococcus pneumoniae to escape from neutrophil extracellular traps. Curr. Biol. 2006, 16, 401–407. [Google Scholar] [CrossRef] [Scilit]
- Brinkmann, V.; Reichard, U.; Goosmann, C.; Fauler, B.; Uhlemann, Y.; Weiss, D.S.; Weinrauch, Y.; Zychlinsky, A. Neutrophil extracellular traps kill bacteria. Science 2004, 303, 1532–1535. [Google Scholar] [CrossRef] [Scilit]
- Cekic, C.; Linden, J. Purinergic regulation of the immune system. Nat. Rev. Immun. 2016, 16, 177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, V.; Sharma, A. Adenosine: An endogenous modulator of innate immune system with therapeutic potential. Eur. J. Pharm. 2009, 616, 7–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasko, G.; Szabo, C.; Nemeth, Z.H.; Kvetan, V.; Pastores, S.M.; Vizi, E.S. Adenosine receptor agonists differentially regulate IL-10, TNF-alpha, and nitric oxide production in RAW 264.7 macrophages and in endotoxemic mice. J. Immun. 1996, 157, 4634–4640. [Google Scholar] [PubMed]
- Cronstein, B.N.; Kramer, S.B.; Weissmann, G.; Hirschhorn, R. Adenosine: A physiological modulator of superoxide anion generation by human neutrophils. J. Exp. Med. 1983, 158, 1160–1177. [Google Scholar] [CrossRef] [Scilit]
- Xaus, J.; Mirabet, M.; Lloberas, J.; Soler, C.; Lluis, C.; Franco, R.; Celada, A. IFN-γ up-regulates the A2B adenosine receptor expression in macrophages: A mechanism of macrophage deactivation. J. Immun. 1999, 162, 3607–3614. [Google Scholar] [PubMed]
- Bouma, M.G.; Jeunhomme, T.; Boyle, D.L.; Dentener, M.A.; Voitenok, N.N.; Van den Wildenberg, F.; Buurman, W.A. Adenosine inhibits neutrophil degranulation in activated human whole blood: Involvement of adenosine A2 and A3 receptors. J. Immun. 1997, 158, 5400–5408. [Google Scholar]
- Soh, K.Y.; Loh, J.M.; Proft, T. Cell wall-anchored 5′-nucleotidases in Gram-positive cocci. Mol. Microbiol. 2019, 113, 691–698. [Google Scholar] [CrossRef] [Scilit]
- Thammavongsa, V.; Schneewind, O.; Missiakas, D.M. Enzymatic properties of Staphylococcus aureus adenosine synthase (AdsA). BMC Biochem. 2011, 12, 56. [Google Scholar] [CrossRef] [Scilit]
- Thammavongsa, V.; Missiakas, D.M.; Schneewind, O. Staphylococcus aureus degrades neutrophil extracellular traps to promote immune cell death. Science 2013, 342, 863–866. [Google Scholar] [CrossRef] [Scilit]
- Fan, J.; Zhang, Y.; Chuang-Smith, O.N.; Frank, K.L.; Guenther, B.D.; Kern, M.; Schlievert, P.M.; Herzberg, M.C. Ecto-5′-nucleotidase: A candidate virulence factor in Streptococcus sanguinis experimental endocarditis. PLoS ONE 2012, 7, e38059. [Google Scholar] [CrossRef] [Scilit]
- Liu, P.; Pian, Y.; Li, X.; Liu, R.; Xie, W.; Zhang, C.; Zheng, Y.; Jiang, Y.; Yuan, Y. Streptococcus suis adenosine synthase functions as an effector in evasion of PMN-mediated innate immunity. J. Infect. Dis. 2014, 210, 35–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, J.; Lai, L.; Tang, H.; Wang, W.; Wang, S.; Lu, C.; Yao, H.; Fan, H.; Wu, Z. Streptococcus suis synthesizes deoxyadenosine and adenosine by 5′-nucleotidase to dampen host immune responses. Virulence 2018, 9, 1509–1520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herbomel, P.; Thisse, B.; Thisse, C. Ontogeny and behaviour of early macrophages in the zebrafish embryo. Blood 1999, 126, 3735–3745. [Google Scholar]
- Hermann, A.C.; Millard, P.J.; Blake, S.L.; Kim, C.H. Development of a respiratory burst assay using zebrafish kidneys and embryos. J. Immunol. Methods 2004, 292, 119–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Guyader, D.; Redd, M.J.; Colucci-Guyon, E.; Murayama, E.; Kissa, K.; Briolat, V.; Mordelet, E.; Zapata, A.; Shinomiya, H.; Herbomel, P. Origins and unconventional behavior of neutrophils in developing zebrafish. Blood 2008, 111, 132–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davidson, A.J.; Zon, L.I. The ‘definitive’(and ‘primitive’) guide to zebrafish hematopoiesis. Oncogene 2004, 23, 7233–7246. [Google Scholar] [CrossRef] [Scilit]
- Lam, S.; Chua, H.; Gong, Z.; Lam, T.; Sin, Y. Development and maturation of the immune system in zebrafish, Danio rerio: A gene expression profiling, in situ hybridization and immunological study. Dev. Comp. Immunol. 2004, 28, 9–28. [Google Scholar] [CrossRef] [Scilit]
- Trede, N.S.; Langenau, D.M.; Traver, D.; Look, A.T.; Zon, L.I. The use of zebrafish to understand immunity. Immunity 2004, 20, 367–379. [Google Scholar] [CrossRef] [Scilit]
- Podbielski, A.; Spellerberg, B.; Woischnik, M.; Pohl, B.; Lütticken, R. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 1996, 177, 137–147. [Google Scholar] [CrossRef] [Scilit]
- Loh, J.M.; Proft, T. Toxin–antitoxin-stabilized reporter plasmids for biophotonic imaging of Group A streptococcus. Appl. Microbiol. Biotechnol. 2013, 97, 9737–9745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinicropi, D.; Baker, D.L.; Prince, W.S.; Shiffer, K.; Shak, S. Colorimetric determination of DNase I activity with a DNA-methyl green substrate. Anal. Biochem. 1994, 222, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, C.; Flores, M.V.; Storm, T.; Crosier, K.; Crosier, P. The zebrafish lysozyme C promoter drives myeloid-specific expression in transgenic fish. BMC Dev. Biol. 2007, 7, 42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellett, F.; Pase, L.; Hayman, J.W.; Andrianopoulos, A.; Lieschke, G.J. mpeg1 promoter transgenes direct macrophage-lineage expression in zebrafish. Blood 2011, 117, 49–56. [Google Scholar] [CrossRef] [Scilit]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit]
- de Buhr, N.; Neumann, A.; Jerjomiceva, N.; von Köckritz-Blickwede, M.; Baums, C.G. Streptococcus suis DNase SsnA contributes to degradation of neutrophil extracellular traps (NETs) and evasion of NET-mediated antimicrobial activity. Microbiology 2014, 160, 385–395. [Google Scholar] [CrossRef] [Scilit]
- Jhelum, H.; Sori, H.; Sehgal, D. A novel extracellular vesicle-associated endodeoxyribonuclease helps Streptococcus pneumoniae evade neutrophil extracellular traps and is required for full virulence. Sci. Rep. 2018, 8, 7985. [Google Scholar] [CrossRef] [Scilit]
- Fox, I.H.; Kelley, W.N. The role of adenosine and 2’-deoxyadenosine in mammalian cells. Annu. Rev. Biochem. 1978, 47, 655–686. [Google Scholar] [CrossRef] [Scilit]
- Tucker, P.W.; Hazen, E.E.; Cotton, F.A. Staphylococcal nuclease reviewed: A prototypic study in contemporary enzymology. I isolation; physical and enzymatic properties. Mol. Cell. Biochem. 1978, 22, 67–78. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; Meng, J.; Shi, C.; Hervin, K.; Fratamico, P.M.; Shi, X. Characterization and comparative analysis of a second thermonuclease from Staphylococcus aureus. Microbiol. Res. 2013, 168, 174–182. [Google Scholar] [CrossRef] [Scilit]
- Hasegawa, T.; Minami, M.; Okamoto, A.; Tatsuno, I.; Isaka, M.; Ohta, M. Characterization of a virulence-associated and cell-wall-located DNase of Streptococcus pyogenes. Microbiology 2010, 156, 184–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aziz, R.K.; Ismail, S.A.; Park, H.W.; Kotb, M. Post-proteomic identification of a novel phage-encoded streptodornase, Sda1, in invasive M1T1 Streptococcus pyogenes. Mol. Microbiol. 2004, 54, 184–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoppenbrouwers, T.; Autar, A.S.; Sultan, A.R.; Abraham, T.E.; van Cappellen, W.A.; Houtsmuller, A.B.; van Wamel, W.J.; van Beusekom, H.M.; van Neck, J.W.; de Maat, M.P. In vitro induction of NETosis: Comprehensive live imaging comparison and systematic review. PLoS ONE 2017, 12, e0176472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kenny, E.F.; Herzig, A.; Krüger, R.; Muth, S.; Mondal, A.; Thompson, P.R.; Brinkmann, V.; Von Bernuth, H.; Zychlinsky, A. Diverse stimuli engage different neutrophil extracellular trap pathways. Elife 2017, 6, e24437. [Google Scholar] [CrossRef] [Scilit]
- Harvie, E.A.; Green, J.M.; Neely, M.N.; Huttenlocher, A. Innate immune response to Streptococcus iniae infection in zebrafish larvae. Infect. Immun. 2013, 81, 110–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Neely, M.N.; Pfeifer, J.D.; Caparon, M. Streptococcus-zebrafish model of bacterial pathogenesis. Infect. Immun. 2002, 70, 3904–3914. [Google Scholar] [CrossRef] [Scilit]
- Astin, J.; Keerthisinghe, P.; Du, L.; Sanderson, L.; Crosier, K.; Crosier, P.; Hall, C. Innate immune cells and bacterial infection in zebrafish. Methods Cell Biol. 2017, 138, 31–60. [Google Scholar]
- Miller, J.D.; Neely, M.N. Zebrafish as a model host for streptococcal pathogenesis. Acta Trop. 2004, 91, 53–68. [Google Scholar] [CrossRef]
- Shin, J.T.; Priest, J.R.; Ovcharenko, I.; Ronco, A.; Moore, R.K.; Burns, C.G.; MacRae, C.A. Human-zebrafish non-coding conserved elements act in vivo to regulate transcription. Nucleic Acids Res. 2005, 33, 5437–5445. [Google Scholar] [CrossRef] [Scilit]
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [Scilit]
- Vincent, W.J.; Harvie, E.A.; Sauer, J.-D.; Huttenlocher, A. Neutrophil derived LTB4 induces macrophage aggregation in response to encapsulated Streptococcus iniae infection. PLoS ONE 2017, 12, e0179574. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roeselers, G.; Mittge, E.K.; Stephens, W.Z.; Parichy, D.M.; Cavanaugh, C.M.; Guillemin, K.; Rawls, J.F. Evidence for a core gut microbiota in the zebrafish. ISME J. 2011, 5, 1595. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loh, J.M.; Proft, T. Stabilized plasmid-based system for bioluminescent labeling of multiple streptococcal species. Biotechnol. Lett. 2016, 38, 139–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cormack, B.P.; Valdivia, R.H.; Falkow, S.J.G. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 1996, 173, 33–38. [Google Scholar] [CrossRef] [Scilit]
- Allen, J.P.; Neely, M.N. The Streptococcus iniae transcriptional regulator CpsY is required for protection from neutrophil-mediated killing and proper growth in vitro. Infect. Immun. 2011, 79, 4638–4648. [Google Scholar] [CrossRef] [Scilit]
- Zlotkin, A.; Chilmonczyk, S.; Eyngor, M.; Hurvitz, A.; Ghittino, C.; Eldar, A. Trojan horse effect: Phagocyte-mediated Streptococcus iniae infection of fish. Infect. Immun. 2003, 71, 2318–2325. [Google Scholar] [CrossRef] [Scilit]
- Chalmers, C.; Khemlani, A.; Sohn, C.R.; Loh, J.M.; Proft, T. Streptococcus pyogenes nuclease A (SpnA) mediated virulence does not exclusively depend on nuclease activity. J. Microbiol. Immunol. Infect. 2020, 53, 42–48. [Google Scholar] [CrossRef] [Scilit]
- Thammavongsa, V.; Kern, J.W.; Missiakas, D.M.; Schneewind, O. Staphylococcus aureus synthesizes adenosine to escape host immune responses. J. Exp. Med. 2009, 206, 2417–2427. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.S.; Choi, S.H.; Lee, E.H.; Nam, Y.K.; Kim, S.K.; Kim, K.H. α-enolase, a plasmin (ogen) binding and cell wall associating protein from a fish pathogenic Streptococcus iniae strain. Aquaculture 2007, 265, 55–60. [Google Scholar] [CrossRef] [Scilit]








| Primer Name | Sequence (5′–3′) |
|---|---|
| (a) Primers used to generate and confirm ∆spnAi and ∆s5nAi | |
| SpnAi_FR1.fw | GCCGGATCCGCAGGCCAATTATCTCTTAG |
| SpnAi_FR1.rv | CTAAGCTTATTGTAACAGAAACATCAGTC |
| SpnAi_FR2.fw | CATGCCATGGCACGCCGGAGAAACTTCTG |
| SpnAi_FR2.rv | CCCCCCGGGAACGGACCACGATGCCAC |
| S5nAi_FR1.fw | GCCGCTAGCGAAAACCATCAAGGCTTCAACG |
| S5nAi_FR1.rv | GGCGAGCTCCCGTGGAAATCGTTGACACC |
| S5nAi_FR2.fw | CATGCCATGGGCCAAAACAAGCACAATGG |
| S5nAi_FR2.rv | GCTGAATTCGCTTAATGAAGAGCATGCG |
| aad9.fw | CCTTATTGGTACTTACATGTTTG |
| SpnAi_DP.rv | GACACTGAACAGGCCTTGGCTG |
| S5nAi_DP.rv | GTCGATTAAGGCTGATTTAGCC |
| (b) Primers used to generate ∆spnAi:spnAi and ∆s5nAi:s5nAi | |
| SpnAi_FL_ORF.fw | CAGGATCCTAAAGGAGTTTTTATGTTAAAC |
| SpnAi_FL_ORF.rv | CGGAATTCTTAGTTTTTTTGACCTTTACG |
| S5nAi_FL_ORF.fw | CGGGATCCATTAGGAGTTTATATGAAAAAGC |
| S5nAi_FL_ORF.rv | CGGAATTCTTAGTTTTCTTCTTTTTTCTTGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Soh, K.Y.; Loh, J.M.S.; Hall, C.; Proft, T. Functional Analysis of Two Novel Streptococcus iniae Virulence Factors Using a Zebrafish Infection Model. Microorganisms 2020, 8, 1361. https://doi.org/10.3390/microorganisms8091361
Soh KY, Loh JMS, Hall C, Proft T. Functional Analysis of Two Novel Streptococcus iniae Virulence Factors Using a Zebrafish Infection Model. Microorganisms. 2020; 8(9):1361. https://doi.org/10.3390/microorganisms8091361
Chicago/Turabian StyleSoh, Kar Yan, Jacelyn Mei San Loh, Christopher Hall, and Thomas Proft. 2020. "Functional Analysis of Two Novel Streptococcus iniae Virulence Factors Using a Zebrafish Infection Model" Microorganisms 8, no. 9: 1361. https://doi.org/10.3390/microorganisms8091361
APA StyleSoh, K. Y., Loh, J. M. S., Hall, C., & Proft, T. (2020). Functional Analysis of Two Novel Streptococcus iniae Virulence Factors Using a Zebrafish Infection Model. Microorganisms, 8(9), 1361. https://doi.org/10.3390/microorganisms8091361

