Next Article in Journal
Gut Bacteria Strategies of Hylurgus ligniperda F. (Coleoptera Scolytidae) in Adapting to Temperature Changes
Previous Article in Journal
The Exploitation of Single-Chambered Microbial Fuel Cells for PET Removal in Water
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees

1
Department of Biology and Physiology, University of Veterinary Medicine and Pharmacy in Košice, 04181 Košice, Slovakia
2
Department of Pharmatology and Toxicology, University of Veterinary Medicine and Pharmacy in Košice, 04181 Košice, Slovakia
*
Authors to whom correspondence should be addressed.
Microorganisms 2025, 13(11), 2501; https://doi.org/10.3390/microorganisms13112501
Submission received: 4 September 2025 / Revised: 20 October 2025 / Accepted: 29 October 2025 / Published: 31 October 2025
(This article belongs to the Section Microbial Biotechnology)

Abstract

Nosemosis is a disease caused by microsporidia, which are strictly intracellular pathogens, currently considered to be most closely related to fungi. These microscopic parasites infect a variety of hosts, significantly affecting honeybees (Apis mellifera). Nosemosis is one of the most serious diseases of bees and is caused primarily by two species: Nosema apis and Nosema ceranae. This infection adversely affects the digestive tract of the bees, causes a reduction in their vitality, and can lead to the death of entire colonies. The diagnosis of nosemosis has undergone extensive development. Traditionally, the identification of microsporidia was performed by examination of bee digestive tract (macerated) by light microscopy. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) are expensive methods that require skilled personnel and were used only when high resolution was necessary. Modern methods, such as polymerase chain reaction (PCR), allow detection of infection at species and genotype levels, thereby increasing the accuracy of diagnosis. Despite advances in molecular techniques, research into nosemosis still faces challenges. This review focuses on a comparison of different diagnostic techniques and their pitfalls that can be integrated into strategies to combat nosemosis and protect the health of honeybee colonies.

1. Introduction

The honeybee (Apis mellifera) is an inseparable part of nature. They live in colonies (consisting of several tens of thousands of individuals) that function as superorganisms. Their most important role is pollination of flowering plants, including fruit trees and crops, and, therefore, they play a major and indispensable role in agriculture as well as in the conservation of ecological biodiversity in general [1].
Extensive research has shown that multiple stressors, such as forage loss, pathogens, parasites, agropesticides, and improper beekeeping practices, are involved in bee population declines [2,3,4].
Globally, microsporidian species Nosema apis and N. ceranae are currently the most prevalent pathogenic microorganisms of A. mellifera [5,6,7,8,9,10,11]. The spores of these two species are very similar at first sight; the differences between them can be distinguished only under transmission electron microscopy—TEM—in dimensions and number of polar filament coils [5] or by surface structure under scanning electron microscopy—SEM [12]. However, recent studies [13,14,15,16] show that N. ceranae infection on honeybee colonies is more aggressive compared to N. apis infection, as it is a relatively new pathogen for the honeybee. N. neumanni, genetically close to N. apis, was recently described as infecting European honeybees in Uganda, but information on this Nosema species is scarce [17].
This review provides a comparative analysis of various diagnostic methods used for detecting nosemosis, emphasizing their respective advantages and limitations. Particular attention is given to the potential challenges and inaccuracies that may arise when applying these techniques. It is also underlined that the integration of diagnostic techniques plays a key role in improving strategies to control nosemosis and to safeguard the vitality and survival of honeybee colonies.

2. Overview of Methodologies Used for the Detection of Nosema spp.

Reliable and harmonized diagnostics are crucial to ensure the quality of follow-up and research results. For this reason, the first European interlaboratory comparison (ILC) was organized in 2017 to assess both the methods and the results obtained by the national reference laboratories (NRLs) for spore counts of Nosema spp. using the microscope published by Duquesne et al. (2021) [18]. The assessment included specificity, sensitivity, trueness, and accuracy. Quantitative results were analyzed in accordance with the international standards NF ISO 13528 (2015) [19] and NF ISO 5725-2 (1994) [20]. The overall results indicate a global specificity of 98% and a global sensitivity of 100%, demonstrating the advanced performance of microscopic methods applied to Nosema NRL spores. The study therefore concluded that the use of microscopy for the detection and quantification of Nosema spp. spores is sufficiently reliable.
However, light microscopy examination is mainly used as a basic preliminary method to check for the presence of Nosema spp. spores [21]. Previous studies have highlighted the efficacy of advanced microscopy methods, such as transmission electron microscopy (TEM) and scanning electron microscopy (SEM), in providing detailed morphological views that surpass traditional light microscopy [5,12].
Nevertheless, to identify Nosema species more accurately, it is essential to use PCR-based molecular methods, as the differences between N. ceranae and N. apis spores are difficult to detect and can often complicate diagnosis, especially in mixed infections. In particular, multiplex PCR, PCR-RFLP, and qPCR or real time are used in research, which allow accurate detection and analysis of genetic material in a variety of biological and clinical applications.
The first application of multiplex PCR for the detection of Nosema spp. in honeybees (Apis mellifera) was published by Martín-Hernández et al. in 2007 [22]. They developed a method to simultaneously identify N. apis and N. ceranae by amplifying specific regions of the 16S rRNA gene. This technique allowed accurate identification of both species in purified spores and in bee homogenates, which contributed to a better understanding of the distribution of N. ceranae in Europe.
In 2010, Hamiduzzaman et al. [23] introduced a semi-quantitative triplex PCR method for the diagnosis and quantification of Nosema infections in bees. This method allowed the detection of low levels of infection, up to 100 spores per bee, and provided a sensitive tool for laboratories without access to real-time PCR technologies. In addition to the detection of N. apis and N. ceranae, this method included amplification of the ribosomal protein gene RpS5 from the bee as an internal control.
These studies laid the foundation for the use of multiplex PCR in the diagnosis of Nosema infections in bees, allowing more efficient and accurate detection of these pathogens.
The Table 1, Table 2 and Table 3 below contain various primers and their sequences used in molecular studies to identify and characterize Nosema species using multiplex (including duplex) PCR, single species-specific PCR, and RFLP PCR methods.
Table 1, Table 2 and Table 3 show the wide range of primers used to detect different Nosema species and to analyze their genetic material. The primers are designed to amplify specific DNA sequences that allow identification of pathogens at the level of molecular biology. Each primer is accompanied by a reference to the study that used or developed the primer.
Early authors of studies on real-time PCR for the detection of Nosema spp. in honeybees (Apis mellifera) include Bourgeois et al. (2010) [30] and Forsgren and Fries (2010) [31]. They developed a method for the genetic detection and quantification of N. apis and N. ceranae using real-time PCR. Both studies have contributed to significant advances in the molecular diagnosis of these parasites.
Subsequently, in 2019, Li et al. [32] presented an improved method combining rapid and simple DNA extraction with quantitative real-time PCR for high-throughput molecular screening of Nosema spp. in Antheraea pernyi. This method allows rapid and automated DNA preparation and is cost-effective.
In 2021, Truong et al. [33] developed ultra-rapid quantitative PCR (UR-qPCR) for the rapid detection of N. ceranae in honeybees, allowing quantification of infection in approximately 20 min.
Ptaszyńska et al. (2014) [12] described the development and validation of an LAMP assay for the detection and differentiation of two origins of nosemosis in honeybees, N. apis and N. ceranae. The method was based on the use of six special primers recognizing sequences in 16S rDNA, with the reaction taking place at a constant temperature of 60 °C and the results could be obtained after only 30 min. LAMP requires following a set of four to six primers: forward inner primer (FIP), backward inner primer (BIP), forward outer primer (F3), backward outer primer (B3), and additionally forward loop primer (LF) and backward loop primer (LB), which significantly reduces the time of the amplification. LAMP detected N. apis and N. ceranae target DNA down to the total DNA concentration of 100 fg, whereas the standard PCR detected these DNA samples to the total DNA concentration of 100 pg. Therefore, LAMP appeared to be 103-fold more sensitive than standard PCR in N. apis and N. ceranae detection. All honeybee DNA samples identified by loop-mediated isothermal amplification reaction as containing N. apis and N. ceranae DNA or these microsporidia’s DNA were positively supported by standard PCR (321 bp and 218–219 bp for N. apis and N. ceranae, Martín-Hernández 2007) [22]. It should be emphasized that the LAMP described by Ptaszyńska et al. (2014) [12] allows not only identifying but also distinguishing between N. apis and N. ceranae infections in honeybees.
These advances in real-time PCR techniques have contributed significantly to the accurate and rapid detection and quantification of Nosema spp. in bees and other hosts.
Table 4 provides an overview of the primers used with a specific sequence (5′ → 3′), with different fragment sizes targeting different target genes, using real-time PCR to detect different Nosema species, namely N. apis, N. ceranae, and N. bombi.
Table 5 shows the different PCR conditions used in studies aimed at detecting Nosema species. The main difference between studies is the annealing temperature, which varies by author. For instance, while Klee et al. (2007) [29] used a temperature of 48 °C and Kunat-Budzynska, Łabuc, and Ptaszynska (2025) [37] 46 °C, Webster et al. (2004) [27] and Sgroi, D’Auria et al. (2025) [38] set the temperature at 62 °C, while other studies (e.g., Martín-Hernández et al. (2007) [22] and Stevanovic et al. (2011) [28]) chose a temperature of 61.8 °C. These differences in temperature may be due to the use of different types of polymerases or PCR mixes, as well as different primers or sample types used for amplification. Another parameter that varies is the annealing time—most authors, such as Fries et al. (2013) [24] and Ostroverkhova et al. (2020) [39], use 30 s, but studies such as Klee et al. (2007) [29] and Webster et al. (2004) [27] set a longer time of 1 min, which may indicate the need for stronger primer binding under specific conditions. The number of cycles ranges from 30 to 45 cycles, which affects the overall DNA amplification—more cycles are used in studies that target smaller amounts of DNA or more challenging samples. The volume of the PCR mix varies from 10 μL to 50 μL, which may be related to different experimental requirements for the amount of reaction mix. These variations show that different authors tailor PCR conditions according to the specific objectives of their experiments, be it sample type, primer type, or detection sensitivity requirements.
Table 6 compares the different PCR protocols used in the studies for the detection of Nosema spp. Each protocol differs in the length and temperature of the initial activation step and the number of PCR cycles, as well as the different denaturation, annealing, and extension steps. These differences may affect the sensitivity and specificity of detection.

3. Comparison of Methodologies by Our Department

Our collective is engaged in research where we use different methodologies to detect N. apis and N. ceranae species in honeybee carcass samples. The bee samples are sent by the beekeepers themselves to the Institute of Beekeeping in Liptovský Hrádok, where microscopic analysis is carried out. Subsequently, the samples are examined by molecular methods at the University of Veterinary Medicine and Pharmacy in Košice.

Molecular Diagnostics

We isolated DNA from crushed bee abdomen samples using the commercially available DNA -sorb- AM isolation kit from AmpliSense and following the manufacturer’s instructions. We used a PRECELLYS tissue homogenizer with a program of 6500 rpm for 2 × 45 s to break the hard shell of the spores.
In the next step, we created a PCR mix for each sample, which consisted of PCR water, master mix, and 10 µM mediums for both species of Nosema spp. (Table 7). We added the template to the mix and vortexed thoroughly.
Duplex PCR was performed using a VWR RISTRETTO thermal cycler (VWR International, Radnor, PA, USA). The initial denaturation took place for 4 min. at 95 °C, followed by 28 cycles of denaturation at 95 °C (25 s), annealing at 58 °C (45 s), and polymerization at 72 °C (2 min). The final extension step lasted 7 min. at 72 °C. To prove the presence of DNA in the investigated samples, we used gel electrophoresis, using a 1.5% agarose gel. After evaluating the results with a UV transilluminator, the DNA concentration was measured with a NanoDrop and the PCR products were sent for sequencing. The obtained sequences were compared with the sequences stored in the gene bank using the BLAST program.
For the detection of Nosema spp. from bee samples using real-time PCR, we used a PCR mix containing SYBR Green. The total volume of the reaction mixture was 25 μL (Table 8), containing the components listed in Table 8.
PCR reactions were performed according to (Malčeková et al., 2013) [41] in a thermal cycler (LightCycler 480 II, Roche, Basel, Switzerland). The program consisted of the following steps: incubation, initial denaturation, 40 cycles of denaturation and hybridization, and melting (melting temperatures) (Table 9).
In Table 10, we report the yield of each methodology, i.e., we compare the same sample of 500 bee colonies. Most of the positive samples were detected by microscopy, which also seems to be the least expensive. Duplex PCR shows the least number of positive samples, which may be due to freezing and thawing of samples or human factor failure. Compared to real-time PCR, duplex is more time-consuming, and the funds required to provide these methods are approximately the same.

4. Discussion

Microscopic analysis of nosemosis in honeybees is one of the most commonly used detection methodologies. It is used both by beekeepers themselves and by research centers. It requires minimal funding and takes a short time to implement. However, microscopic detection is limited to observation and counting of spores, with visible spores representing only a fraction of the life cycle of microsporidia, which can survive outside the host gut cells [42]. Because other stages occurring outside the organ of observation may remain invisible, these apparently low levels of infection may thus be difficult to detect. In our experience, microscopy appears to be a reliable method for detecting nosemosis, but it is not sufficient for accurate species and genotype identification.
In molecular detection of parasites using PCR, several critical parameters must be considered to ensure accuracy and specificity. One of the most important is the number of amplification cycles. In our study, we used 28 cycles, which are below the threshold where false positives may increase. Several publications indicate that exceeding 30 cycles can lead to amplification of non-specific products or contaminants, resulting in misinterpretation of results. Therefore, it is essential to optimize the number of cycles based on the quantity and quality of DNA in the sample [24,43].
Another key parameter is the annealing temperature, which affects the specificity of primer binding to the target sequence. Higher annealing temperatures improve specificity but may reduce amplification efficiency if not properly adjusted. In our protocol, we used 58 °C, representing a compromise between specificity and efficiency. Differences in annealing temperatures across studies (e.g., from 46 °C to 62 °C) highlight the need for individual optimization depending on the primers and polymerases used [22,27,29,37,38].
Amplicon length and nucleotide diversity also play a crucial role. Shorter amplicons are suitable for degraded samples but may offer lower taxonomic resolution. Longer sequences provide more genetic information, which is beneficial for species differentiation. In our work, we used amplicons ranging from 218 to 321 bp, which proved effective for detecting N. apis and N. ceranae [12,22].
Also, Baigazanov et al. (2022) [44], in their research results, point out the need for further research on the use of molecular biology methods for the needs of distinguishing the species causing nosemosis infection (PCR).
Truong et al. (2021) [33] also concluded in their study that quantification of N. ceranae by UR-qPCR improved the sensitivity and stability of detection compared to microscopic counting. By molecular quantification, they calculated the total amount of Nosema DNA in the sample according to a standard curve. Thus, PCR detection using specific primers proved to be more useful for quantitative detection of intracellular parasites. PCR detection has also been chosen by McAfee et al. (2024) [45] to extensively investigate common honeybee pathogens in the context of blueberry pollination.
Since the currently widely used PCR and microscopy are expensive techniques that require skilled personnel and may not be available in every laboratory, it is appropriate to look for cheaper and less labor-intensive methodologies. Study [46] describes the production and characterization of four monoclonal antibodies (mAbs) against N. ceranae and N. apis and the development of an indirect fluorescent antibody test (IFAT). The IFAT using mAbs was compared with microscopy and PCR for 180 hive samples. The diagnostic test revealed similar percentages of sensitivity and specificity as IFAT (97.79% and 93.18%) and microscopy (97.79% and 95.45%), with 100% for PCR considered the “gold standard”. mAb (7D2) has been patented for its high specificity for N. ceranae. IFAT using mAb therefore appears to be a good alternative to microscopy and PCR in laboratories where PCR is not available for the detection and identification of both Nosema spp.
In the submitted manuscript, I have decided to use the names Nosema ceranae and Nosema apis, although some current taxonomic databases list these species under the genus Vairimorpha. This decision is based on both professional and practical reasons. The name Nosema has long been established in the field of bee disease research, as well as in apicultural practice, and its use contributes to terminological consistency and clarity of the text for the wider professional community, including veterinary workers, beekeepers, and students. The taxonomic revision, which proposed the transfer of the species Nosema apis and Nosema ceranae to the genus Vairimorpha [43], was based mainly on the analysis of a limited number of molecular markers. This approach has provoked extensive professional debate about its justification, as several authors point to the need for a more comprehensive phylogenetic analysis before adopting such fundamental nomenclatural changes. Bartolomé et al. (2024) [47], for example, warn that such a revision may lead to ambiguities in the interpretation of older data and unnecessary confusion in the literature on bee pathogens. Several recent publications focusing on applied research and diagnosis of nosemosis also prefer to retain the original nomenclature Nosema [37,38], as this designation is still commonly used in laboratory practice, diagnostics, and professional recommendations, and its retention helps to minimize terminological chaos during the transitional period of taxonomic revision.

5. Conclusions

The aim of this work was to provide an overview of the diagnostic capabilities of an important honeybee parasite that is crucial in the face of an alarming worldwide decline in honeybee colony numbers. Honeybees are not only of great economic importance but also provide invaluable ecological benefits, so it is essential to identify and analyze the factors that are leading to their decline so that we can implement effective measures to protect these important pollinators.
One of the important factors causing bee decline is nosemosis, which contributes to the gradual collapse of bee colonies by weakening their defenses. Infections caused by parasites of the genus Nosema can cause widespread problems in colonies, which, in turn, affect the overall health and productivity of the colonies.
Microscopic determination plays an important role in the diagnosis of nosemosis and is suitable for the rapid detection of Nosema in bee colonies, which is crucial for the early detection of the disease and the prevention of its spread. However, modern molecular methods such as polymerase chain reaction (PCR) are desirable for species differentiation. PCR is not only a very sensitive method but also highly specific, meaning that it can recognize different Nosema species even at low concentrations. These methods are increasingly used in the diagnosis of bee diseases and provide valuable information for research and the protection of colonies from these serious pathogens. A relatively new methodology is IFAT using mAb, which can identify specific Nosema species and is also more affordable than PCR.

Author Contributions

I.S. and M.S. developed the research idea; I.S., M.S., J.M. and L.S. carried out the preparation of the material, data collection, and analysis; I.S. and M.S. supervised the work; I.S. funding acquisition. All authors participated in writing and reviewing the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the EU NextGenerationEU through the Recovery and Resilience Plan for Slovakia under the project No. 09I03-03-V05-00017.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Devillers, J.; Pham-Delegue, M.-H. (Eds.) Honey Bees: Estimating the Environmental Impact of Chemicals; CRC Press: London, UK, 2002. [Google Scholar] [CrossRef] [Scilit]
  2. Goulson, D.; Nicholls, E.; Botías, C.; Rotheray, E.L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 2015, 347, 1255957. [Google Scholar] [CrossRef] [Scilit]
  3. Sánchez-Bayo, F.; Goulson, D.; Pennacchio, F.; Nazzi, F.; Goka, K.; Desneux, N. Are bee diseases linked to pesticides?—A brief review. Environ. Int. 2016, 89–90, 7–11. [Google Scholar] [CrossRef] [Scilit]
  4. McMenamin, A.J.; Brutscher, L.M.; Glenny, W.; Flenniken, M.L. Abiotic and biotic factors affecting the replication and pathogenicity of bee viruses. Curr. Opin. Insect Sci. 2016, 16, 14–21. [Google Scholar] [CrossRef] [Scilit]
  5. Fries, I.; Feng, F.; da Silva, A.; Slemenda, S.B.; Pieniazek, N.J. Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur. J. Protistol. 1996, 32, 356–365. [Google Scholar] [CrossRef] [Scilit]
  6. Chen, Y.; Evans, J.D.; Smith, I.B.; Pettis, J.S. Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States. J. Invertebr. Pathol. 2008, 97, 186–188. [Google Scholar] [CrossRef] [Scilit]
  7. Martín-Hernández, R.; Botías, C.; Bailón, E.G.; Martínez-Salvador, A.; Prieto, L.; Meana, A.; Higes, M. Microsporidia infecting Apis mellifera: Coexistence or competition. Is Nosema ceranae replacing Nosema apis? Environ. Microbiol. 2012, 14, 2127–2138. [Google Scholar] [CrossRef] [Scilit]
  8. Martín-Hernández, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20, 1302–1329. [Google Scholar] [CrossRef] [Scilit]
  9. Emsen, B.; Guzman-Novoa, E.; Hamiduzzaman, M.M.; Eccles, L.; Lacey, B.; Ruiz-Pérez, R.A.; Nasr, M. Higher prevalence and levels of Nosema ceranae than Nosema apis infections in Canadian honey bee colonies. Parasitol. Res. 2016, 115, 175–181. [Google Scholar] [CrossRef] [Scilit]
  10. Ansari, M.J.; Al-Ghamdi, A.; Nuru, A.; Khan, K.A.; Alattal, Y. Geographical distribution and molecular detection of Nosema ceranae from indigenous honey bees of Saudi Arabia. Saudi J. Biol. Sci. 2017, 24, 983–991. [Google Scholar] [CrossRef] [Scilit]
  11. Goblirsch, M. Nosema ceranae disease of the honey bee (Apis mellifera). Apidologie 2018, 49, 131–150. [Google Scholar] [CrossRef] [Scilit]
  12. Ptaszyńska, A.A.; Borsuk, G.; Mułenko, W.; Demetraki-Paleolog, J. Differentiation of Nosema apis and Nosema ceranae spores under Scanning Electron Microscopy (SEM). J. Apic. Res. 2014, 53, 537–544. [Google Scholar] [CrossRef] [Scilit]
  13. Higes, M.; Martín-Hernández, R.; Botías, C.; Bailón, E.G.; González-Porto, A.V.; Barrios, L.; Del Nozal, M.J.; Bernal, J.L.; Jiménez, J.J.; Palencia, P.G.; et al. How natural infection by Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 2008, 10, 2659–2669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Natsopoulou, M.E.; McMahon, D.P.; Doublet, V.; Bryden, J.; Paxton, R.J. Interspecific competition in honeybee intracellular gut parasites is asymmetric and favours the spread of an emerging infectious disease. Proc. R. Soc. B 2015, 282, 20141896. [Google Scholar] [CrossRef] [Scilit]
  15. Marín-García, P.J.; Peyre, Y.; Ahuir-Baraja, A.E.; Garijo, M.M.; Llobat, L. The Role of Nosema ceranae (Microsporidia: Nosematidae) in Honey Bee Colony Losses and Current Insights on Treatment. Vet. Sci. 2022, 9, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Moeini, S.; Malekifard, F.; Tavassoli, M. Identification of the Nosema spp., a microsporidian parasite isolated from the honey bees (Apis mellifera) and its association with honey bee colony losses in apiaries of Iran. J. Hell. Vet. Med. Soc. 2022, 73, 3667–3672. [Google Scholar] [CrossRef] [Scilit]
  17. Chemurot, M.; De Smet, L.; Brunain, M.; De Rycke, R.; De Graaf, D.C. Nosema neumanni n. sp. (Microsporidia, Nosematidae), a new microsporidian parasite of honeybees, Apis mellifera in Uganda. Eur. J. Protistol. 2017, 61, 13–19. [Google Scholar] [CrossRef] [Scilit]
  18. Duquesne, V.; Gastaldi, C.; Del Cont, A.; Cougoule, N.; Bober, A.; Brunain, M.; Chioveanu, G.; Demicoli, N.; Paulus, P.D.; Somalo, P.F.; et al. An international inter-laboratory study on Nosema spp. spore detection and quantification through microscopic examination of crushed honey bee abdomens. J. Microbiol. Methods 2021, 184, 106183. [Google Scholar] [CrossRef] [Scilit]
  19. ISO 13528 (2015); Statistical methods for use in proficiency testing by interlaboratory comparison. International Organization for Standardization: Geneva, Switzerland, 2015.
  20. ISO 5725-2 (1994); Accuracy (Trueness and Precision) of Measurement Methods and Results—Part 2: Basic Method for the Determination of Repeatability and Reproducibility of a Standard Measurement Method. International Organization for Standardization: Geneva, Switzerland, 1994.
  21. Utuk, A.E.; Piskin, F.C.; Girisgin, A.O.; Selcuk, O.; Aydin, L. Microscopic and molecular detection of Nosema spp. in honeybees of Turkey. Apidologie 2016, 47, 267–271. [Google Scholar] [CrossRef] [Scilit]
  22. Martín-Hernández, R.; Meana, A.; Prieto, L.; Salvador, A.M.; Garrido-Bailón, E.; Higes, M. Outcome of Colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 2007, 73, 6331–6338. [Google Scholar] [CrossRef] [Scilit]
  23. Hamiduzzaman, M.M.; Guzman-Novoa, E.; Goodwin, P.H. A multiplex PCR assay to diagnose and quantify Nosema infections in honey bees (Apis mellifera). J. Invertebr. Pathol. 2010, 105, 151–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Fries, I.; Chauzat, M.-P.; Chen, Y.-P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; Mcmahon, D.; Martín-Hernández, R.; Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apic. Res. 2013, 52, 1–28. [Google Scholar] [CrossRef] [Scilit]
  25. Tlak Gajger, I.; Bakarić, K.; Toplak, I.; Šimenc, L.; Zajc, U.; Pislak Ocepek, M. Winter Hive Debris Analysis Is Significant for Assessing the Health Status of Honeybee Colonies (Apis mellifera). Insects 2024, 15, 350. [Google Scholar] [CrossRef] [Scilit]
  26. Claing, G.; Dubreuil, P.; Bernier, M.; Ferland, J.; L’Homme, Y.; Rodriguez, E.; Arsenault, J. Prevalence of pathogens in honey bee colonies and association with clinical signs in southwestern Quebec, Canada. Can. J. Vet. Res. 2024, 88, 45–54. [Google Scholar] [PubMed]
  27. Webster, T.C.; Pomper, K.W.; Hunt, G.; Thacker, E.M.; Jones, S.C. Nosema apis infection in worker and queen Apis mellifera. Apidologie 2004, 35, 49–54. [Google Scholar] [CrossRef] [Scilit]
  28. Stevanovic, J.; Stanimirovic, Z.; Genersch, E.; Kovacevic, S.R.; Ljubenkovic, J.; Radakovic, M.; Aleksic, N. Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of colony collapse disorder. Apidologie 2011, 42, 49–58. [Google Scholar] [CrossRef] [Scilit]
  29. Klee, J.; Besana, A.M.; Genersch, E.; Gisder, S.; Nanetti, A.; Tam, D.Q.; Chinh, T.X.; Puerta, F.; Ruz, J.M.; Kryger, P.; et al. Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera. J. Invertebr. Pathol. 2007, 96, 1–10. [Google Scholar] [CrossRef] [Scilit]
  30. Bourgeois, A.L.; Rinderer, T.E.; Beaman, L.D.; Danka, R.G. Genetic detection and quantification of Nosema apis and N. ceranae in the honey bee. J. Invertebr. Pathol. 2010, 103, 53–58. [Google Scholar] [CrossRef] [Scilit]
  31. Forsgren, E.; Fries, I. Comparative virulence of Nosema ceranae and Nosema apis in individual European honey bees. Vet. Parasitol. 2010, 170, 212–217. [Google Scholar] [CrossRef] [Scilit]
  32. Li, P.; Mi, R.; Zhao, R.; Li, X.; Zhang, B.; Yue, D.; Ye, B.; Zhao, Z.; Wang, L.; Zhu, Y.; et al. Quantitative real-time PCR with high-throughput automatable DNA preparation for molecular screening of Nosema spp. in Antheraea pernyi. J. Invertebr. Pathol. 2019, 164, 16–22. [Google Scholar] [CrossRef] [Scilit]
  33. Truong, A.-T.; Sevin, S.; Kim, S.; Yoo, M.-S.; Cho, Y.S.; Yoon, B. Rapidly quantitative detection of Nosema ceranae in honeybees using ultra-rapid real-time quantitative PCR. J. Vet. Sci. 2021, 22, e40. [Google Scholar] [CrossRef] [Scilit]
  34. Babin, A.; Schurr, F.; Rivière, M.-P.; Chauzat, M.-P.; Dubois, E. Specific detection and quantification of three microsporidia infecting bees, Nosema apis, Nosema ceranae, and Nosema bombi, using probe-based real-time PCR. Eur. J. Protistol. 2022, 86, 125935. [Google Scholar] [CrossRef] [Scilit]
  35. Cilia, G.; Cardaio, I.; Dos Santos, P.E.J.; Ellis, J.D.; Nanetti, A. The first detection of Nosema ceranae (Microsporidia) in the small hive beetle, Aethina tumida Murray (Coleoptera: Nitidulidae). Apidologie 2018, 49, 619–624. [Google Scholar] [CrossRef] [Scilit]
  36. Traver, B.E.; Fell, R.D. Prevalence and infection intensity of Nosema in honey bee (Apis mellifera L.) colonies in Virginia. J. Invertebr. Pathol. 2011, 107, 43–49. [Google Scholar] [CrossRef] [Scilit]
  37. Kunat-Budzyńska, M.; Łabuć, E.; Ptaszyńska, A.A. Seasonal detection of pathogens in honeybees kept in natural and laboratory conditions. Parasitol. Int. 2025, 104, 102978. [Google Scholar] [CrossRef] [Scilit]
  38. Sgroi, G.; D’Auria, L.J.; Lucibelli, M.G.; Mancusi, A.; Proroga, Y.T.R.; Esposito, M.; Rea, S.; Signorelli, D.; Gargano, F.; D’Alessio, N.; et al. Bees on the run: Nosema spp. (Microsporidia) in Apis mellifera and related products, Italy. Front. Vet. Sci. 2025, 11, 1530169. [Google Scholar] [CrossRef] [Scilit]
  39. Ostroverkhova, N.V.; Konusova, O.L.; Kucher, A.N.; Kireeva, T.N.; Rosseykina, S.A. Prevalence of the Microsporidian Nosema spp. in Honey Bee Populations (Apis mellifera) in Some Ecological Regions of North Asia. Vet. Sci. 2020, 7, 111. [Google Scholar] [CrossRef] [Scilit]
  40. Hurná, B.; Sučik, M.; Staroň, M.; Tutka, Š.; Maková, Z.; Galajda, R.; Valenčáková, A. Molecular Detection of Nosema spp. in Three Eco Regions of Slovakia. CIMB 2023, 45, 4814–4825. [Google Scholar] [CrossRef] [Scilit]
  41. Malčeková, B.; Valenčáková, A.; Molnár, L.; Kočišová, A. First detection and genotyping of human-associated microsporidia in wild waterfowl of Slovakia. Acta Parasitol. 2013, 58, 13–17. [Google Scholar] [CrossRef] [Scilit]
  42. Gray, F.H.; Cali, A.; Briggs, J.D. Intracellular stages in the life cycle of the microsporidian Nosema apis. J. Invertebr. Pathol. 1969, 14, 391–394. [Google Scholar] [CrossRef] [Scilit]
  43. Tokarev, Y.S.; Huang, W.-F.; Solter, L.F.; Malysh, J.M.; Becnel, J.J.; Vossbrinck, C.R. A formal redefinition of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) and reassignment of species based on molecular phylogenetics. J. Invertebr. Pathol. 2020, 169, 107279. [Google Scholar] [CrossRef] [Scilit]
  44. Baigazanov, A.; Tikhomirova, Y.; Valitova, N.; Nurkenova, M.; Koigeldinova, A.; Abdullina, E.; Zaikovskaya, O.; Ikimbayeva, N.; Zainettinova, D.; Bauzhanova, L. Occurrence of Nosemosis in honey bee, Apis mellifera L. at the apiaries of East Kazakhstan. PeerJ 2022, 10, e14430. [Google Scholar] [CrossRef] [Scilit]
  45. McAfee, A.; French, S.K.; Wizenberg, S.B.; Newburn, L.R.; Tsvetkov, N.; Higo, H.; Common, J.; Pernal, S.F.; Giovenazzo, P.; Hoover, S.E.; et al. Higher prevalence of sacbrood virus in Apis mellifera (Hymenoptera: Apidae) colonies after pollinating highbush blueberries. J. Econ. Entomol. 2024, 117, 1324–1335, Erratum in J. Econ. Entomol. 2024, 117, 2200. https://doi.org/10.1093/jee/toae198. [Google Scholar] [CrossRef] [Scilit]
  46. Izquierdo, F.; Fernández Vadillo, C.; Fenoy, S.; Hurtado-Marcos, C.; Magnet, A.; Higes, M.; Martín-Hernández, R.; Del Aguila, C. Production and characterization of monoclonal antibodies for specific detection of Nosema ceranae and Nosema apis in beehive samples. Int. J. Parasitol. 2025, 55, 163–172. [Google Scholar] [CrossRef] [Scilit]
  47. Bartolomé, C.; Higes, M.; Hernández, R.M.; Chen, Y.P.; Evans, J.D.; Huang, Q. The recent revision of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) was flawed and misleads the bee scientific community. J. Invertebr. Pathol. 2024, 206, 108146. [Google Scholar] [CrossRef] [Scilit]
Table 1. Detection of Nosema by multiplex PCR of partial 16S rRNA gene.
Table 1. Detection of Nosema by multiplex PCR of partial 16S rRNA gene.
SpeciesType of PCRPrimersSequence (5′ → 3′)Fragment (bp)References
N. ceranaeduplex PCR218MITOC-FORCGGCGACGATGTGATATGAAAATATTAA218–219[22]
N. ceranae218MITOC-REVCCCGGTCATTCTCAAACAAAAAACCG
N. apis321APIS-FORGGGGGCATGTCTTTGACGTACTATGTA321
N. apis321APIS-REVGGGGGGCGTTTAAAATGTGAAACAACTATG
N. apismultiplex PCRMnapis-FGCATGTCTTTGACGTACTATG224[24]
N. bombiMnbombi-FTTTATTTTATGTRYACMGCAG171
N. ceranaeMnceranae-FCGTTAAAGTGTAGATAAGATGTT143
UniMuniv-RGACTTAGTAGCCGTCTCTC
N. ceranaemultiplex PCRMnceranae-FCGT TAA AGT GTA GAT AAG ATG TT143[25]
Mnceranae-RGAC TTA GTA GCC GTC TCT C
N. apisMnapis-FGCA TGT CTT TGA CGT ACT ATG224
Mnapis-RGAC TTA GTA GCC GTC TCT C
N. apismultiplex PCR CCATTGCCGGATAAGA GAGT401[26]
CACGCATTGCTGCATCA TTGAC
N. ceranae CGGATAAAAGAGTCC GTTACC250
TGAGCAGGGTTCTAGGGAT
Table 2. Detection of Nosema spp. by N. apis-specific PCR.
Table 2. Detection of Nosema spp. by N. apis-specific PCR.
SpeciesType of PCRPrimersSequence (5′ → 3′)Fragment (bp)TargetReferences
N. apisN. apis-specific PCRNosA-FCCGACGATGTGATATGAGATG20916S rRNA[27]
N. apisNosA-RCACTATTATCATCCTCAG ATCATA
Table 3. Differentiation between Nosema species based on PCR-RFLPs of partial 16S rRNA gene.
Table 3. Differentiation between Nosema species based on PCR-RFLPs of partial 16S rRNA gene.
Type of PCRPrimersSequence (5′ → 3′)Fragment (bp)RFLP PatternsRestriction EnzymesReferences
PCR-RFLPNos-16S-fw
Nos-16S-rv
CGTAGACGCTATTCCCTAAGATT
CTCCCAACTATACAGTACACCTCATA
488N. ceranae 97, 118, 269 bp.
N. apis 91, 131, 266 bp.
Pac I
Nde I
Msp I
[28]
PCR-RFLPSSUres-f1GCCTGACGTAGACGCTATTC~400N. cerane 104, 116, 177 bp.
N. apis 91, 136, 175 bp.
Pac I
Nde I
Msp I
[29]
SSUres-r1GTATTACCGCGGCTGCTGG
Table 4. Detection of Nosema spp. by real-time PCR.
Table 4. Detection of Nosema spp. by real-time PCR.
SpeciesPrimers’ NamesSequence (5′ → 3′)Fragment (bp)TargetReferences
N. apisNaForFwd: CTAGTATATTTGAATATTT
GTTTACAATGG
27816S rRNA[31]
N. ceranaeNcForFwd: TATTGTAGAGAGGTGGGAGATT31616S rRNA[31]
Nosema universalUnivRevUrev: GTC GCT ATG ATC GCT TGC C 16S rRNA[31]
N. apis Fwd: TGCAGATTTTGACGGAGATGA
Rev: TGTACAATACCCATTATAGGACGA
138RPB1[34]
N. ceranae Fwd: TCTTGTTCCTCCACCATCAGT
Rev: TGTGTCAAATCATCTTCTGCTCT
75RPB1[34]
N. bombi Fwd: GGAGAAATCTGTGAAAGTGGGT
Rev: GGCTACTAGTCCCATTCCTTCT
81RPB1[34]
N. ceranae Fwd: GGGATTACAAGTGCTTAGAGTGATT
Rev: TGTCAAGCCCATAAGCAAGTG
65Hsp70[35]
N. ceranaeDQ486027 F
DQ486027 R
Fwd: GGTTGGGAGAAGCCGTTACC
Rev: ACCTGATCCAACGCAAATGCTA
10316S rRNA[36]
N. apisU97150 F
U97150 R
Fwd: GGAACCACCTTTTCTCCTACAAGCAA
Rev: CCAAAAACTCCCAAGGAAAAACAAAAC
9216S rRNA[36]
Table 5. Overview of PCR conditions for the detection of Nosema species in different studies.
Table 5. Overview of PCR conditions for the detection of Nosema species in different studies.
ReferencesType of PCRAnnealing TemperatureDurationNumber of CyclesTotal Mix Volume
[22]duplex PCR61.8 °C30 s3050 μL
[24]multiplex PCR55 °C30 s3510 μL
[39]duplex PCR58 °C30 s3520 μL
[28]RFLP PCR53 °C1 min4525 μL
[29]RFLP PCR48 °C1 min4525 μL
[23]multiplex PCR61.8 °C30 s3015 μL
[28]duplex PCR61.8 °C30 s3025 μL
[27]N. apis specific PCR62 °C1 min4020 μL
[38]duplex PCR62 °C30 s3525 μL
[37]multiplex PCR46 °C1 min3525 μL
[25]multiplex PCR55 °C30 s3510 μL
[26]multiplex PCR56 °C45 s3015 μL
[40]duplex PCR58 °C45 s3525 μL
Table 6. Overview of thermal conditions of real-time PCR protocols for the detection of Nosema spp.
Table 6. Overview of thermal conditions of real-time PCR protocols for the detection of Nosema spp.
StepTemperature (°C)TimeNumber of CyclesTotal Mix Volume
Forsgren and Fries (2010) [31]
20 µL
Initial activation step9815 min120 µL
PCR cycling 40
Denaturation985 s
Annealing and elongation6310 s
Analysis of the melting curve65–9510 s/step-
Babin et al. (2022) [34]
20 µL
Initial activation step953 min120 µL
PCR cycling 45
Denaturation9510 s
Annealing of primers6030 s
Elongation7225 s
Termination of reaction4010 s1
Cilia et al. (2018) [35]
20 µL
Initial activation step9510 min120 µL
PCR cycling 40
Denaturation9515 s
Annealing of primers5660 s
Traver a Fell (2011) [36]
20 µL
Initialization step502 min120 µL
Initial activation step9510 min1
PCR cycling 40
Denaturation9515 s
Annealing/elongation601 min
Table 7. Components of the PCR mix and their amounts.
Table 7. Components of the PCR mix and their amounts.
Components of the PCR MixConcentrationsQuantity
PCR water 11.5 µL
Firepol Master Mix (Solis Biodine)1.5 mM MgCl24 µL
218MITOC-FOR/REV (specific for N. ceranae)10 pmol1 µL
321APIS-FOR/REV (specific for N. apis) of Martín-Hernández et al. (2007) [22]10 pmol1 µL
Template 2.5 µL
Table 8. Composition of the reaction mixture for real-time PCR detection of Nosema spp.
Table 8. Composition of the reaction mixture for real-time PCR detection of Nosema spp.
FastStart Universal SYBR Green Master (Roche):12.5 μL
Specific primers (0.3 μM)
APIS FOR (5′-GGGGCCATGTGTTTGACGTACTATGTA-3′)0.5 μL
APIS REV (5′-GGGGGGCGTTTAAAAATGTGAACAACTATG-3′)0.5 μL
PCR water4.5 μL
Template7 μL
FastStart Universal SYBR Green Master (Roche):12.5 μL
Specific primers (0.3 μM)
MITOC FOR (5′CGGCGACGATGATGATGATGAAAAATATTAA-3′)0.5 μL
MITOC REV (5′-CCCGGTCATTCTCAAAAAAACCG-3’)0.5 μL
PCR water4.5 μL
Template7 μL
Table 9. Program used for real-time PCR.
Table 9. Program used for real-time PCR.
StepTemperature (°C)TimeNumber of Cycles
Incubation50 °C2 min1
Initial denaturation95 °C10 min1
Denaturation95 °C15 s
Hybridization60 °C1 min
Melting95 °C15 s1
Table 10. Comparison of the yield of individual methodologies by our workplace.
Table 10. Comparison of the yield of individual methodologies by our workplace.
Detection MethodTotal Number of SamplesPositiveNegative
Microscopy500115385
Duplex PCR500107393
Real-time PCR500110390
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Szabó, I.; Sučik, M.; Morochovičová, J.; Sabová, L. An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms 2025, 13, 2501. https://doi.org/10.3390/microorganisms13112501

AMA Style

Szabó I, Sučik M, Morochovičová J, Sabová L. An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms. 2025; 13(11):2501. https://doi.org/10.3390/microorganisms13112501

Chicago/Turabian Style

Szabó, Imrich, Monika Sučik, Jana Morochovičová, and Lucia Sabová. 2025. "An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees" Microorganisms 13, no. 11: 2501. https://doi.org/10.3390/microorganisms13112501

APA Style

Szabó, I., Sučik, M., Morochovičová, J., & Sabová, L. (2025). An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms, 13(11), 2501. https://doi.org/10.3390/microorganisms13112501

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop