Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Bacterial Counting, Isolation, and Identification of E.coli
2.3. Antibiotic Susceptibility Test
2.4. Detection of Antibiotic Resistance Genes
2.5. Statistical Analysis
3. Results and Discussion
3.1. E. coli Concentrations in Feces
3.2. Antibiotic Susceptibility Test
3.3. Profiling of AR-EC Multidrug Resistance
3.4. Detection of Antibiotic-Resistant Genes
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Primer | Sequence | Product Size (bp) | Reference | Amplification Program |
---|---|---|---|---|---|
uidA | F | TGGTAATTACCGACGAAAACGGC | 162 | [10] | Initial denaturation: 95 °C, 3 min Denaturation: 95 °C, 30 s Annealing: 58 °C, 30 s Elongation: 72 °C, 1 min 35 cycles Final extension: 74 °C, 10 min |
R | ACGCGTGGTTACAGTCTTGCG | ||||
blaCTX-M-1 | F | TTAGGAARTGTGCCGCTGYA | 688 | [13] | Initial denaturation: 94 °C, 10 min Denaturation: 94 °C, 40 s Annealing: 60 °C, 40 s Elongation: 72 °C, 1 min 30 cycles Final extension: 72 °C, 1 min |
R | CGATATCGTTGGTGGTRCCAT | ||||
blaCTX-M-2 | F | CGTTAACGGCACGATGAC | 404 | ||
R | CGATATCGTTGGTGGTRCCAT | ||||
blaCTX-M-8 | F | AACRCRCAGACGCTCTAC | 326 | ||
R | TCGAGCCGGAASGTGTYAT | ||||
blaCTX-M-9 | F | TCAAGCCTGCCGATCTGGT | 561 | ||
R | TGATTCTCGCCGCTGAAG | ||||
blaTEM | F | CATTTCCGTGTCGCCCTTATTC | 800 | ||
R | CGTTCATCCATAGTTGCCTGAC | ||||
tetA | F | TTGGCATTCTGCATTCACTC | 494 | [14] | Initial denaturation: 95 °C, 2 min Denaturation: 96 °C, 30 s Annealing: 60 °C, 30 s Elongation: 72 °C, 30 s 30 cycles Final extension: 72 °C, 10 min |
R | GTATAGCTTGCCGGAAGTCG | ||||
tetB | F | CAGTGCTGTTGTTGTCATTAA | 571 | ||
R | GCTTGGAATACTGAGTGTAA | ||||
tetD | F | GCAAACCATTACGGCATTCT | 546 | ||
R | GATAAGCTGCGCGGTAAAAA | ||||
tetE | F | TATTAACGGGCTGGCATTTC | 544 | ||
R | AGCTGTCAGGTGGGTCAAAC | ||||
tetM | F | ACACGCCAGGACATATGGAT | 536 | ||
R | ATTTCCGCAAAGTTCAGACG | ||||
tetW | F | GGGAAATTGTTCGGACAGAC | 549 | ||
R | AACGGATACCATCCCTGACA | ||||
tetC | F | GCGGGATATCGTCCATTCCG | 207 | [15] | Initial denaturation: 94 °C, 5 min Denaturation: 94 °C, 5 s Annealing: 68 °C, 10 s 25 cycles Final extension: 68 °C, 7 min |
R | GCGTAGAGGATCCACAGGACG | ||||
tetG | F | GCAGAGCAGGTCGCTGG | 134 | ||
R | CCYGCAAGAGAAGCCAGAAG | ||||
tetJ | F | CGAAAACAGACTCGCCAATC | 184 | ||
R | TCCATAATGAGGTGGGGC |
References
- World Health Organization (WHO). Antimicrobial Resistance. 2023. Available online: https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance (accessed on 1 May 2024).
- O’Neill, J.I.M. Antimicrobial resistance: Tackling a crisis for the health and wealth of nations. Rev. Antimicrob. Resist. 2014. Available online: https://amr-review.org/sites/default/files/AMR%20Review%20Paper%20-%20Tackling%20a%20crisis%20for%20the%20health%20and%20wealth%20of%20 (accessed on 1 May 2024).
- Bishop, M. Global disruption of antibiotic-resistant bacteria. Public health post, 2017. Available online: https://www.publichealthpost.org/databyte/antibiotic-resistant-bacteria/ (accessed on 1 May 2024).
- Mulchandani, R.; Wang, Y.; Gilbert, M.; Van Boeckel, T.P. Global trends in antimicrobial use in food-producing animals: 2020 to 2030. PLOS Glob. Public Health 2023, 3, e0001305. [Google Scholar] [CrossRef] [PubMed]
- Nippon AMR one health report (NAOR 2022) JVARM. 2022. Available online: https://amr-onehealth.ncgm.go.jp/en/ (accessed on 1 May 2024).
- Asai, T. Antimicrobial resistance monitoring program in food-producing animals in Japan. J. Vet. Epidemiol. 2008, 12, 93–98. [Google Scholar] [CrossRef]
- Fujimoto, K.; Kawasaki, M.; Abe, R.; Yokoyama, T.; Haga, T.; Sugiura, K. Establishing defined daily doses (DDDs) for antimicrobial agents used in pigs, cattle, and poultry in Japan and comparing them with European DDD values. PLoS ONE 2021, 16, e0245105. [Google Scholar] [CrossRef] [PubMed]
- Sawant, A.A.; Hegde, N.V.; Straley, B.A.; Donaldson, S.C.; Love, B.C.; Knabel, S.J.; Jayarao, B.M. Antimicrobial-resistant enteric bacteria from dairy cattle. Appl. Environ. Microbiol. 2007, 73, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention (CDC). Antibiotic Resistance Threats in the United States, 2019; U.S. Department of Health and Human Services, CDC: Atlanta, GA, USA, 2019. [Google Scholar]
- Suzuki, Y.; Hiroki, H.; Xie, H.; Nishiyama, M.; Sakamoto, S.H.; Uemura, R.; Nukazawa, K.; Ogura, Y.; Watanabe, T.; Kobayashi, I. Antibiotic-resistant Escherichia coli isolated from dairy cows and their surrounding environment on a livestock farm practicing prudent antimicrobial use. Int. J. Hyg. Environ. Health 2022, 240, 113930. [Google Scholar] [CrossRef] [PubMed]
- Bej, A.K.; Steffan, R.J.; DiCesare, J.; Haff, L.; Atlas, R.M. Detection of coliform bacteria in water by polymerase chain reaction and gene probes. Appl. Environ. Microbiol. 1990, 56, 307–314. [Google Scholar] [CrossRef] [PubMed]
- Clinical Laboratory Standard Institute. Performance Standards for Antimicrobial Susceptibility Testing. 2023, Volume 2023. Available online: http://em100.edaptivedocs.net/ (accessed on 1 May 2024).
- Dallenne, C.; Da Costa, A.D.; Decré, D.; Favier, C.; Arlet, G. Development a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
- Call, D.R.; Bakko, M.K.; Krug, M.J.; Roberts, M.C. Identifying antimicrobial resistance genes with DNA microarrays. Antimicrob. Agents Chemother. 2003, 47, 3290–3295. [Google Scholar] [CrossRef]
- Aminov, R.I.; Chee-Sanford, J.C.; Garrigues, N.; Teferedegne, B.; Krapac, I.J.; White, B.A.; Mackie, R.I. Development, validation, and application of PCR primers for detection of tetracycline efflux genes of Gram-negative bacteria. Appl. Environ. Microbiol. 2002, 68, 1786–1793. [Google Scholar] [CrossRef]
- Bogaard, A.E.; Stobberingh, E.E. Epidemiology of resistance to antibiotics. Links between animals and humans. Int. J. Antimicrob. Agents 2000, 14, 327–335. [Google Scholar] [CrossRef]
- Sayah, R.S.; Kaneene, J.B.; Johnson, Y.; Miller, R. Patterns of antimicrobial resistance observed in Escherichia coli isolates obtaind from domestic- and wild-animal fecal samples, human septage, and surface water. Appl. Environ. Microbiol. 2005, 71, 1394–1404. [Google Scholar] [CrossRef] [PubMed]
- Sobur, M.A.; Sabuj, A.A.M.; Sarker, R.; Rahman, A.M.M.T.; Kabir, S.M.L.; Rahman, M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World 2019, 12, 984–993. [Google Scholar] [CrossRef] [PubMed]
- Cheney, T.E.; Smith, R.P.; Hutchinson, J.P.; Brunton, L.A.; Pritchard, G.; Teale, C.J. Cross-sectional survey of antibiotic resistance in Escherichia coli isolated from diseased farm livestock in England and Wales. Epidemiol. Infect. 2015, 143, 2653–2659. [Google Scholar] [CrossRef] [PubMed]
- Hennessey, M.; Whatford, L.; Payne-Gifford, S.; Johnson, K.F.; Van Winden, S.; Barling, D.; Häsler, B. Antimicrobial & antiparasitic use and resistance in British sheep and cattle: A systematic review. Prev. Vet. Med. 2020, 185, 105174. [Google Scholar]
- Morris, C.; Wickramasingha, D.; Abdelfattah, E.M.; Pereira, R.V.; Okello, E.; Maier, G. Prevalence of antimicrobial resistance in fecal Escherichia coli and Enterococcus spp. isolates from beef cow-calf operations in northern California and associations with farm practices. Front. Microbiol. 2023, 14, 1086203. [Google Scholar] [CrossRef] [PubMed]
- Surette, M.D.; Wright, G.D. Lessons from the environmental antibiotic resistome. Annu. Rev. Microbiol. 2017, 71, 309–329. [Google Scholar] [CrossRef] [PubMed]
- Schmid, A.; Hörmansdorfer, S.; Messelhäusser, U.; Käsbohrer, A.; Sauter-Louis, C.; Mansfeld, R. Prevalence of Extended-spectrum-βlactamase-producing Escherichia coli on Bavarian dairy and beef cattle farms. Appl. Environ. Microbiol. 2013, 79, 3027–3032. [Google Scholar] [CrossRef] [PubMed]
- Wilson, J.B.; McEwen, S.A.; Clarke, R.C.; Leslie, K.E.; Wilson, R.A.; Waltner-Toews, D.; Gyles, C.L. Distribution and characteristics of verocytotoxigenic Escherichia coli isolated from Ontario dairy cattle. Epidemiol. Infect. 1992, 108, 423–439. [Google Scholar] [CrossRef]
- Call, D.R.; Davis, M.A.; Sawant, A.A. Antimicrobial resistance in beef and dairy cattle production. Anim. Health Res. Rev. 2008, 9, 159–167. [Google Scholar] [CrossRef]
- National Action Plan on Antimicrobial Resistance (AMR), 2023–2027. 2023. Available online: https://www.mhlw.go.jp/content/10900000/001096228.pdf (accessed on 1 May 2024).
- Yamamoto, S.; Iwabuchi, E.; Hasegawa, M.; Esaki, H.; Muramatsu, M.; Hirayama, N.; Hirai, K. Prevalence and molecular epidemiological characterization of antimicrobial-resistant Escherichia coli isolates from Japanese black beef cattle. J. Food Prot. 2013, 76, 394–404. [Google Scholar] [CrossRef]
- Wagner, B.A.; Dargatz, D.A.; Salman, M.D.; Morley, P.S.; Wittum, T.E.; Keefe, T.J. Comparison of sampling techniques for measuring the antimicrobial susceptibility of enteric Escherichia coli recovered from feedlot cattle. Am. J. Vet. Res. 2002, 63, 1662–1670. [Google Scholar] [CrossRef] [PubMed]
- Carson, C.A.; Reid-Smith, R.; Irwin, R.J.; Martin, W.S.; McEwen, S.A. Antimicrobial resistance in generic fecal Escherichia coli from 29 beef farms in Ontario. Can. J. Vet. Res. 2008, 72, 119–128. [Google Scholar] [PubMed]
- Lim, S.K.; Lee, H.S.; Nam, H.M.; Cho, Y.S.; Kim, J.M.; Song, S.W.; Park, Y.H.; Jung, S.C. Antimicrobial resistance observed in Escherichia coli strains isolated from fecal samples of cattle and pigs in Korea during 2003–2004. Int. J. Food Microbiol. 2007, 116, 283–286. [Google Scholar] [CrossRef] [PubMed]
- Gow, S.P.; Waldner, C.L.; Rajić, A.; McFall, M.E.; Reid-Smith, R. Prevalence of antimicrobial resistance in fecal generic Escherichia coli isolated in western Canadian beef herds. Part II. Cows and cow-calf pairs. Can. J. Vet. Res. 2008, 72, 91–100. [Google Scholar] [PubMed]
- Khachatryan, A.R.; Hancock, D.D.; Besser, T.E.; Call, D.R. Role of calf-adapted Escherichia coli in maintenance of antimicrobial drug resistance in dairy calves. Appl. Environ. Microbiol. 2004, 70, 752–757. [Google Scholar] [CrossRef]
- Poirel, L.; Madec, J.Y.; Lupo, A.; Schink, A.K.; Kieffer, N.; Nordmann, P.; Schwarz, S. Antimicrobial resistance in Escherichia coli. Microbiol. Spec. 2018, 6, ARBA-0026. [Google Scholar] [CrossRef]
- Braun, S.D.; Ahmed, M.F.E.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Weiß, D.; Monecke, S.; Ehricht, R. Surveillance of extended-spectrum beta-lactamase producing Escherichia coli in dairy cattle farms in the Nile Delta, Egypt. Front. Microbiol. 2016, 7, 1020. [Google Scholar] [CrossRef]
- Ohnishi, M.; Sawada, T.; Harada, K.; Esaki, H.; Shimura, K.; Marumo, K.; Takahashi, T. Occurrence of bovine mastitis caused by CTX-M-2 β-lactamase producing Klebsiella pneumoniae. J. Vet. Epidemol 2012, 16, 142–147. [Google Scholar] [CrossRef]
- Yue, S.; Zhang, Z.; Liu, Y.; Zhou, Y.; Wu, C.; Huang, W.; Chen, N.; Zhu, Z. Phenotypic and molecular characterizations of multidrug-resistant diarrheagenic, E. coli of calf origin. Anim. Dis. 2021, 1, 14. [Google Scholar] [CrossRef]
Name | CTX | CAZ | CPX | ABP | CXM | CFX | IPM | AZT | ACV | T/P | ST | GM | AMK | CIP | TC | TGC | FOM | CP | Injection History |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
B1 (n = 40) | 0 | 0 | 0 | 15.0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 15.0 | 0 | 0 | 25.0 | 0 | 0 | 7.5 | - |
B2 (n = 21) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
B3 (n = 40) | 0 | 0 | 0 | 15.0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12.5 | 0 | 0 | 20.0 | 0 | 0 | 12.5 | - |
B4 (n = 36) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | - |
B5 (n = 15) | 6.7 | 0 | 0 | 46.7 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 46.7 | 0 | 0 | 46.7 | 0 | 0 | 46.7 | - |
D1 (n = 102) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.8 | 0 | 0 | 0 | C |
D2 (n = 94) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | SE, P |
D3 (n = 87) | 0 | 0 | 0 | 1.1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | SE, PK, P, CXM, C |
D4 (n = 101) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.0 | 0 | 0 | 0 | 0 | 0 | SE, P, CXM |
D5 (n = 60) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | P, C, PK |
D6 (n = 86) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2.3 | 0 | 0 | 0 | 0 | SE, SL, P |
D7 (n = 110) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | SE, P |
D8 (n = 78) | 0 | 0 | 0 | 6.4 | 0 | 0 | 0 | 0 | 0 | 1.3 | 5.1 | 5.1 | 0 | 0 | 6.4 | 0 | 0 | 0 | - |
D9 (n = 106) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.9 | 0 | 0 | 0 | 0 | SE, PK, C |
D10 (n = 60) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1.7 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | SE, C |
DCs (n = 884) | 0 | 0 | 0 | 4.6 | 0.7 | 0 | 0 | 0 | 0 | 1.3 | 2.6 | 0 | 3.3 | 2.6 | 11.2 | 0 | 0 | 0 | |
BC (n = 152) | 0 | 0.7 | 0 | 12.5 | 0.0 | 0 | 0 | 0 | 0 | 0 | 0 | 11.8 | 0 | 0 | 16.5 | 0 | 0 | 9.9 |
Name | BC | DCs | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Oct-22 | Nov-22 | Dec-22 | Jan-23 | Oct-22 | Nov-22 | Dec-22 | Jan-23 | Apr-23 | May-23 | Jun-23 | Jul-23 | Aug-23 | Sep-23 | Nov-23 | |
n = 36 | n = 46 | n = 40 | n = 30 | n = 100 | n = 100 | n = 90 | n = 97 | n = 81 | n = 52 | n = 80 | n = 80 | n = 64 | n = 74 | n = 66 | |
CTX | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
CAZ | 0 | 2.2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
CPX | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
ABP | 22.2 | 23.9 | 0 | 0 | 1 | 1 | 1.1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6.1 |
CXM | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
CFX | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
IPM | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
AZT | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
ACV | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
T/P | 0 | 0 | 0 | 0 | 0 | 0 | 1.1 | 0 | 0 | 1.9 | 0 | 0 | 0 | 0 | 0 |
ST | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 6.1 |
GM | 19.4 | 23.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
AMK | 0 | 0 | 0 | 0 | 1.0 | 0 | 3.3 | 0 | 0 | 0 | 0 | 0 | 1.6 | 0 | 0 |
CIP | 0 | 0 | 0 | 0 | 2.0 | 0 | 1.1 | 0 | 0 | 0 | 0 | 0 | 0.0 | 0 | 0 |
TC | 27.8 | 32.6 | 0 | 0 | 3 | 0 | 0 | 0 | 1.2 | 15.4 | 0 | 0 | 1.6 | 0 | 6.1 |
TGC | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
FOM | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
CP | 8.3 | 23.9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Antibiogram Patterns | Number of Isolates | Percentage of Resistance (%) | |
---|---|---|---|
BC | TC | 6 | 3.9 |
(n = 152) | CAZ | 1 | 0.7 |
ABP + GM + TC | 18 | 11.8 | |
ABP + TC + CP | 2 | 1.3 | |
ABP + GM + TC + CP | 14 | 9.2 | |
DCs | TC | 13 | 1.5 |
(n = 884) | CIP | 4 | 0.5 |
AMK | 4 | 0.5 | |
ABP | 1 | 0.1 | |
T/P | 1 | 0.1 | |
ABP + ST + TC | 4 | 0.5 | |
ABP + T/P + AMK | 1 | 0.1 |
Name | BC | DCs | ||||||
---|---|---|---|---|---|---|---|---|
B1 (n = 6) | B3 (n = 6) | B5 (n = 7) | Total (n = 19) | D1 (n = 0) | D3 (n = 2) | D8 (n = 5) | Total (n = 7) | |
blaCTX-M-1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaTEM | 5 (83.3%) | 6 (100%) | 5 (71.4%) | 16 (84.2%) | 0 | 0 | 3 (60%) | 3(42.8) |
n = 10 | n = 8 | n = 7 | n = 25 | n = 12 | n = 0 | n = 5 | n = 17 | |
tetA | 0 | 0 | 0 | 0 | 8 (66.7%) | 0 | 4 (80%) | 12 (70.6%) |
tetB | 5 (50%) | 2 (25%) | 7 (28%) | 0 | 0 | 0 | 0 | |
tetC | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetD | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetE | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetG | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetJ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetM | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetW | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Name | BC | DCs | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Oct-22 | Nov-22 | Dec-22 | Jan-23 | Oct-22 | Nov-22 | Dec-22 | Jan-23 | Apr-23 | May-23 | Jun-23 | Jul-23 | Aug-23 | Sep-23 | Nov-23 | |
n = 8 | n = 11 | n = 0 | n = 0 | n = 1 | n = 1 | n = 1 | n = 0 | n = 0 | n = 0 | n = 0 | n = 0 | n = 0 | n = 0 | n = 4 | |
blaCTX-M-1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaCTX-M-9 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
blaTEM | 7 (87.5%) | 9 (81.8%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 (75%) |
n = 10 | n = 15 | n = 0 | n = 0 | n = 3 | n = 0 | n = 0 | n = 0 | n = 1 | n = 8 | n = 0 | n = 0 | n = 1 | n = 0 | n = 4 | |
tetA | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 8 (100%) | 0 | 0 | 0 | 0 | 3 (75%) |
tetB | 3 (30%) | 4 (26.7%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetC | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetD | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetE | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetG | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetJ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetM | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
tetW | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khishigtuya, T.; Matsuyama, H.; Suzuki, K.; Watanabe, T.; Nishiyama, M. Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms 2024, 12, 1342. https://doi.org/10.3390/microorganisms12071342
Khishigtuya T, Matsuyama H, Suzuki K, Watanabe T, Nishiyama M. Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms. 2024; 12(7):1342. https://doi.org/10.3390/microorganisms12071342
Chicago/Turabian StyleKhishigtuya, Tumurbaatar, Hiroki Matsuyama, Kazuhito Suzuki, Toru Watanabe, and Masateru Nishiyama. 2024. "Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan" Microorganisms 12, no. 7: 1342. https://doi.org/10.3390/microorganisms12071342
APA StyleKhishigtuya, T., Matsuyama, H., Suzuki, K., Watanabe, T., & Nishiyama, M. (2024). Prevalence of Antibiotic-Resistant Escherichia coli Isolated from Beef Cattle and Dairy Cows in a Livestock Farm in Yamagata, Japan. Microorganisms, 12(7), 1342. https://doi.org/10.3390/microorganisms12071342