Next Article in Journal
Correction: Wu et al. Heterologous Expression and Enzymatic Properties of β-Glucuronidase from Clostridium perfringens and Its Application in Bilirubin Transformation. Microorganisms 2025, 13, 1043
Previous Article in Journal
Microbial Communities and Physicochemical Properties of the Nile River Water in the Suez Canal Area
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 10
10.3390/microorganisms13102396
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of the Wheat Crab Model and the Pond Culture Model on the Growth, Metabolism and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis)

by
Min Yang
,
Jun Ling
,
Tong Li
,
Chengchen Yu
,
He Jiang
and
Tingshuang Pan
*
Anhui Key Laboratory of Aquaculture and Stock Enhancement, Fishery Institute of Anhui Academy of Agricultural Sciences, Hefei 230041, China
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(10), 2396; https://doi.org/10.3390/microorganisms13102396
Submission received: 1 September 2025 / Revised: 13 October 2025 / Accepted: 16 October 2025 / Published: 19 October 2025
(This article belongs to the Special Issue Advances in Aquaculture and Microorganisms)
Browse Figures
Versions Notes

Abstract

This study investigated the influence of two distinct aquaculture systems, namely, the wheat-crab model (WCM) and pond culture (PC) model, on the growth, physiological well-being, and gut microbial structure of Chinese mitten crabs (Eriocheir sinensis). A total of 120 adult crabs were randomly selected from the two systems: 60 crabs from the WCM, including 30 females and 30 males, and 60 crabs from the PC model, also including 30 females and 30 males. The gonadosomatic index of female crabs in the WCM was notably higher than that of the other groups, while the hepatopancreatic index was significantly lower. Significant variations were not observed in final weight, fullness, or muscle yield between the WCM and PC groups. Biochemical evaluations indicated no substantial differences in antioxidant capabilities between the two systems; however, female crabs demonstrated increased critical antioxidant enzyme activity, such as for catalase and superoxide dismutase, and significantly elevated cholesterol levels. Additionally, the expression of the genes IL, ProPO, and Keap1 was significantly higher in the WCM group than the PC group, whereas the expression of ALF2, Myd88, and CncC did not significantly differ between the two cultivation methods. Non-targeted metabolomics analysis revealed notable distinctions in metabolite profiles between the two systems. Moreover, the WCM facilitated an increase in beneficial Firmicutes bacteria while reducing potentially harmful microorganisms, suggesting improved immune function in crabs raised under the WCM. In summary, female crabs reared in the WCM matured earlier and exhibited slightly better health conditions compared to those grown in the PC model.

1. Introduction

The Chinese mitten crab (Eriocheir sinensis) is a significant freshwater crustacean species. Due to its high nutritional content and economic value, it is extensively farmed across many provinces in China [1]. With the development of large-scale crab culturing in recent years, this industry has been challenged by various diseases associated with the culture environment. Thus, it is crucial to create more sustainable E. sinensis breeding models.
Some pond culture (PC) models in Anhui Province have been transformed from farmland. Although the PC model can enhance economic benefits in the short term, with the strengthening of China’s food security policies [2], such aquaculture methods that occupy basic farmland are facing the risk of being rectified or even banned. Meanwhile, the drawbacks of the PC model have become increasingly prominent. The PC model relies on artificial feeding of compound feed, with a large accumulation of leftover feed and excrement, which can easily cause eutrophication of water bodies [3], leading to algal blooms and insufficient dissolved oxygen, thereby increasing the risk of diseases in Chinese mitten crabs and reducing the farming benefits. Against this backdrop, the WCM has emerged as an innovative approach, using the wheat intercropping period to create a good growing environment for crabs, and exhibits several advantages over the pond model, including reduced fertilizer use, reduced pesticide use, efficient land and water use, resource recycling, and improved economic efficiency. Previous studies have shown that the aquaculture environment of crabs affects their growth, nutrition [4], health status [5] and intestinal microbial community composition [6], among other factors. Many studies have shown that rice-crab culture can affect the nutrient composition of E. sinensis, improve the ecological environment and enhance economic benefits [7]. Although the WCM farming method was successfully implemented in China in 2022 and 2023, how this system affects the growth, metabolism and intestinal microbiota of E. sinensis remains a blank.
Similar to other crustaceans, Chinese mitten crabs lack a typical adaptive immune system [8], and their defense system primarily consists of an innate immune response that include various endogenous immune system expression or inducible factors [9] and the activity of various immune-related enzymes (e.g., SOD, GSH-Px, MDA, and CAT) [10,11]. Consequently, when these crabs are subjected to biological or abiotic stressors, the cellular equilibrium can be disturbed, leading to the production and buildup of reactive oxygen species (ROS) [12,13]. An imbalance between antioxidant defenses and ROS levels can lead to the increased production of oxygen ions, free radicals, and peroxides, which subsequently induces oxidative stress [14]. Therefore, fluctuations in various antioxidants in serum and hepatopancreas reflect the health of crabs [15]. Previous studies have found that TLRs may be essential in the antibacterial and anti-fungal immune response of crabs, improving the innate immune response [16]. In amphibians, overexpressed MyD88 triggered the NF-κB promoter, indicating that MyD88 may play an important role in inflammatory responses [17]. Therefore, it is possible to gain a deeper understanding of the adaptation mechanisms and immune defense strategies of E. sinensis within the WCM by analyzing the expression patterns of immune-related factors.
The gut microbiota plays a vital role in the digestion, nutrient absorption, and immune function of crustaceans [18,19,20]. Alterations in the gut microbial community can significantly affect host health and disease resistance. Metabolomics analysis, particularly non-targeted metabolomics, enables a holistic profiling of small-molecule metabolites, revealing metabolic changes induced by environmental factors or dietary interventions [21]. By integrating gut microbiota and metabolomics analysis, this study provides a deeper understanding of the impact of the WCM on the physiological and immune status of crabs, providing valuable insights for sustainable aquaculture practices.
To address this knowledge gap, we conducted a study in Dangtu County, Anhui Province, analyzing the growth performance, biochemical parameters, metabolome, and gut microbiota of crabs under the WCM model. This research aims to provide a robust scientific foundation for assessing the viability and promoting the adoption of the environmentally friendly WCM in E. sinensis aquaculture.

2. Materials and Methods

All animal procedures in this study were conducted in accordance with relevant guidelines and regulations, and were specifically approved by the Animal Ethics Committee of the Fishery Institute, Anhui Academy of Agricultural Sciences (Approval No. AAAS2023-9 on 15 March 2023).

2.1. Sites and System Description

The experiment was conducted in a wheat-crab breeding demonstration site (Guangfeng Aquaculture Family Farm) in Dangtu City, Anhui Province, China (longitude: 118.58°, latitude: 31.46°). Chinese crab larvae were obtained from a Guangfeng aquaculture family farm. The WCM had an area of 32 × 667 m2, and trenches (1.2 m × 0.8 m, width × depth) were dug around each plot to breed the Chinese mitten crabs (Figure 1). The wheat growing season was from November 2022 to May 2023, and field operations included sowing, fertilizing, weeding, and harvesting. After the wheat was harvested, the straw was removed, the land was tilled, and water was injected into the soil to plant grass. After 15 days, the density of E. sinensis was 1200/667 m2 (60 ± 5 g). The pond culture (PC) model had an area of 30 × 667 m2, grass was planted in December, and crabs were added to the pond in March at a density of 1500/667 m2 (10 ± 2 g). A 35 cm-high fence was constructed around the two experimental plots to prevent the crabs from escaping. Water inlets and outlets were also installed in each plot. Each field was equipped with two water wheel aerators, each with a power of 2.20 kW/h. During the experiment, 4% of the crab body weight was fed with commercial pellet feed containing 40% crude protein and 4% crude fat (provided by Chengdu Tongwei Co., Ltd. in Chengdu, China) twice a day, at 6:30 a.m. and 3:00 p.m., and minor adjustments were made according to the remaining feed volume. The water management, feeding schedule, and daily maintenance for the two breeding plots were identical.

2.2. Sample Collection

On 15 October, the crabs were ripe. Sixty crabs (30 females [C♀] and 30 males [C♂]) were randomly selected from the WCM and sixty crabs (30 females [C♀] and 30 males [C♂]) were randomly selected from the PC model for sampling. Five minutes after cryoanesthesia, hemolymph was collected from the bottom of the third leg using a sterile syringe. Hemolymph was injected into sterile and enzyme-free centrifuge tubes, refrigerated overnight at 4 °C, and then centrifuged at 12,000× g for 8 min at 4 °C. The supernatant was stored at −80 °C for subsequent biochemical analysis. The hepatopancreas, muscles and gonads were dissected and weighed to calculate the performance indicators. Hepatopanpancreas and muscle samples were stored at −80 °C for further metabolomics and genetic quantitative examination. In addition, intestinal chyme specimens were collected on a sterile operating table and stored at −80 °C for microbial community analysis.
After a 24 h fasting period, the fullness (FNS), hepatopancreas index (HSI), gonadosomatic index (GSI), and muscle yield (MYI) of the crabs were determined using the following equations:
FNS (g/cm) = (whole body weight) (g)/(carapace length)3
HSI (%) = hepatopancreas weight × 100/whole-body weight
GSI (%) = gonad weight × 100/whole-body weight
MYI (%) = muscle weight × 100/whole-body weight

2.3. Chemical Analysis

The hepatopancreas samples were weighed and homogenized in 10 volumes (v/w) of ice-cold 0.85% saline solution. The resulting homogenate was centrifuged at 12,000× g for 10 min at 4 °C, after which the supernatant was collected and stored at −80 °C for subsequent analysis of antioxidant parameters. The concentrations of malondialdehyde (MDA), total superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), alanine aminotransferase (ALT), alkaline phosphatase (ALP), triglycerides (TG), total protein (TP), total cholesterol (CHO), and amylase (AMY) were measured in the hepatopancreas, muscle, and hemolymph. All measurements were conducted using diagnostic reagent kits (provided by Jiancheng Co., Ltd., Nanjing, China) following the manufacturer’s protocols. There were a total of 6 samples, and each sample was tested three times.

2.4. Gene Expression Analysis

Total RNA was extracted from approximately 50 mg of hepatopancreas tissue using TRIzol reagent (Invitrogen, Waltham, MA, USA), followed by purification with the Ultrapure RNA Kit (DNase I) (CW0597S, CWBIO, Taizhou, China) according to the manufacturer’s instructions. RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA), and integrity was verified by 1% agarose gel electrophoresis.
First-strand cDNA was synthesized from 1 µg of total RNA using the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (AE311, TransGen Biotech, Beijing, China) in a 20 µL reaction system containing 10 µL of 2 × TS Reaction Mix, 1 µL of RT/RI Enzyme Mix, 1 µL of gDNA Remover, 1 µL of Random Primer (10 µM), and RNase-free water. The reaction was incubated at 42 °C for 15 min, followed by 85 °C for 5 s.
Quantitative real-time PCR (qPCR) was performed on a LightCycler 96 system (Roche, Basel, Switzerland) using TransStart Green qPCR SuperMix (AQ131-01, TransGen Biotech, Beijing, China). Each 20 µL reaction contained 10 µL of 2 × SuperMix, 0.5 µL each of forward and reverse primers (10 µM), 2 µL of diluted cDNA, and 7 µL of RNase-free water. The thermal cycling conditions were as follows: initial denaturation at 94 °C for 30 s; 45 cycles of 94 °C for 5 s and 61 °C for 35 s; followed by a melting curve analysis (95 °C for 10 s, 65 °C for 60 s, and 97 °C for 1 s). All samples were run in triplicate, including no-template controls.
Primers for target genes (IL, 30, ProPO, Keap1, ALF2, Myd88, and CncC) and the reference gene (β-actin) were designed using Oligo 6.0 software and are listed in Table 1. Gene expression levels were calculated using the 2−ΔΔCt method, with β-actin as the internal control. There were a total of 6 samples, and each sample was tested three times.

2.5. Intestinal Microflora Identification

Total genomic DNA was extracted from intestinal content samples using the TIANamp Stool DNA Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s protocols. The concentration and quality of the extracted DNA were checked using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and 1% agarose gel electrophoresis.
The hypervariable V3-V4 region of the bacterial 16S rRNA gene was amplified with the forward primer 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and the reverse primer 806R (5′-GGACTACHVGGGTWTCTAAT-3′). PCR reactions were performed in triplicate for each sample using TransStart FastPfu DNA Polymerase (TransGen Biotech, Beijing, China). The PCR products were purified with AMPure XP Beads (Beckman Coulter, Brea, CA, USA) and quantified using a Qubit 3.0 fluorometer (Thermo Scientific, Waltham, MA, USA).
Sequencing libraries were constructed using the Illumina DNA Prep Kit (Illumina, San Diego, CA, USA). The quality of the libraries was assessed with an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).
The raw sequencing data were processed using QIIME 2 (version 2023.5). Briefly, primer sequences were trimmed, and paired-end reads were merged, quality-filtered, and denoised into amplicon sequence variants (ASVs) using the DADA2 plugin. Chimeric sequences were identified and removed. Taxonomy was assigned to the ASVs using the SILVA database (version 138). The raw sequencing data have been deposited into the NCBI Sequence Read Archive (SRA) under the accession number PRJNA1132773.

2.6. Non-Targeted Metabolomics Analysis

To investigate the metabolic differences between the WCM and PC systems in E. sinensis, non-targeted metabolomics analysis was performed on muscle tissue samples (50 mg). The analysis was conducted using a UHPLC system (1290 Infinity LC, Agilent Technologies, Santa Clara, CA, USA) interfaced with a quadrupole time-of-flight mass spectrometer (AB Sciex TripleTOF 6600, Brea, CA, USA). To achieve HILIC separation, samples were injected onto a 2.1 mm × 100 mm ACQUIY UPLC BEH Amide column with a particle size of 1.7 µm (Waters, Dublin, Ireland). The mobile phase composition, applied in both ESI positive and negative ionization modes, consisted of solvent A (25 mM ammonium acetate and 25 mM ammonium hydroxide in water) and solvent B (acetonitrile). The gradient program initiated at 95% B for 0.5 min, followed by a linear decrease to 65% B over 6.5 min, further reduction to 40% B within 1 min, and a hold at 40% B for an additional minute. This was followed by a rapid increase back to 95% B in 0.1 min, with a 3 min re-equilibration phase included to ensure column stability.
The metabolites were identified and annotated by referencing the Human Metabolome Database (HMDB) and Metlin database. Differential metabolites among groups were determined using a significance cutoff of VIP > 1 and p < 0.05. Subsequently, metabolic enrichment analysis and key pathway screening were carried out based on data from the Kyoto Encyclopedia of Genes and Genomes (KEGG).

2.7. Statistical Analyses

All data were analyzed using one-way analysis of variance (ANOVA) with SPSS software, version 20.0 (IBM Corp., Armonk, NY, USA). Unless otherwise specified, all data are expressed as mean values ± standard deviations.

3. Results

3.1. Performance Indexes

The growth performance of E. sinensis under the two culture systems is presented in Table 2. The final weight of the C♀ and W♀ groups was notably lower than that of the C♂ and W♂ groups (p < 0.05). The growth rate (GSI) of the W♀ group was significantly higher than that of the other groups (p < 0.05), whereas the hepatopancreas index (HIS) of the W♀ group was significantly reduced relative to the other groups (p < 0.05). The muscle yield (MYI) of the C♂ and W♂ groups showed a significant increase compared to the C♀ and W♀ groups (p < 0.05). No significant differences were observed among the groups in terms of the fullness (FNS) index, which is a comprehensive indicator for assessing the plumpness of muscle, hepatopancreas, and gonad in Chinese mitten crabs.

3.2. Biochemical Parameters

In the hepatopancreas (Figure 2), SOD activity was significantly higher in the C♀ and W♀ groups compared to the C♂ group (p < 0.05). The activity of CAT in the W♀ group was markedly elevated compared to the other groups (p < 0.05). GSH-Px activity was significantly greater in the W♂ group than in the C♂ group (p < 0.05) but did not significantly differ between the W♀ and C♀ groups. Additionally, MDA activity levels did not significantly differ in any of the pairwise comparisons.
In the serum (Figure 3), the C♀ and W♀ groups exhibited higher levels of TP and CHO compared to the C♂ and W♂ groups (p < 0.05). However, the groups did not show significant differences in the ALT, TG, and ALP activity levels. Additionally, the W♂ group showed a significantly higher AMY content than the W♀ group (p < 0.05), while significant variations were not detected among the remaining groups.

3.3. Gene Expression Analyses

Figure 4 shows the expression of ALF2, Myd88, and CncC genes in the hepatopancreas, which were markedly elevated in male crabs compared to female crabs (p < 0.05). The expression levels of the IL and Keap1 genes were significantly higher in the W♂ group than in the other groups (p < 0.05). Additionally, ProPO gene expression was significantly upregulated under the WCM compared to the PC model (p < 0.05).

3.4. Intestinal Microbiota

β-diversity analysis indicated significant differences among the four groups (W♂, W♀, C♂, and C♀), according to an Adonis (PERMANOVA) test (genus: R2 = 0.2364, p = 0.001; OTU: R2 = 0.2103, p = 0.001; Figure S1A,B). Additionally, the alpha diversity indexes differed according to the Kruskal–Wallace test (Chao 1: p = 0.0016; Sobs: p = 0.0016; Simpson: p = 0.0087; Shannon: p = 0.0001; Figure S1C–F).
Venn diagrams were constructed based on the counts of genera present in all groups. In terms of abundance, the top four phyla were Firmicutes, Proteobacteria, Bacteroidetes, and Fusobacteriota (Figure 5A); and the top nine genera were Candidatus_Hepatoplasma, Candidatus_Bacilloplasma, Bacteroides, Vibrio, Acinetobacter, Paracoccus, Aeromonas, Roseimarinus, and Fusobacterium (Figure 5B). The intestinal flora included 115 (C♂), 92 (W♂), 143 (C♀), and 118 (C♂) genera. Among them, 40 genera occurred in all groups, accounting for 34.19% (Figure 5C). The linear discriminant analysis (LDA) effect size (LEfSe; LDA score > 2.5, p < 0.05) showed that 36 microbial clades displayed statistically significant differences between the C♀ and W♀ groups (Figure 6), including Streptococcaceae (LDA score = 3.78), Cyanobiaceae (LDA score = 2.61), Cyanobacteria (LDA score = 3.22), Arenimonas (LDA score = 2.50), Verrucomicrobiae (LDA score = 3.69), and Pir2_lineage (LDA score = 2.69) (Figure 6A). Furthermore, 23 microbial clades displayed statistically significant differences between the C♂ and W♂ groups, including Fusobacteriia (LDA score = 4.09), Peptostreptococcales_Tissierellales (LDA score = 3.47), Rhodocyclaceae (LDA score = 3.56), Lactobacillus (LDA score = 3.13), and Myroides (LDA score = 2.70) (Figure 6B).

3.5. Non-Targeted Metabolomics

The impact the different culture models on the muscle metabolism of Chinese mitten crabs was analyzed using orthogonal partial least squares discriminant analysis (OPLS-DA). As shown in Figure S1, the OPLS-DA score chart of electrospray ionization (ESI) (−) (Figure S2A,B, A: C♀ vs. W♀, B: C♂ vs. W♂) showed significant separation between different groups, indicating significant differences in metabolites related to different rolling times. The arrangement test showed that the R2 and Q2 intercepts of ESI(−) were R2 = (0.0, 0.9), Q2 = (0.0, −0.17) between the C♀ and W♀ groups and R2 = (0.0, 0.99), Q2 = (0.0, 0.1) between the C♂ and W♂ groups, respectively, indicating that the OPLS-DA model is.
As depicted in Figure 7A,B, the heat map and VIP map clearly illustrate that the wheat-crab pattern can modify both the types and amounts of metabolites present in crab meat (VIP > 1 and p < 0.05). These metabolites are categorized and identified based on their chemical classifications, such as fatty acyls, triazines, carboxylic acids and derivatives, glycerophospholipids, steroids, and steroid derivatives. Furthermore, the findings indicate that N-acetyl-d-lactosamine (p = 0.004221), arenobufagin (p = 0.045766), and Cys-Gln (p = 0.025446) are the primary metabolites influenced by the WCM.
To gain deeper insights into the biological roles of differentially abundant metabolites, we identified signaling pathways that were significantly enriched with differential metabolites between the control group and WCM group using the KEGG database (p < 0.05). In the analysis between the W♀ and C♀ groups, the top 20 enriched metabolic pathways included glutathione metabolism, caffeine metabolism, thiamine metabolism, vitamin B6 metabolism, arginine biosynthesis, vitamin digestion and absorption, lysine degradation, as well as other important metabolic pathways (Figure 7C). For the comparison between the W♂ and C♂ groups, the top 20 enriched metabolic pathways included polyketide sugar unit biosynthesis, phosphonate and phosphinate metabolism, microbial metabolism in diverse environments, purine metabolism, glycerolipid metabolism, glycerophospholipid metabolism, and additional critical metabolic pathways (Figure 7C). These disrupted metabolic pathways are also strongly associated with the substantial changes observed in the aforementioned differentially abundant metabolites.

3.6. Correlation Analysis

To explore whether the wheat crab model’s effect on muscle metabolism is linked to changes in gut microbiota, we performed a Spearman correlation analysis between differential microbial genera and metabolites (Figure 8). In the W♀ vs. C♀ group, intestinal microbiota genera were significantly correlated with N-acetyl-d-lactosamine and 2, 4, 6-tri-tert-butylaniline (Figure 8A). In the W♂ vs. C♂ group, correlations were observed with 2-aminoethylphosphonic acid and Cys-Gln (Figure 8B). Additionally, Cys-Gln was negatively correlated with Malaciobacter and Luteolibacter in the W♀ vs. C♀ group, while it was negatively correlated with Fusobacterium and positively correlated with Hafnia-Obesumbacterium, Peptostreptococcus, and Enterococcus in the W♂ vs. C♂ group. These related patterns suggest that the changes in the gut microbiota of the WCM may be associated with the alterations in the muscle metabolite profile of E. sinensis.

4. Discussion

Our study is the first to elucidate the impact of wheat-crab culture and pond monoculture on the growth performance, immunity, and gut microbiome of E. sinensis. Significant differences were not observed in the weight gain of E. sinensis between the two cultivation models, although the maturity level of E. sinensis under the WCM was significantly greater compared to that of the PC model. These findings suggest that the wheat-crab co-culture approach holds promise as a viable method for commercial-scale aquaculture.

4.1. Performance Indexes

The aquaculture environment has a significant impact on the growth performance of E. sinensis [22]. Environmental factors (e.g., water quality, substrate, and feed) and farming models (e.g., rice-crab, recirculating systems) directly influence crab physiology and energy allocation, ultimately affecting growth performance [23,24]. Our results indicated that the two culture models did not significantly affect the overall weight gain of E. sinensis, but influenced their energy allocation strategy, particularly in female crabs. A key finding was that female crabs in the WCM exhibited a significantly lower HIS alongside a significantly higher GSI compared to those in the PC model. This aligns with the typical physiological pattern during ovarian development in female crabs: nutrients stored in the hepatopancreas are mobilized and transferred to the developing ovaries, resulting in a negative correlation between GSI and HIS [25,26]. The more natural environment provided by the WCM may have promoted this physiological process, leading to earlier and more advanced gonadal development in female crabs.
More importantly, this study revealed that for many growth indices, the differences between sexes were far greater than those between the culture models. For instance, the final body weight and muscle yield of male crabs were significantly higher than those of females, a trend consistent under both culture models. This pattern clearly suggests that, for E. sinensis, sex is a stronger determinant of growth performance than the culture models investigated in this study. It is essential to consider sex as a critical biological variable in future aquaculture practices and related research.

4.2. Biochemical Parameters

In the present study, the female crab groups exhibited higher activities of CAT, SOD, and GSH-Px compared to the male crab groups; however, no significant difference was observed between the two cultivation modes. Additionally, MDA activity did not differ significantly among any of the groups. Taken together, these findings suggest that the antioxidant capacity of Chinese mitten crabs was not significantly affected by the two culture modes. Our study investigated the impact of two breeding models on the nutritional and health status of aquatic organisms, with a specific focus on TG and CHO levels. CHO plays a critical role in the synthesis of cell membranes and production of steroid hormones, with its blood concentration being affected by factors such as liver function, nutritional status, gender, and sexual development [27]. TGs serve as the primary fat storage molecules in the body and represent an important energy source for cells [28]. Our results did not show significant differences in TG and CHO levels between the two breeding models, indicating that the models did not significantly affect lipid metabolism. However, a notable gender-specific difference was observed, with male mitten crabs exhibiting significantly higher CHO levels compared to females. This finding highlights the need for further research to explore gender-specific responses and environmental responses on the nutritional and health status of aquatic organisms.
In crustaceans, hemolymph serves as an open circulatory system and plays a key role in transporting hormones, oxygen, nutrients, and other substances throughout the organism [29,30]. ALP, a glycoprotein enzyme, is recognized as a critical biomarker for assessing the condition of the plasma membrane and endoplasmic reticulum [31,32]. In this study, no significant differences in ALP activity levels were observed among the experimental groups, suggesting that the serum cells of E. sinensis were not affected or damaged by the ecological wheat-crab farming model. The level of serum ALT activity can serve as a tool for monitoring health status [33,34]. If liver cells are injured or their permeability increases, ALT may be released into the bloodstream, leading to elevated blood transaminase activity [35]. In our research, no significant increase in serum ALT activity was observed, suggesting that the liver cells of Chinese mitten crabs were not adversely affected by the WCM treatment.

4.3. Gene Expression Analyses

Innate immunity primarily depends on the recognition of pathogens by innate receptors, which modulate the expression of antimicrobial peptides by activating nuclear factor-kappa B (NF-κB) via MyD88 [36]. Among these peptides, ALF is considered one of the most crucial antimicrobial compounds [37]. In this research, the expression levels of ALF2, Myd88, and CncC genes in the hepatopancreas did not significantly differ between the two culture models. However, male crabs showed significantly higher expression levels than female crabs, indicating that male crabs may have stronger immune defense functions. Previous studies have found that the xenobiotic transcription factor CncC serves as the primary regulator of antioxidant and detoxification genes [38].
The significant upregulation of IL and Keap1 genes in the W♂ group indicates that male crabs have model-specific immunity and antioxidant responses. IL is a key cytokine in the inflammatory response, and its elevated expression indicates an elevated immune activation status in male E. sinensis with WCM. Meanwhile, Keap1 is a key negative regulatory factor of the Nrf2-Keap1 pathway that regulates the expression of antioxidant genes [39]. The increase in Keap1 expression may reflect the dynamic feedback mechanism in this pathway and could be a response to elevated oxidative stress. Female crabs may allocate a greater proportion of their energy resources to gonadal development, as demonstrated by their higher GSI, which may limit the allocation of resources to sustained and high-level immune gene expression. In contrast, male crabs do not require direct energy consumption for the formation of yolk cells, and thus may have a stronger ability to build a robust immune and antioxidant defense to cope with environmental factors. Furthermore, the expression of the ProPO gene, a central component of the melanization cascade, was markedly elevated in the WCM compared to the PC model. This discovery further indicates that the WCM environment has the potential to enhance the immunity and antioxidant capacity of male E. sinensis.

4.4. Intestinal Microbiota

In crustaceans, the gut serves as the habitat for a diverse range of microorganisms. It functions not only as a key organ for digestion, absorption, and nutrient exchange but also plays a crucial role in preserving host health and modulating numerous important physiological processes [40,41]. The intestinal microbiota constitute a dynamic and diverse ecosystem, where environmental and nutritional factors play a significant role in shaping the composition and abundance of the microbial community [42,43,44]. Our results provide robust evidence that both the culture model and the host sex are major drivers of microbial community structure in E. sinensis. We found significant differences in beta diversity among the four groups (Adonis test, R2 = 0.2364, p = 0.001), indicating distinct microbial community compositions. Furthermore, significant variations in alpha diversity indices (e.g., Chao1, p = 0.0016; Shannon, p = 0.0001) confirmed that the richness and evenness of the gut microbes were also markedly influenced between the WCM model and the PC model.
The most functionally significant alterations were observed in the abundance of specific bacterial taxa. At the phylum level, the predominant bacterial groups in crabs across all four groups were Firmicutes, Proteobacteria, Bacteroidetes, and Fusobacteriota [45,46]. Among them, Firmicutes are key contributors to energy harvest and short-chain fatty acid production, which enhance host nutrient absorption and fortify intestinal barrier integrity, thereby exerting anti-inflammatory effects [47]. At the genus level, the LEfSe identified specific biomarkers indicative of the culture environment. Notably, the class Fusobacteriia—a taxon often associated with inflammatory conditions in aquatic animals—was identified as a significant biomarker in the control male group (C♂). In stark contrast, the WCM male group (W♂) was prominently enriched with Lactobacillus, a genus widely recognized for its probiotic properties, including pathogen inhibition and immunomodulation [48]. Furthermore, both Candidatus_Hepatoplasma and Candidatus_Bacilloplasma belong to the phylum Tenericutes. Several studies have indicated that Candidatus_Bacilloplasma is commonly found in healthy crustaceans [49]. These findings indicate that the WCM leads to alterations in the composition of gut microbiota, characterized by an increase in beneficial microorganisms and a reduction in harmful ones. These findings align with previous studies on integrated culture systems for E. sinensis, such as the rice-crab model, where similar enrichments of beneficial bacterial consortia have been reported [25]. We propose that the WCM environment, through the provision of complex organic matter from wheat residues and a diverse environmental microbiome, acts as a continuous source of prebiotic substrates and beneficial microbial inocula. This ecological feature selectively enriches a gut microbiota that is more metabolically efficient and resilient against pathogen colonization, thereby contributing to the enhanced immune competence and overall physiological well-being observed in crabs reared under the WCM model.

4.5. Non-Targeted Metabolomics

In order to examine the effects of the two culture models on the muscle metabolism of E. sinensis, we employed OPLS-DA for non-targeted metabolomics analysis. The results indicated significant differences in metabolic pathways between female crabs (C♀ and W♀) and male crabs (C♂ and W♂), which may have important implications for their immune and metabolic functions.
In our study, the significant enrichment pathways of differential metabolites included glutathione metabolism, arginine biosynthesis, vitamin digestion and absorption, thiamine metabolism, and vitamin B6 metabolism in the C♀ and W♀ groups. Earlier research has demonstrated that glutathione strengthens the antioxidant defense and oxidative stress response in crabs, safeguarding them against potential harm [50]. Additionally, dietary arginine plays a role in modulating the expression of genes related to antioxidation and immunity in crabs, thereby mitigating T-2 toxin-induced damage [51]. Thiamine and vitamin B6 metabolism are the basis for maintaining normal nervous system function and energy metabolism, and the normal conduct of these processes is also important for the maintenance of immune function under the wheat-crab treatment.
In contrast, the significant enrichment pathways of differential metabolites included polyketide sugar unit biosynthesis, phosphonate and phosphinate metabolism, purine metabolism, glycerolipid metabolism, and glycerophospholipid metabolism between the C♂ and W♂ groups. For example, glycerolipid and glycerophospholipid metabolism are essential for preserving the stability and fluidity of cell membranes, which directly impact the proper functioning of immune cells and efficiency of substance transport [52]. Moreover, purine metabolism is intricately connected to energy production and signal transduction pathways, potentially influencing immune function by modulating intracellular signaling networks [53,54]. Additionally, processes such as polyketide biosynthesis may play a role in the growth and development of male crabs [55,56], specifically by affecting their physiological traits through changes in cellular structure and metabolic activity.
In addition, omics correlation analysis serves as a vital tool for elucidating the relationship between gut microbiota patterns and metabolite changes [57]. The correlation analysis between gut microbiota and metabolites provides compelling evidence for functional crosstalk between microbial communities and host metabolism. The significant associations between specific microbial genera (e.g., Fusobacterium, Lactobacillus) and muscle metabolites suggest that the WCM-induced gut microbiota restructuring serves as an upstream regulator of crabs’ metabolic phenotypes. We propose that the altered gut microbial community modulates host metabolism through several interconnected mechanisms: the production of microbial metabolites that directly influence metabolic pathways in crabs, enhanced degradation and utilization of dietary components, thereby altering nutrient availability. This microbiota–metabolite axis constitutes a pivotal mechanism by which the WCM environment translates ecological advantages into improved physiological performance, offering a comprehensive framework for understanding how integrated culture models enhance crab health through coordinated microbiome–metabolome interactions.

5. Conclusions

This study provides the first comprehensive evaluation of the WCM as a sustainable alternative to the PC for E. sinensis. Our results demonstrate that while the WCM does not enhance final body weight, it induces significant physiological improvements characterized by sexual dimorphism: females exhibit accelerated ovarian maturation, while males show enhanced immune and antioxidant capacities through upregulation of key genes (IL, Keap1, ProPO). The health benefits of WCM are fundamentally supported by a restructuring of the gut microbial ecosystem, marked by increased beneficial Firmicutes and Lactobacillus alongside reduced potential pathogens. These microbial changes are functionally linked to systemic metabolic reprogramming, as revealed by non-targeted metabolomics, indicating improved antioxidant defense in females and optimized energy metabolism in males. In conclusion, the WCM successfully translates its ecological advantages into measurable health benefits for E. sinensis. This integrated approach not only enhances crab quality but also aligns with national food security strategies by enabling simultaneous grain and aquaculture production on the same land. We recommend WCM as a sustainable practice that supports both ecological integrity and economic viability in Chinese mitten crab aquaculture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13102396/s1, Figure S1: Impact of different culture patterns on beta diversity indices (A,B) and alpha diversity indices (C–F) of intestinal microbiota (n = 6). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in wheat-crab model; W♂ represents male E. sinensis in wheat-crab model; Kru-Wall: Kruskal-Wallis test. Figure S2: Quality assessment of metabolomic data for comparisons between C♀ vs W♀ and C♂ vs W♂. Score plot of orthogonal partial least squares discriminant analysis (OPLS-DA) (A: C♀ vs W♀, B: C♂ vs W♂) and permutation test results (C: C♀ vs W♀, D: C♂ vs W♂) in negative ion mode (n = 6). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in wheat-crab co-culture systems; W♂ represents male E. sinensis in wheat-crab co-culture systems.

Author Contributions

M.Y.: Conceptualization, Methodology, Software, Data curation, Writing—Original draft preparation. J.L. and C.Y.: Visualization, Investigation. H.J.: Supervision. T.L.: Software, Validation. M.Y. and T.P.: Writing—Reviewing and Editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Anhui Province innovation platform of major science and technology projects (grant number: S202305a12020001) and China Agriculture Research System (CARS-48), and Anhui Provincial Modern Agri-industry Technology Research System (AHCYJSTX-08).

Institutional Review Board Statement

All experiments were performed in strict accordance with protocols approved by The Fishery Institute of Anhui Academy of Agricultural Sciences Animal Ethics Committee (permission No. AAAS2023-9, 15 March 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Acknowledgments

The authors are grateful to Hongge Tao of the Dangtu Agricultural Technology Extension Center (Dangtu 243100, China) for his professional support and technical assistance throughout the experimental phase of this study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tan, Y.; Dong, J.; Wang, L.; Li, W.; Bao, J.; Jiang, H. Chronic chlorpyrifos exposure induces oxidative stress, neurological damage, and hepatopancreas enrichment in Chinese mitten crab (Eriocheir sinensis). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2025, 289, 110111. [Google Scholar] [CrossRef]
  2. Zhu, X.; Zhang, Y.; Zhu, Y.; Li, Y.; Cui, J.; Yu, B. Multidimensional deconstruction and workable solutions for addressing China’s food security issues: From the perspective of sustainable diets. Land Use Policy 2025, 148, 107401. [Google Scholar] [CrossRef]
  3. Chen, J.; Liu, X.; Chen, J.; Jin, H.; Wang, T.; Zhu, W.; Li, L. Underestimated nutrient from aquaculture ponds to Lake Eutrophication: A case study on Taihu Lake Basin. J. Hydrol. 2024, 630, 130749. [Google Scholar] [CrossRef]
  4. Kong, L.; Cai, C.; Ye, Y.; Chen, D.; Wu, P.; Li, E.; Chen, L.; Song, L. Comparison of non-volatile compounds and sensory characteristics of Chinese mitten crabs (Eriocheir sinensis) reared in lakes and ponds: Potential environmental factors. Aquaculture 2012, 364–365, 96–102. [Google Scholar] [CrossRef]
  5. Tang, S.-Z.; Song, D.; Bai, S.-Y.; Huang, X.-L.; Chen, Z.-X.; Wang, P.; Qin, D.-L. Trace elements accumulation and health risk assessment of Chinese mitten crab (Eriocheir sinensis) from monoculture and rice-crab co-culture mode. J. Food Compos. Anal. 2023, 123, 105640. [Google Scholar] [CrossRef]
  6. Zhang, B.; Hou, Y.; Zhu, R.; Wang, W.; Liu, H.; Yang, Z.; Wu, M.; Wang, Q. Comparative study on growth performance and nutritional quality of Eriocheir sinensis between Liaohe River strain and Yangtze River strain under rice field culture environment. J. Food Compos. Anal. 2025, 137, 106942. [Google Scholar] [CrossRef]
  7. Wang, A.; Ma, X.; Xu, J.; Lu, W. Methane and nitrous oxide emissions in rice-crab culture systems of northeast China. Aquac. Fish. 2019, 4, 134–141. [Google Scholar] [CrossRef]
  8. Jiang, W.; Jia, X.; Zhang, M.; Qiang, W.; Shen, X.; Jiang, G.; Li, X.; Chi, C.; Liu, H.; Liu, W.; et al. The effect of dietary vitamin A supplementation on growth, gonadal development, molting, immunity, and ammonia nitrogen resistance in sub-adult male Chinese mitten crab, Eriocheir sinensis. Aquaculture 2024, 581, 740451. [Google Scholar] [CrossRef]
  9. Li, B.-W.; Xu, W.-B.; Dong, W.-R.; Zhang, Y.-M.; Cheng, Y.-X.; Chen, D.-Y.; Xiao, Y.; Chen, Y.-Y.; Shu, M.-A. Identification and function analysis of two fibroblast growth factor receptor (FGFR) from Scylla paramamosain: The evidence of FGFR involved in innate immunity in crustacean. Fish Shellfish Immunol. 2022, 131, 602–611. [Google Scholar] [CrossRef] [PubMed]
  10. Resch-Sedlmeier, G.; Sedlmeier, D. Release of digestive enzymes from the crustacean hepatopancreas: Effect of vertebrate gastrointestinal hormones. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 1999, 123, 187–192. [Google Scholar] [CrossRef]
  11. Yan, Z.; zhu, L.; Hou, C.; Zheng, Y.; Guo, H.; Shi, L.; Tan, B.; Zhang, S. The enhancement effect of low-dose dietary lipopolysaccharide on the growth and immunity of Litopenaeus vannamei, and transcriptome analysis. Fish Shellfish Immunol. 2023, 133, 108517. [Google Scholar] [CrossRef]
  12. Zheng, X.; Duan, Y.; Dong, H.; Zhang, J. Effects of dietary Lactobacillus plantarum in different treatments on growth performance and immune gene expression of white shrimp Litopenaeus vannamei under normal condition and stress of acute low salinity. Fish Shellfish Immunol. 2017, 62, 195–201. [Google Scholar] [CrossRef]
  13. Kim, J.-H.; Cho, J.-H.; Kim, S.-R.; Hur, Y.B. Toxic effects of waterborne ammonia exposure on hematological parameters, oxidative stress and stress indicators of juvenile hybrid grouper, Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀. Environ. Toxicol. Pharmacol. 2020, 80, 103453. [Google Scholar] [CrossRef] [PubMed]
  14. Chen, J.; Wang, H.; Yuan, H.; Hu, N.; Zheng, Y.; Tan, B.; Shi, L.; Zhang, S. Tapping Chlorella vulgaris potential for enhanced growth, immunity, digestion, microbiota, and immunometabolism in Litopenaeus vannamei feeding across varied salinities. Aquaculture 2024, 581, 740469. [Google Scholar] [CrossRef]
  15. Zhang, B.-Y.; Wang, W.-J.; Zhu, R.; Zhang, D.-M.; Wang, N.; Zheng, N.; Wang, S.; Liu, H.-J.; Wan, J.-W.; Chen, Y.-K.; et al. Comparative study on growth performance and edible portion nutritional composition of male Eriocheir sinensis at different growth stages in rice-crab culture systems. J. Food Compos. Anal. 2024, 130, 106156. [Google Scholar] [CrossRef]
  16. Yu, A.-Q.; Jin, X.-K.; Guo, X.-N.; Li, S.; Wu, M.-H.; Li, W.-W.; Wang, Q. Two novel Toll genes (EsToll1 and EsToll2) from Eriocheir sinensis are differentially induced by lipopolysaccharide, peptidoglycan and zymosan. Fish Shellfish Immunol. 2013, 35, 1282–1292. [Google Scholar] [CrossRef] [PubMed]
  17. Tang, S.; Xu, X.; Yu, D.; Long, M.; Xia, H.; Lu, Y.; Gan, Z. Evolutionary and functional conservation of myeloid differentiation factor 88 (MyD88) in amphibian Xenopus tropicalis. Gene 2023, 865, 147332. [Google Scholar] [CrossRef]
  18. Tiwari, N.; Suri, M.; Upadhyay, J.; Ansari, M.N.; Samad, A. Chapter 11—Interplay between gut microbiota in immune homeostasis and inflammatory diseases. In Recent Developments in Anti-Inflammatory Therapy; Prasher, P., Zacconi, F.C., Withey, J.H., Rathbone, M., Dua, K., Eds.; Academic Press: Cambridge, MA, USA, 2023; pp. 143–154. [Google Scholar]
  19. Macpherson, A.J.; Pachnis, V.; Prinz, M. Boundaries and integration between microbiota, the nervous system, and immunity. Immunity 2023, 56, 1712–1726. [Google Scholar] [CrossRef]
  20. Shor, E.K.; Brown, S.P.; Freeman, D.A. A novel role for the pineal gland: Regulating seasonal shifts in the gut microbiota of Siberian hamsters. J. Pineal Res. 2020, 69, e12696. [Google Scholar] [CrossRef]
  21. Pang, Z.; Lu, Y.; Zhou, G.; Hui, F.; Xu, L.; Viau, C.; Spigelman, F.; MacDonald, E.; Wishart, S.; Li, S.; et al. MetaboAnalyst 6.0: Towards a unified platform for metabolomics data processing, analysis and interpretation. Nucleic Acids Res. 2024, 52, W398–W406. [Google Scholar] [CrossRef]
  22. Zhang, R.; Zhao, Z.; Guo, K.; Zhao, X.; Deng, X.; Wang, S.; Luo, L. Effect of environmental factors on the control of milky disease in Chinese mitten crab (Eriocheir sinensis). Aquaculture 2026, 610, 742942. [Google Scholar] [CrossRef]
  23. Han, C.; Xiao, Y.; Dai, Z.; Feng, L.; Shi, Y.; Liu, X.; Ge, J.; Yang, J. Use of stable isotopic signatures and fatty acid profiles to authenticate Chinese mitten crab (Eriocheir sinensis) reared in ponds and rice fields. Food Control 2025, 174, 111253. [Google Scholar] [CrossRef]
  24. Fang, L.; Chen, X.; Fan, L.; Hu, G.; Qiu, L.; Song, C.; Xie, Y.; Giesy, J.P.; Wang, C.; Meng, S. Environment consistently impact on aquaculture: The predominant source of residual pollutants in cultured Chinese mitten crab (Eriocheir sinensis) across China. Heliyon 2024, 10, e32418. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, B.-Y.; Yao, Q.; Zhang, D.-M.; Wang, N.; Liu, H.-J.; Wan, J.-W.; Chen, Y.-K.; Wang, Q.-J.; Guo, Z.-X. Comparative study on growth, digestive function and intestinal microbial composition of female Chinese mitten crab Eriocheir sinensis selected at different growth stages in rice-crab culture systems. Aquaculture 2022, 554, 738120. [Google Scholar] [CrossRef]
  26. Long, X.; Guo, Q.; Wang, X.; Francis, D.S.; Cheng, Y.; Wu, X. Effects of fattening period on ovarian development and nutritional quality of adult female Chinese mitten crab Eriocheir sinensis. Aquaculture 2020, 519, 734748. [Google Scholar] [CrossRef]
  27. Guo, J.; Chen, S.; Zhang, Y.; Liu, J.; Jiang, L.; Hu, L.; Yao, K.; Yu, Y.; Chen, X. Cholesterol metabolism: Physiological regulation and diseases. MedComm 2024, 5, e476. [Google Scholar] [CrossRef] [PubMed]
  28. Semova, I.; Biddinger, S.B. Triglycerides in Nonalcoholic Fatty Liver Disease: Guilty Until Proven Innocent. Trends Pharmacol. Sci. 2021, 42, 183–190. [Google Scholar] [CrossRef] [PubMed]
  29. Wirkner, C.S.; Richter, S. Circulatory System and Respiration. In Functional Morphology and Diversity; Watling, L., Thiel, M., Eds.; Oxford University Press: Oxford, UK, 2013. [Google Scholar]
  30. Tian, Y.; Guo, C.; Zhang, X.; Xie, S.; Zhou, Q.; Luo, J.; Zhu, T.; Yang, Y.; Li, X.; Jin, M. Effects of dietary histidine level on growth, antioxidant capacity and TOR signaling pathway in juvenile swimming crabs, Portunus trituberculatus. Aquac. Rep. 2023, 33, 101869. [Google Scholar] [CrossRef]
  31. Suri, A.; Singh, N.; Bansal, S.K. A Study on the Serum γ-Glutamyltranspeptidase and Plasma Osteopontin in Alcoholic Liver Disease. J. Lab. Physicians 2022, 14, 101–108. [Google Scholar] [CrossRef]
  32. Khan, K.; Praba, L.K.; Ali, H.A.J. Ascidians as Bioresources: An Anti-inflammatory Activity of Colonial Ascidians Eudistoma ovatum and Didemnum perlucidum. J. Biol. Act. Prod. Nat. 2021, 11, 254–268. [Google Scholar] [CrossRef]
  33. Männistö, V.; Salomaa, V.; Jula, A.; Lundqvist, A.; Männistö, S.; Perola, M.; Åberg, F. ALT levels, alcohol use, and metabolic risk factors have prognostic relevance for liver-related outcomes in the general population. JHEP Rep. 2024, 6, 101172. [Google Scholar] [CrossRef]
  34. Sigurdarson, S.S.; Bjornsson, H.K.; Bjornsson, E.S. THU-151 A prospective study on the causes of notable elevation of alanine aminotransferase (ALT) as well as elevation of both ALT and alkaline phosphatase (ALP) with special emphasis on drug-induced liver injury (DILI). J. Hepatol. 2024, 80, S328. [Google Scholar] [CrossRef]
  35. Feng, M.; Liu, K.; Zhao, G.; Lou, S.; An, B.; Lin, L.; Ding, Y.; Bao, S.; Wang, H. A novel model based on qAnti-HBc and conventional biomarkers for identifying significant liver injury among CHB patients with ALT ≤ ULN. Antivir. Res. 2022, 202, 105315. [Google Scholar] [CrossRef] [PubMed]
  36. Oh, J.; Kwon, T.W.; Choi, J.H.; Kim, Y.; Moon, S.-K.; Nah, S.-Y.; Cho, I.-H. Ginsenoside-Re inhibits experimental autoimmune encephalomyelitis as a mouse model of multiple sclerosis by downregulating TLR4/MyD88/NF-κB signaling pathways. Phytomedicine 2024, 122, 155065. [Google Scholar] [CrossRef] [PubMed]
  37. Imjongjirak, C.; Amparyup, P.; Tassanakajon, A.; Sittipraneed, S. Antilipopolysaccharide factor (ALF) of mud crab Scylla paramamosain: Molecular cloning, genomic organization and the antimicrobial activity of its synthetic LPS binding domain. Mol. Immunol. 2007, 44, 3195–3203. [Google Scholar] [CrossRef]
  38. Amezian, D.; Fricaux, T.; de Sousa, G.; Maiwald, F.; Huditz, H.-I.; Nauen, R.; Le Goff, G. Investigating the role of the ROS/CncC signaling pathway in the response to xenobiotics in Spodoptera frugiperda using Sf9 cells. Pestic. Biochem. Physiol. 2023, 195, 105563. [Google Scholar] [CrossRef]
  39. Zhao, L.; Tao, X.; Wang, Q.; Yu, X.; Dong, D. Diosmetin alleviates neuropathic pain by regulating the Keap1/Nrf2/NF-κB signaling pathway. Biomed. Pharmacother. 2024, 170, 116067. [Google Scholar] [CrossRef] [PubMed]
  40. Starke, S.; Harris, D.M.M.; Paulay, A.; Aden, K.; Waschina, S. Comparative analysis of amino acid auxotrophies and peptidase profiles in non-dysbiotic and dysbiotic small intestinal microbiomes. Comput. Struct. Biotechnol. J. 2025, 27, 821–831. [Google Scholar] [CrossRef]
  41. Foysal, M.J. Host habitat shapes the core gut bacteria of decapod crustaceans: A meta-analysis. Heliyon 2023, 9, e16511. [Google Scholar] [CrossRef]
  42. van de Guchte, M.; Mondot, S.; Doré, J. Dynamic Properties of the Intestinal Ecosystem Call for Combination Therapies, Targeting Inflammation and Microbiota, in Ulcerative Colitis. Gastroenterology 2021, 161, 1969–1981.e12. [Google Scholar] [CrossRef]
  43. Yonoichi, S.; Hirano, T.; Hara, Y.; Ishida, Y.; Shoda, A.; Kimura, M.; Murata, M.; Mantani, Y.; Yokoyama, T.; Ikenaka, Y.; et al. Effects of exposure to the neonicotinoid pesticide clothianidin on mouse intestinal microbiota under unpredictable environmental stress. Toxicol. Appl. Pharmacol. 2024, 482, 116795. [Google Scholar] [CrossRef]
  44. Baldeon, M.E.; Cardenas, P.; Carpio, V.; Chavez, M.; Benitez, D.; Robles, J.; Loza, G.; Alvarado, R.; Rios, G.; Pazmiño, K.; et al. Nutritional Status and Intestinal Microbiota in Children with High Prevalence of Malnutrition Supplemented with a Snack Based on Lupinus mutabilis Sweet—2022–2023. Curr. Dev. Nutr. 2025, 9, 106245. [Google Scholar] [CrossRef]
  45. Fu, C.; Cui, Z.; Shi, X.; Liu, J.; Jiang, Y.; Zhang, R. Effects of dietary glyceryl monolaurate supplementation on growth performance, non-specific immunity, antioxidant status and intestinal microflora of Chinese mitten crabs. Fish Shellfish Immunol. 2022, 125, 65–73. [Google Scholar] [CrossRef]
  46. Yu, C.; Li, L.; Jin, J.; Zhang, B.; Wei, H.; Zhao, Y.; Li, X.; Li, Y. Comparative analysis of gut bacterial community composition during a single day cycle in Chinese mitten crab (Eriocheir sinensis). Aquac. Rep. 2021, 21, 100907. [Google Scholar] [CrossRef]
  47. Shastry, R.P.; Ghate, S.D.; Hameed, A.; Prasad Rao, R.S.; Bhandary, Y.P.; Shetty, R. Emergence of rare and low abundant anaerobic gut Firmicutes is associated with a significant downfall of Klebsiella in human colon cancer. Microb. Pathog. 2024, 193, 106726. [Google Scholar] [CrossRef] [PubMed]
  48. Fadare, O.S.; Enabulele, O.I.; Singh, V.; Pradhan, D. GC-MS based metabolomic profiling of synbiotic action of probiotic lactobacilli with aqueous garlic extract against Salmonella spp. Microbe 2025, 8, 100494. Microbe 2025, 8, 100494. [Google Scholar] [CrossRef]
  49. Infante-Villamil, S.; Huerlimann, R.; Condon, K.; Maes, G.E.; Jerry, D.R. Bacterial signatures of productivity decay in Penaeus monodon ponds infected with PirA toxin. Aquaculture 2019, 511, 734202. [Google Scholar] [CrossRef]
  50. Liu, J.D.; Liu, W.B.; Zhang, C.Y.; Xu, C.Y.; Zheng, X.C.; Zhang, D.D.; Chi, C. Dietary glutathione supplementation enhances antioxidant activity and protects against lipopolysaccharide-induced acute hepatopancreatic injury and cell apoptosis in Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol. 2020, 97, 440–454, Erratum in Fish Shellfish Immunol. 2020, 100, 496–497. [Google Scholar] [CrossRef]
  51. Zhang, C.; Chi, C.; Liu, J.; Ye, M.; Zheng, X.; Zhang, D.; Liu, W. Protective effects of dietary arginine against oxidative damage and hepatopancreas immune responses induced by T-2 toxin in Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 2020, 104, 447–456. [Google Scholar] [CrossRef]
  52. Gonzalez-Baro, M.R.; Coleman, R.A. Mitochondrial acyltransferases and glycerophospholipid metabolism. Biochim. Biophys. Acta (BBA)-Mol. Cell Biol. Lipids 2017, 1862, 49–55. [Google Scholar] [CrossRef]
  53. Zamer, B.A.; Shafarin, J.; Sharaf, B.; Hroub, H.A.; Soares, N.C.; Semreen, M.H.; Hamad, M.; Muhammad, J.S. Estrogen-mediated inhibition of purine metabolism and cell cycle arrest as a novel therapeutic approach in colorectal cancer. Mol. Cell. Endocrinol. 2025, 596, 112414. [Google Scholar] [CrossRef] [PubMed]
  54. Kennelly, C.; Tran, P.; Prindle, A. Environmental purines decrease Pseudomonas aeruginosa biofilm formation by disrupting c-di-GMP metabolism. Cell Rep. 2024, 43, 114154. [Google Scholar] [CrossRef] [PubMed]
  55. Zhang, B.; Ge, H.M. Recent progresses in the cyclization and oxidation of polyketide biosynthesis. Curr. Opin. Chem. Biol. 2024, 81, 102507. [Google Scholar] [CrossRef]
  56. Guth, F.M.; Lindner, F.; Rydzek, S.; Peil, A.; Friedrich, S.; Hauer, B.; Hahn, F. Rieske Oxygenase-Catalyzed Oxidative Late-Stage Functionalization during Complex Antifungal Polyketide Biosynthesis. ACS Chem. Biol. 2023, 18, 2450–2456. [Google Scholar] [CrossRef]
  57. Cheng, X.; Chen, J.; Guo, X.; Cao, H.; Zhang, C.; Hu, G.; Zhuang, Y. Disrupting the gut microbiota/metabolites axis by Di-(2-ethylhexyl) phthalate drives intestinal inflammation via AhR/NF-κB pathway in mice. Environ. Pollut. 2024, 343, 123232. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 13 02396 g001
Figure 1. Schematic diagram of the breeding model. (A) the crab-wheat model. (B) the pond culture model.
Figure 1. Schematic diagram of the breeding model. (A) the crab-wheat model. (B) the pond culture model.
Microorganisms 13 02396 g001
Microorganisms 13 02396 g002
Figure 2. Impact of various culture methods on the hepatopancreas immune indices of E. sinensis (n = 6), SOD to total superoxide dismutase (A), GSH-Px to glutathione peroxidase (B), CAT to catalase (C), and MDA refers to malondialdehyde content (D). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ denotes female E. sinensis in wheat-crab culture systems; W♂ denotes male E. sinensis in wheat-crab culture systems. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Figure 2. Impact of various culture methods on the hepatopancreas immune indices of E. sinensis (n = 6), SOD to total superoxide dismutase (A), GSH-Px to glutathione peroxidase (B), CAT to catalase (C), and MDA refers to malondialdehyde content (D). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ denotes female E. sinensis in wheat-crab culture systems; W♂ denotes male E. sinensis in wheat-crab culture systems. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Microorganisms 13 02396 g002
Microorganisms 13 02396 g003
Figure 3. Impact of serum biochemistry on E. sinensis in the wheat-crab model (n = 6), ALT refers to alanine aminotransferase (A); ALP refers to alkaline phosphatase (B); TP refers to total protein (C); TG refers to triglyceride (D); CHO refers to total cholesterol (E); and AMY refers to amylase (F). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Figure 3. Impact of serum biochemistry on E. sinensis in the wheat-crab model (n = 6), ALT refers to alanine aminotransferase (A); ALP refers to alkaline phosphatase (B); TP refers to total protein (C); TG refers to triglyceride (D); CHO refers to total cholesterol (E); and AMY refers to amylase (F). Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Microorganisms 13 02396 g003
Microorganisms 13 02396 g004
Figure 4. Gene expression levels in the hepatopancreas of E. sinensis from the wheat-crab model (n = 6). ALF2 refers to anti-lipopolysaccharide factor 2 (A); Myd88 refers to myeloid differentiation primary response gene 88 (B); IL refers to interleukin (C); ProPO refers to prophenoloxidase (D); CncC refers to Cap‘n’Collar Isoform C (E); and Keap1 refers to kelch-like ECH-associated protein 1 (F). Note: C♀ denotes control female E. sinensis; C♂ denotes control male E. sinensis; W♀ denotes female E. sinensis in wheat-crab model; W♂ denotes male E. sinensis in wheat-crab model. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Figure 4. Gene expression levels in the hepatopancreas of E. sinensis from the wheat-crab model (n = 6). ALF2 refers to anti-lipopolysaccharide factor 2 (A); Myd88 refers to myeloid differentiation primary response gene 88 (B); IL refers to interleukin (C); ProPO refers to prophenoloxidase (D); CncC refers to Cap‘n’Collar Isoform C (E); and Keap1 refers to kelch-like ECH-associated protein 1 (F). Note: C♀ denotes control female E. sinensis; C♂ denotes control male E. sinensis; W♀ denotes female E. sinensis in wheat-crab model; W♂ denotes male E. sinensis in wheat-crab model. Data are expressed as mean ± standard deviation. Identical letters indicate no significant difference (p > 0.05), while the absence of identical letters signifies a significant difference (p < 0.05).
Microorganisms 13 02396 g004
Microorganisms 13 02396 g005
Figure 5. Impact of various culture patterns on the intestinal microbiota composition of E. sinensis (n = 6). Note: (A): Influence on microbial abundance at the phylum level; (B): Influence on microbial abundance at the genus level; (C): VENN diagram at the genus level. Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Figure 5. Impact of various culture patterns on the intestinal microbiota composition of E. sinensis (n = 6). Note: (A): Influence on microbial abundance at the phylum level; (B): Influence on microbial abundance at the genus level; (C): VENN diagram at the genus level. Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Microorganisms 13 02396 g005
Microorganisms 13 02396 g006
Figure 6. LDA scores and cladograms for the LEfSe comparison analysis between the C♀ and W♀ groups (A) and C♂ and W♂ groups (B) (n = 6). The bacterial taxa that showed significantly higher levels in comparisons of C♀ versus W♀ and C♂ versus W♂ are highlighted in red and green, respectively. Discriminative taxa were identified using an LDA score threshold of 2.5. Statistical significance for differences in taxonomic relative abundances was determined at a p-value of 0.05. Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Figure 6. LDA scores and cladograms for the LEfSe comparison analysis between the C♀ and W♀ groups (A) and C♂ and W♂ groups (B) (n = 6). The bacterial taxa that showed significantly higher levels in comparisons of C♀ versus W♀ and C♂ versus W♂ are highlighted in red and green, respectively. Discriminative taxa were identified using an LDA score threshold of 2.5. Statistical significance for differences in taxonomic relative abundances was determined at a p-value of 0.05. Note: C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Microorganisms 13 02396 g006
Microorganisms 13 02396 g007
Figure 7. Identification and classification of differential metabolites and results of the KEGG analysis (n = 6). (A) Clustering heat map of differential metabolites. The color change from red to blue in the heat map indicates that the abundance of metabolites in each group of samples decreases from high to low. (B) VIP map of differential metabolites. The red rectangle on the right represents an increase, and the blue rectangle represents a decrease. (C) Top 20 KEGG pathways of differential metabolites. Note: The size of the squares indicates the magnitude of the impact factor, while the darker color represents a higher degree of enrichment significance. KEGG: Kyoto Encyclopedia of Genes and Genomes; C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Figure 7. Identification and classification of differential metabolites and results of the KEGG analysis (n = 6). (A) Clustering heat map of differential metabolites. The color change from red to blue in the heat map indicates that the abundance of metabolites in each group of samples decreases from high to low. (B) VIP map of differential metabolites. The red rectangle on the right represents an increase, and the blue rectangle represents a decrease. (C) Top 20 KEGG pathways of differential metabolites. Note: The size of the squares indicates the magnitude of the impact factor, while the darker color represents a higher degree of enrichment significance. KEGG: Kyoto Encyclopedia of Genes and Genomes; C♀ represents control female E. sinensis; C♂ represents control male E. sinensis; W♀ represents female E. sinensis in the wheat-crab model; W♂ represents male E. sinensis in the wheat-crab model.
Microorganisms 13 02396 g007
Microorganisms 13 02396 g008
Figure 8. Analysis of the correlation model between microorganisms (genera) and metabolites. (A) W♀ vs. C♀ group, (B) W♂ vs. C♂ group. The colors of the squares in the figure represent the strength of the correlation. Red represents a positive correlation, and blue represents a negative correlation. “*” indicates p < 0.05, “**” indicates p < 0.01 and “***” indicates p < 0.001.
Figure 8. Analysis of the correlation model between microorganisms (genera) and metabolites. (A) W♀ vs. C♀ group, (B) W♂ vs. C♂ group. The colors of the squares in the figure represent the strength of the correlation. Red represents a positive correlation, and blue represents a negative correlation. “*” indicates p < 0.05, “**” indicates p < 0.01 and “***” indicates p < 0.001.
Microorganisms 13 02396 g008
Table 1. Primer sequences utilized for real-time PCR analysis.
Table 1. Primer sequences utilized for real-time PCR analysis.
GenePrimer Sequence Forward (5′-3′)Primer Sequence Reverse (5′-3′)Tm (°C)Length (bp)
ALF2TCGGCAAAGTAACTGAAACTCTGTAATGAGGCGGGGTGACAAG60.590
Myd88GTGGGTCAGCTGTGGAACTATTCCCTGGCTTACAACCTTGTC59.7105
ProPOGTGACCGTCCGCATCTTCATTGTGCCTGGCTTCAATGTGT60.5123
ILCGATCCTACGAGTTCTTCAGCACTTGGTGTTGTCATC59.5125
Keap1CTTCATGTACACTGGCGAGAGTACAGCAAGCGTCAATCACA61.0105
CncCGCATCCTTCTGGTACCTCGTTCACTGCTTTGGCTCATCCTTG58.591
β-actinTCGTGCGAGACATCAAGGAAAAGGAAGGAAGGCTGGAAGAGTG59.5178
Table 2. Growth performance and tissue indexes of E. sinensis in the wheat-crab co-culture system.
Table 2. Growth performance and tissue indexes of E. sinensis in the wheat-crab co-culture system.
GroupsWeight (g)HIS (%)GSI (%)MYI (%)FNS (%)
C♀166.92 ± 24.11 a8.43 ± 1.02 a4.45 ± 1.09 b26.53 ± 2.31 a0.43 ± 0.01 a
C♂220.75 ± 43.97 b8.67 ± 1.35 a2.86 ± 0.41 a29.41 ± 1.68 b0.46 ± 0.04 a
W♀167.30 ± 25.06 a7.68 ± 0.81 b5.59 ± 2.07 b26.63 ± 1.45 a0.43 ± 0.02 a
W♂221.43 ± 38.49 b8.01 ± 1.07 a3.37 ± 0.53 a29.08 ± 2.04 b0.47 ± 0.03 a
Note: C♀: female E. sinensis in the pond culture model; C♂: male E. sinensis in the pond culture model; W♀: female E. sinensis in the wheat-crab model; W♂: male E. sinensis in the wheat-crab model; FNS: fullness index; MYI: muscle yield index; HIS: hepatopancreas index; GSI: gonadosomatic index. Comparisons were performed between crabs of the same sex between the two model treatments, with a indicating p > 0.05 (non-significant) and b indicating p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, M.; Ling, J.; Li, T.; Yu, C.; Jiang, H.; Pan, T. Effects of the Wheat Crab Model and the Pond Culture Model on the Growth, Metabolism and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis). Microorganisms 2025, 13, 2396. https://doi.org/10.3390/microorganisms13102396

AMA Style

Yang M, Ling J, Li T, Yu C, Jiang H, Pan T. Effects of the Wheat Crab Model and the Pond Culture Model on the Growth, Metabolism and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis). Microorganisms. 2025; 13(10):2396. https://doi.org/10.3390/microorganisms13102396

Chicago/Turabian Style

Yang, Min, Jun Ling, Tong Li, Chengchen Yu, He Jiang, and Tingshuang Pan. 2025. "Effects of the Wheat Crab Model and the Pond Culture Model on the Growth, Metabolism and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis)" Microorganisms 13, no. 10: 2396. https://doi.org/10.3390/microorganisms13102396

APA Style

Yang, M., Ling, J., Li, T., Yu, C., Jiang, H., & Pan, T. (2025). Effects of the Wheat Crab Model and the Pond Culture Model on the Growth, Metabolism and Intestinal Microbiota of the Chinese Mitten Crab (Eriocheir sinensis). Microorganisms, 13(10), 2396. https://doi.org/10.3390/microorganisms13102396

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop