The S2 Glycoprotein Subunit Determines Intestinal Tropism in Infectious Bronchitis Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus Strains and Cells
2.2. IBV CSL Strain Pathogenicity Test
2.3. Plasmid Construction and Viral Rescue
2.4. Recombinant D90 Strain Pathogenicity Test
2.5. RNA Extraction and Reverse Transcription
2.6. Viral Load Determination
2.7. qRT-PCR Analysis of Gene Expression
2.8. Statistical Analysis
2.9. Ethics Statement
3. Results
3.1. CSL Strain Exhibits Unique Duodenal and Renal Tropism
3.2. CSL Infection Induces Duodenal Epithelial Inflammation


3.3. S2 Subunit Is Necessary and Sufficient for Duodenal Tropism
3.4. CSL S2 Subunit Induces Duodenal Epithelial Inflammation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Isham, I.M.; Abd-Elsalam, R.M.; Mahmoud, M.E.; Najimudeen, S.M.; Ranaweera, H.A.; Ali, A.; Hassan, M.S.H.; Cork, S.C.; Gupta, A.; Abdul-Careem, M.F. Comparison of Infectious Bronchitis Virus (IBV) Pathogenesis and Host Responses in Young Male and Female Chickens. Viruses 2023, 15, 2285. [Google Scholar] [CrossRef] [PubMed]
- Hoerr, F.J. The Pathology of Infectious Bronchitis. Avian Dis. 2021, 65, 600–611. [Google Scholar] [CrossRef] [PubMed]
- Jackwood, M.W.; Hall, D.; Handel, A. Molecular Evolution and Emergence of Avian Gammacoronaviruses. Infect. Genet. Evol. 2012, 12, 1305–1311. [Google Scholar] [CrossRef] [PubMed]
- Valastro, V.; Holmes, E.C.; Britton, P.; Fusaro, A.; Jackwood, M.W.; Cattoli, G.; Monne, I. S1 Gene-Based Phylogeny of Infectious Bronchitis Virus: An Attempt to Harmonize Virus Classification. Infect. Genet. Evol. 2016, 39, 349–364. [Google Scholar] [CrossRef]
- Chen, Y.; Jiang, L.; Zhao, W.; Liu, L.; Zhao, Y.; Shao, Y.; Li, H.; Han, Z.; Liu, S. Identification and Molecular Characterization of a Novel Serotype Infectious Bronchitis Virus (GI-28) in China. Vet. Microbiol. 2017, 198, 108–115. [Google Scholar] [CrossRef]
- Jiang, L.; Zhao, W.; Han, Z.; Chen, Y.; Zhao, Y.; Sun, J.; Li, H.; Shao, Y.; Liu, L.; Liu, S. Genome Characterization, Antigenicity and Pathogenicity of a Novel Infectious Bronchitis Virus Type Isolated from South China. Infect. Genet. Evol. 2017, 54, 437–446. [Google Scholar] [CrossRef]
- Marandino, A.; Mendoza-González, L.; Panzera, Y.; Tomás, G.; Williman, J.; Techera, C.; Gayosso-Vázquez, A.; Ramírez-Andoney, V.; Alonso-Morales, R.; Realpe-Quintero, M.; et al. Genome Variability of Infectious Bronchitis Virus in Mexico: High Lineage Diversity and Recurrent Recombination. Viruses 2023, 15, 1581. [Google Scholar] [CrossRef]
- Petzoldt, D.; Vogel, N.; Bielenberg, W.; Haneke, J.; Bischoff, H.; Liman, M.; Rönchen, S.; Behr, K.-P.; Menke, T. IB80-A Novel Infectious Bronchitis Virus Genotype (GVIII). Avian Dis. 2022, 66, 1–8. [Google Scholar] [CrossRef]
- Lu, Y.; Zeng, Y.; Luo, H.; Qiao, B.; Meng, Q.; Dai, Z.; Chen, N.; Zhao, L.; Meng, X.; Zhang, H.; et al. Molecular Characteristic, Evolution, and Pathogenicity Analysis of Avian Infectious Bronchitis Virus Isolates Associated with QX Type in China. Poult. Sci. 2024, 103, 104256. [Google Scholar] [CrossRef]
- Li, H.; Liu, G.; Zhou, Q.; Yang, H.; Zhou, C.; Kong, W.; Su, J.; Li, G.; Si, H.; Ou, C. Which Strain of the Avian Coronavirus Vaccine Will Become the Prevalent One in China Next? Front. Vet. Sci. 2023, 10, 1139089. [Google Scholar] [CrossRef]
- Stevenson-Leggett, P.; Armstrong, S.; Keep, S.; Britton, P.; Bickerton, E. Analysis of the Avian Coronavirus Spike Protein Reveals Heterogeneity in the Glycans Present. J. Gen. Virol. 2021, 102, 001642. [Google Scholar] [CrossRef]
- Liang, R.; Liu, K.; Li, Y.; Zhang, X.; Duan, L.; Huang, M.; Sun, L.; Yuan, F.; Zhao, J.; Zhao, Y.; et al. Adaptive Truncation of the S Gene in IBV during Chicken Embryo Passaging Plays a Crucial Role in Its Attenuation. PLoS Pathog. 2024, 20, e1012415. [Google Scholar] [CrossRef]
- Brian, D.A.; Baric, R.S. Coronavirus Genome Structure and Replication. Curr. Top. Microbiol. Immunol. 2005, 287, 1–30. [Google Scholar] [CrossRef] [PubMed]
- Callison, S.A.; Jackwood, M.W.; Hilt, D.A. Infectious Bronchitis Virus S2 Gene Sequence Variability May Affect S1 Subunit Specific Antibody Binding. Virus Genes 1999, 19, 143–151. [Google Scholar] [CrossRef] [PubMed]
- Bickerton, E.; Dowgier, G.; Britton, P. Recombinant Infectious Bronchitis Viruses Expressing Heterologous S1 Subunits: Potential for a New Generation of Vaccines That Replicate in Vero Cells. J. Gen. Virol. 2018, 99, 1681–1685. [Google Scholar] [CrossRef] [PubMed]
- Manswr, B.; Ball, C.; Forrester, A.; Chantrey, J.; Ganapathy, K. Evaluation of Full S1 Gene Sequencing of Classical and Variant Infectious Bronchitis Viruses Extracted from Allantoic Fluid and FTA Cards. Avian Pathol. 2018, 47, 418–426. [Google Scholar] [CrossRef]
- Lin, S.-Y.; Chen, H.-W. Infectious Bronchitis Virus Variants: Molecular Analysis and Pathogenicity Investigation. Int. J. Mol. Sci. 2017, 18, 2030. [Google Scholar] [CrossRef]
- Li, S.-Y.; Shen, Y.-X.; Xiang, X.-L.; Li, Y.-X.; Li, N.-L.; Wang, A.-D.; Cui, M.; Han, X.-F.; Huang, Y.; Xia, J. The Conserved L1089 in the S2 Subunit of Avian Infectious Bronchitis Virus Determines Viral Kidney Tropism by Disrupting Virus-Cell Fusion. Vet. Microbiol. 2023, 277, 109619. [Google Scholar] [CrossRef]
- Bickerton, E.; Maier, H.J.; Stevenson-Leggett, P.; Armesto, M.; Britton, P. The S2 Subunit of Infectious Bronchitis Virus Beaudette Is a Determinant of Cellular Tropism. J. Virol. 2018, 92, e01044-18. [Google Scholar] [CrossRef]
- Huang, B.; Chen, S.; Wang, Z.; Feng, K.; Teng, Y.; Li, R.; Shao, G.; Rao, J.; Zhang, X.; Xie, Q. Development and Immunoprotection Assessment of Novel Vaccines for Avian Infectious Bronchitis Virus. Virol. Sin. 2025, 40, 462–476. [Google Scholar] [CrossRef]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine Epidemic Diarrhea Virus (PEDV): An Update on Etiology, Transmission, Pathogenesis, and Prevention and Control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef]
- Saiada, F.; Gallardo, R.A.; Shivaprasad, H.L.; Corsiglia, C.; Van Santen, V.L. Intestinal Tropism of an Infectious Bronchitis Virus Isolate Not Explained by Spike Protein Binding Specificity. Avian Dis. 2020, 64, 23–35. [Google Scholar] [CrossRef] [PubMed]
- Cuicchi, D.; Lazzarotto, T.; Poggioli, G. Fecal-Oral Transmission of SARS-CoV-2: Review of Laboratory-Confirmed Virus in Gastrointestinal System. Int. J. Color. Dis. 2021, 36, 437–444. [Google Scholar] [CrossRef] [PubMed]
- El-Nahass, E.-S.; Abdelhamid, M.K.; Ali, A.; Shalaby, A.A.; Shaalan, M. Pathological Assessment and Tissue Tropism of Two Different Egyptian Infectious Bronchitis Strains. Virusdisease 2023, 34, 410–420. [Google Scholar] [CrossRef] [PubMed]
- Quinteros, J.A.; Noormohammadi, A.H.; Lee, S.W.; Browning, G.F.; Diaz-Méndez, A. Genomics and Pathogenesis of the Avian Coronavirus Infectious Bronchitis Virus. Aust. Vet. J. 2022, 100, 496–512. [Google Scholar] [CrossRef]
- Chen, Y.; Liu, Q.; Guo, D. Emerging Coronaviruses: Genome Structure, Replication, and Pathogenesis. J. Med. Virol. 2020, 92, 418–423. [Google Scholar] [CrossRef]
- Conrad, K.P. Might Proton Pump or Sodium-Hydrogen Exchanger Inhibitors Be of Value to Ameliorate SARs-CoV-2 Pathophysiology? Physiol. Rep. 2021, 8, e14649. [Google Scholar] [CrossRef]
- Stevenson-Leggett, P.; Keep, S.; Bickerton, E. Treatment with Exogenous Trypsin Expands In Vitro Cellular Tropism of the Avian Coronavirus Infectious Bronchitis Virus. Viruses 2020, 12, 1102. [Google Scholar] [CrossRef]
- Lin, L.; Feng, K.; Shao, G.; Gong, S.; Liu, T.; Chen, F.; Zhang, X.; Xie, Q. Construction and Efficacy of a Recombinant QX-like Infectious Bronchitis Virus Vaccine Strain. Virus Genes 2025, 61, 355–364. [Google Scholar] [CrossRef]
- Shao, G.; Xie, Z.; Liang, M.; Liu, Y.; Song, C.; Feng, K.; Zhang, X.; Lin, W.; Fu, J.; Xie, Q. Efficacy of Recombinant Newcastle Disease Virus Expressing HA Protein of H9N2 Avian Influenza Virus in Respiratory and Intestinal Tract. Poult. Sci. 2022, 101, 102078. [Google Scholar] [CrossRef]
- Wickramasinghe, I.N.A.; van Beurden, S.J.; Weerts, E.A.W.S.; Verheije, M.H. The Avian Coronavirus Spike Protein. Virus Res. 2014, 194, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Leyson, C.L.M.; Jordan, B.J.; Jackwood, M.W. Insights from Molecular Structure Predictions of the Infectious Bronchitis Virus S1 Spike Glycoprotein. Infect. Genet. Evol. 2016, 46, 124–129. [Google Scholar] [CrossRef] [PubMed]
- Fan, S.; Shen, Y.; Li, S.; Xiang, X.; Li, N.; Li, Y.; Xu, J.; Cui, M.; Han, X.; Xia, J.; et al. The S2 Subunit of Infectious Bronchitis Virus Affects Abl2-Mediated Syncytium Formation. Viruses 2023, 15, 1246. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, I.S.; Jarrar, Y.B. Targeting the Intestinal TMPRSS2 Protease to Prevent SARS-CoV-2 Entry into Enterocytes-Prospects and Challenges. Mol. Biol. Rep. 2021, 48, 4667–4675. [Google Scholar] [CrossRef]
- Zang, R.; Gomez Castro, M.F.; McCune, B.T.; Zeng, Q.; Rothlauf, P.W.; Sonnek, N.M.; Liu, Z.; Brulois, K.F.; Wang, X.; Greenberg, H.B.; et al. TMPRSS2 and TMPRSS4 Promote SARS-CoV-2 Infection of Human Small Intestinal Enterocytes. Sci. Immunol. 2020, 5, eabc3582. [Google Scholar] [CrossRef]
- Shi, W.; Fan, W.; Bai, J.; Tang, Y.; Wang, L.; Jiang, Y.; Tang, L.; Liu, M.; Cui, W.; Xu, Y.; et al. TMPRSS2 and MSPL Facilitate Trypsin-Independent Porcine Epidemic Diarrhea Virus Replication in Vero Cells. Viruses 2017, 9, 114. [Google Scholar] [CrossRef]
- Wang, X.; Qiao, X.; Sui, L.; Zhao, H.; Li, F.; Tang, Y.-D.; Shi, W.; Guo, Y.; Jiang, Y.; Wang, L.; et al. Establishment of Stable Vero Cell Lines Expressing TMPRSS2 and MSPL: A Useful Tool for Propagating Porcine Epidemic Diarrhea Virus in the Absence of Exogenous Trypsin. Virulence 2020, 11, 669–685. [Google Scholar] [CrossRef]
- Gu, Y.; Zuo, X.; Zhang, S.; Ouyang, Z.; Jiang, S.; Wang, F.; Wang, G. The Mechanism behind Influenza Virus Cytokine Storm. Viruses 2021, 13, 1362. [Google Scholar] [CrossRef]
- Wojdasiewicz, P.; Poniatowski, Ł.A.; Szukiewicz, D. The Role of Inflammatory and Anti-Inflammatory Cytokines in the Pathogenesis of Osteoarthritis. Mediat. Inflamm. 2014, 2014, 561459. [Google Scholar] [CrossRef]
- Das, U.N. Infection, Inflammation, and Immunity in Sepsis. Biomolecules 2023, 13, 1332. [Google Scholar] [CrossRef]
- Sardinha-Silva, A.; Alves-Ferreira, E.V.C.; Grigg, M.E. Intestinal Immune Responses to Commensal and Pathogenic Protozoa. Front. Immunol. 2022, 13, 963723. [Google Scholar] [CrossRef]
- Yang, S.; Liu, G.; Savelkoul, H.F.J.; Jansen, C.A.; Li, B. Mini-Review: Microbiota Have Potential to Prevent PEDV Infection by Improved Intestinal Barrier. Front. Immunol. 2023, 14, 1230937. [Google Scholar] [CrossRef]


| Gene | Primer Sequence (5′–3′) | |
|---|---|---|
| Forward Primer | Reverse Primer | |
| IL 6 | CCTCCTCGCCAATCTGAAGT | CAAATAGCGAACGGCCCTCA |
| IL 22 | CAGGAATCGCACCTACACCT | TCATGTAGCAGCGGTTGTTC |
| IL 17A | CAGGAATCGGTCTCTCGCTC | AGTGAGTTCAAGCAGCCCAA |
| IFN γ | ATCATACTGAGCCAGATTGTTTCG | TCTTTCACCTTCTTCACGCCAT |
| TNF α | CCGCCCAGTTCAGATGAGTT | GCAACAACCAGCTATGCACC |
| IFN β | TCAACATGCTTAGCAGCCCA | AGTGAGTTCAAGCAGCCCAA |
| Occludin | GATGGACAGCATCAACGACC | CATGCGCTTGATGTGGAAGA |
| Claudin-3 | GAAGGGCTGTGGATGAACTG | GAGACGATGGTGATCTTGGC |
| ZO-1 | GCCTGAATCAAACCCAGCAA | TATGCGGCGGTAAGGATGAT |
| GAPDH | TGAAAGTCGGAGTCAACGGA | GGTCACGCTCCTGGAAGATA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dai, Z.; Zhang, J.; Huang, Y.; Huang, B.; Xiao, Z.; Feng, K.; Shao, G.; Zhang, X.; Xie, Q. The S2 Glycoprotein Subunit Determines Intestinal Tropism in Infectious Bronchitis Virus. Microorganisms 2025, 13, 1918. https://doi.org/10.3390/microorganisms13081918
Dai Z, Zhang J, Huang Y, Huang B, Xiao Z, Feng K, Shao G, Zhang X, Xie Q. The S2 Glycoprotein Subunit Determines Intestinal Tropism in Infectious Bronchitis Virus. Microorganisms. 2025; 13(8):1918. https://doi.org/10.3390/microorganisms13081918
Chicago/Turabian StyleDai, Zhenkai, Jing Zhang, Ying Huang, Benli Huang, Zhengzhong Xiao, Keyu Feng, Guanming Shao, Xinheng Zhang, and Qingmei Xie. 2025. "The S2 Glycoprotein Subunit Determines Intestinal Tropism in Infectious Bronchitis Virus" Microorganisms 13, no. 8: 1918. https://doi.org/10.3390/microorganisms13081918
APA StyleDai, Z., Zhang, J., Huang, Y., Huang, B., Xiao, Z., Feng, K., Shao, G., Zhang, X., & Xie, Q. (2025). The S2 Glycoprotein Subunit Determines Intestinal Tropism in Infectious Bronchitis Virus. Microorganisms, 13(8), 1918. https://doi.org/10.3390/microorganisms13081918

