Determination of Technological Properties and CRISPR Profiles of Streptococcus thermophilus Isolates Obtained from Local Yogurt Samples
Abstract
1. Introduction
1.1. Protease (prtS Gene)
1.2. Urease (ureC Gene)
1.3. Glutamate Dehydrogenase (gdh Gene)
1.4. Cold Shock Proteins (csp)
1.5. Competence Frequency (cox Gene)
2. Materials and Methods
2.1. Microbial Analyses
2.1.1. Isolation of S. Thermophilus Isolates
2.1.2. Acid-Production Ability
2.1.3. Proteolytic and Lipolytic Activity
2.1.4. Antimicrobial Activity
2.2. Genetic Analysis
2.2.1. CRISPR Profiles of the Isolates
2.2.2. Technologically Important Proteins of the Isolates
3. Results
3.1. Microbial Analyses
3.1.1. Isolation of S. thermophilus Isolates
3.1.2. Acid-Production Ability
3.1.3. Proteolytic and Lipolytic Activity
3.1.4. Antimicrobial Activity
3.2. Genetic Analysis
3.2.1. CRISPR Profiles of the Isolates
3.2.2. Technologically Important Proteins of the Isolates
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shi, A.; Fan, F.; Broach, J.R. Microbial adaptive evolution. J. Ind. Microbiol. Biotechnol. 2021, 49, kuab076. [Google Scholar] [CrossRef]
- Whitehead, H.R.; Cox, G.A. The Occurrence of Bacteriophage in Cultures of Lactic Streptococci: A Preliminary Note; Government Printer: Wellington, NZ, USA, 1935; pp. 319–320.
- Sturino, J.M.; Klaenhammer, T.R. Antisense RNA Targeting of Primase Interferes with Bacteriophage Replication in Streptococcus thermophilus. Appl. Environ. Microbiol. 2004, 70, 1735–1743. [Google Scholar] [CrossRef] [PubMed]
- Sturino, J.M.; Klaenhammer, T.R. Engineered bacteriophage-defence systems in bioprocessing. Nat. Rev. Microbiol. 2006, 4, 395–404. [Google Scholar] [CrossRef] [PubMed]
- Deveau, H.; Barrangou, R.; Garneau, J.E.; Labonte, J.; Fremaux, C.; Boyaval, P.; Romero, D.A.; Horvath, P.; Moineau, S. Phage Response to CRISPR-Encoded Resistance in Streptococcus thermophilus. J. Bacteriol. 2007, 190, 1390–1400. [Google Scholar] [CrossRef] [PubMed]
- McDonnell, B.; Mahony, J.; Hanemaaijer, L.; Kouwen, T.R.H.M.; Van Sinderen, D. Generation of Bacteriophage-Insensitive Mutants of Streptococcus thermophilus via an Antisense RNA CRISPR-Cas Silencing Approach. Appl. Environ. Microbiol. 2017, 84, e01733-17. [Google Scholar] [CrossRef]
- Ishino, Y.; Shinagawa, H.; Makino, K.; Amemura, M.; Nakata, A. Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J. Bacteriol. 1987, 169, 5429–5433. [Google Scholar] [CrossRef] [PubMed]
- Ishino, Y.; Krupovic, M.; Forterre, P. History of CRISPR-Cas from Encounter with a Mysterious Repeated Sequence to Genome Editing Technology. J. Bacteriol. 2018, 200, e00580-17. [Google Scholar] [CrossRef]
- Godde, J.S.; Bickerton, A. The repetitive DNA elements called CRISPRs and their associated genes: Evidence of horizontal transfer among prokaryotes. J. Mol. Evol. 2006, 62, 718–729. [Google Scholar] [CrossRef]
- Jansen, R.; Van Embden, J.D.A.; Gaastra, W.; Schouls, L.M. Identification of genes that are associated with DNA repeats in prokaryotes. Mol. Microbiol. 2002, 43, 1565–1575. [Google Scholar] [CrossRef]
- Makarova, K.S.; Wolf, Y.I.; Alkhnbashi, O.S.; Costa, F.; Shah, S.A.; Saunders, S.J.; Barrangou, R.; Brouns, S.J.J.; Charpentier, E.; Haft, D.H.; et al. An updated evolutionary classification of CRISPR–Cas systems. Nat. Rev. Microbiol. 2015, 13, 722–736. [Google Scholar] [CrossRef] [PubMed]
- Forde, B.M.; Neville, B.A.; Donnell, M.M.O.; Riboulet-Bisson, E.; Claesson, M.J.; Coghlan, A.; Ross, R.P.; Toole, P.W.O. Genome sequences and comparative genomics of two Lactobacillus ruminis strains from the bovine and human intestinal tracts. Microb. Cell Factories 2011, 10, S13. [Google Scholar] [CrossRef] [PubMed]
- Barrangou, R.; Marraffini, L.A. CRISPR-CAS Systems: Prokaryotes upgrade to adaptive immunity. Mol. Cell 2014, 54, 234–244. [Google Scholar] [CrossRef] [PubMed]
- Beauruelle, C.; Treluyer, L.; Pastuszka, A.; Cochard, T.; Lier, C.; Mereghetti, L.; Glaser, P.; Poyart, C.; Lanotte, P. CRISPR Typing Increases the Discriminatory Power of Streptococcus agalactiae Typing Methods. Front. Microbiol. 2021, 12, 675597. [Google Scholar] [CrossRef] [PubMed]
- Quiberoni, A.; Moineau, S.; Rousseau, G.M.; Reinheimer, J.; Ackermann, H.-W. Streptococcus thermophilus bacteriophages. Int. Dairy J. 2010, 20, 657–664. [Google Scholar] [CrossRef]
- Horvath, P.; Romero, D.A.; CouTé-Monvoisin, A.-C.; Richards, M.; Deveau, H.; Moineau, S.; Boyaval, P.; Fremaux, C.; Barrangou, R. Diversity, Activity, and Evolution of CRISPR Loci in Streptococcus thermophilus. J. Bacteriol. 2007, 190, 1401–1412. [Google Scholar] [CrossRef]
- Haft, D.H.; Selengut, J.; Mongodin, E.F.; Nelson, K.E. A guild of 45 CRISPR-Associated (CAS) protein families and multiple CRISPR/CAS subtypes exist in prokaryotic genomes. PLoS Comput. Biol. 2005, 1, e60. [Google Scholar] [CrossRef]
- Makarova, K.S.; Grishin, N.V.; Shabalina, S.A.; Wolf, Y.I.; Koonin, E.V. A putative RNA-interference-based immune system in prokaryotes: Computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol. Direct 2006, 1, 7. [Google Scholar] [CrossRef]
- Makarova, K.S.; Haft, D.H.; Barrangou, R.; Brouns, S.J.J.; Charpentier, E.; Horvath, P.; Moineau, S.; Mojica, F.J.M.; Wolf, Y.I.; Yakunin, A.F.; et al. Evolution and classification of the CRISPR–Cas systems. Nat. Rev. Microbiol. 2011, 9, 467–477. [Google Scholar] [CrossRef]
- Pinilla-Redondo, R.; Russel, J.; Mayo-Muñoz, D.; Shah, S.A.; Garrett, R.A.; Nesme, J.; Madsen, J.S.; Fineran, P.C.; Sørensen, S.J. CRISPR-Cas systems are widespread accessory elements across bacterial and archaeal plasmids. Nucleic Acids Res. 2021, 50, 4315–4328. [Google Scholar] [CrossRef]
- Alexandraki, V.; Kazou, M.; Blom, J.; Pot, B.; Papadimitriou, K.; Tsakalidou, E. Comparative Genomics of Streptococcus thermophilus Support Important Traits Concerning the Evolution, Biology and Technological Properties of the Species. Front. Microbiol. 2019, 10, 2916. [Google Scholar] [CrossRef]
- Bonham, K.S.; Wolfe, B.E.; Dutton, R.J. Extensive horizontal gene transfer in cheese-associated bacteria. eLife 2017, 6, e22144. [Google Scholar] [CrossRef] [PubMed]
- Plavec, T.V.; Berlec, A. Safety aspects of genetically modified lactic acid bacteria. Microorganisms 2020, 8, 297. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.; Nethery, M.A.; Hidalgo-Cantabrana, C.; Barrangou, R. Comprehensive mining and characterization of CRISPR-CAS systems in bifidobacterium. Microorganisms 2020, 8, 720. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Tun, H.M.; Leung, F.C.-C.; Shah, N.P. Genomic insights into high exopolysaccharide-producing dairy starter bacterium Streptococcus thermophilus ASCC 1275. Sci. Rep. 2014, 4, 4974. [Google Scholar] [CrossRef] [PubMed]
- Horvath, P.; Barrangou, R. CRISPR/CAS, the immune system of bacteria and archaea. Science 2010, 327, 167–170. [Google Scholar] [CrossRef] [PubMed]
- Kunji, E.R.S.; Mierau, I.; Hagting, A.; Poolman, B.; Konings, W.N. The proteotytic systems of lactic acid bacteria. Antonie Van Leeuwenhoek 1996, 70, 187–221. [Google Scholar] [CrossRef]
- Mora, D.; Fortina, M.G.; Parini, C.; Ricci, G.; Gatti, M.; Giraffa, G.; Manachini, P.L. Genetic diversity and technological properties of Streptococcus thermophilus strains isolated from dairy products. J. Appl. Microbiol. 2002, 93, 278–287. [Google Scholar] [CrossRef]
- Mora, D.; Maguin, E.; Masiero, M.; Parini, C.; Ricci, G.; Manachini, P.L.; Daffonchio, D. Characterization of urease genes cluster of Streptococcus thermophilus. J. Appl. Microbiol. 2003, 96, 209–219. [Google Scholar] [CrossRef]
- Mora, D.; Monnet, C.; Parini, C.; Guglielmetti, S.; Mariani, A.; Pintus, P.; Molinari, F.; Daffonchio, D.; Manachini, P.L. Urease biogenesis in Streptococcus thermophilus. Res. Microbiol. 2005, 156, 897–903. [Google Scholar] [CrossRef]
- De Cadiñanos, L.P.G.; Peláez, C.; Martínez-Cuesta, M.C.; García-Cayuela, T.; Requena, T. Identification and characterization of glutamate dehydrogenase activity in wild Lactococcus lactis isolated from raw milk cheeses. Eur. Food Res. Technol. 2017, 244, 603–609. [Google Scholar] [CrossRef]
- Wouters, J.A.; Rombouts, F.M.; De Vos, W.M.; Kuipers, O.P.; Abee, T. Cold Shock Proteins and Low-Temperature Response of Streptococcus thermophilus CNRZ302. Appl. Environ. Microbiol. 1999, 65, 4436–4442. [Google Scholar] [CrossRef] [PubMed]
- Yazdiç, F.C.; Karaman, A.; Akyol, İ.; Ekinci, M.S.; Özköse, E. Doğal Streptococcus thermophilus İzolatlarında comX Gen Varlığına Bağlı DNA Transfer Frekansının Belirlenmesi. Selçuk Üniversitesi Fen Fakültesi Fen Derg. 2018, 44, 9–23. [Google Scholar]
- Bulut, C.; Gunes, H.; Okuklu, B.; Harsa, S.; Kilic, S.; Coban, H.S.; Yenidunya, A.F. Homofermentative lactic acid bacteria of a traditional cheese, Comlek peyniri from Cappadocia region. J. Dairy Res. 2005, 72, 19–24. [Google Scholar] [CrossRef] [PubMed][Green Version]
- De Almeida Júnior, W.L.G.; Da Silva Ferrari, Í.; De Souza, J.V.; Da Silva, C.D.A.; Da Costa, M.M.; Dias, F.S. Characterization and evaluation of lactic acid bacteria isolated from goat milk. Food Control 2015, 53, 96–103. [Google Scholar] [CrossRef]
- Ateşlier, Z.B.B.; Metin, K. Production and partial characterization of a novel thermostable esterase from a thermophilic Bacillus sp. Enzym. Microb. Technol. 2005, 38, 628–635. [Google Scholar] [CrossRef]
- Akpinar, A.; Yerlikaya, O.; Kiliccedil, S. Antimicrobial activity and antibiotic resistance of Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus thermophilus strains isolated from Turkish homemade yoghurts. Afr. J. Microbiol. Res. 2011, 5, 675–682. [Google Scholar]
- Courtin, P.; Monnet, V.; Rul, F. Cell-wall proteinases PrtS and PrtB have a different role in Streptococcus thermophilus/Lactobacillus bulgaricus mixed cultures in milk. Microbiology 2002, 148, 3413–3421. [Google Scholar] [CrossRef][Green Version]
- Quero, G.M.; Fusco, V.; Cocconcelli, P.S.; Owczarek, L.; Borcakli, M.; Fontana, C.; Skapska, S.; Jasinska, U.T.; Ozturk, T.; Morea, M. Microbiological, physico-chemical, nutritional and sensory characterization of traditional Matsoni: Selection and use of autochthonous multiple strain cultures to extend its shelf-life. Food Microbiol. 2013, 38, 179–191. [Google Scholar] [CrossRef]
- Tanous, C.; Kieronczyk, A.; Helinck, S.; Chambellon, E.; Yvon, M. Glutamate dehydrogenase activity: A major criterion for the selection of flavour-producing lactic acid bacteria strains. In Lactic Acid Bacteria: Genetics, Metabolism and Applications; Springer: Dordrecht, The Netherlands, 2002; pp. 271–278. [Google Scholar] [CrossRef]
- Siddiqui, S.A.; Erol, Z.; Rugji, J.; Taşçı, F.; Kahraman, H.A.; Toppi, V.; Musa, L.; Di Giacinto, G.; Bahmid, N.A.; Mehdizadeh, M.; et al. An overview of fermentation in the food industry—Looking back from a new perspective. Bioresour. Bioprocess 2023, 10, 85. [Google Scholar] [CrossRef]
- Caplice, E.; Fitzgerald, G.F. Food fermentations: Role of microorganisms in food production and preservation. Int. J. Food. Microbiol. 1999, 50, 131–149. [Google Scholar] [CrossRef]
- Ji, W.; Lee, D.; Wong, E.; Dadlani, P.; Dinh, D.; Huang, V.; Kearns, K.; Teng, S.; Chen, S.; Haliburton, J.; et al. Specific Gene Repression by CRISPRi System Transferred through Bacterial Conjugation. ACS Synth. Biol. 2014, 3, 929–931. [Google Scholar] [CrossRef]
- De Brabandere, A.G.; De Baerdemaeker, J.G. Effects of process conditions on the pH development during yogurt fermentation. J. Food Eng. 1999, 41, 221–227. [Google Scholar] [CrossRef]
- Uzunsoy, I.; Budak, S.O.; Sanli, T.; Taban, B.; Aytac, A.; Yazihan, N.; Bas, A.L.; Ozer, B. Observation of the Suitability of Single Strains of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus Isolated from Local Dairy Sources in Turkey as Yogurt Starter Combinations. J. Microbiol. Biotechnol. Food Sci. 2023, 13, e9241. [Google Scholar] [CrossRef]
- Zotta, T.; Ricciardi, A.; Rossano, R.; Parente, E. Urease production by Streptococcus thermophilus. Food Microbiol. 2007, 25, 113–119. [Google Scholar] [CrossRef] [PubMed]
- Fontaine, L.; Boutry, C.; De Frahan, M.H.; Delplace, B.; Fremaux, C.; Horvath, P.; Boyaval, P.; Hols, P. A Novel Pheromone Quorum-Sensing System Controls the Development of Natural Competence in Streptococcus thermophilus and Streptococcus salivarius. J. Bacteriol. 2009, 192, 1444–1454. [Google Scholar] [CrossRef]
- Goh, Y.J.; Goin, C.; O’Flaherty, S.; Altermann, E.; Hutkins, R. Specialized adaptation of a lactic acid bacterium to the milk environment: The comparative genomics of Streptococcus thermophilus LMD-9. Microb. Cell Factories 2011, 10, S22. [Google Scholar] [CrossRef]
- Kim, W.S.; Dunn, N.W. Identification of a cold shock gene in lactic acid bacteria and the effect of cold shock on cryotolerance. Curr. Microbiol. 1997, 35, 59–63. [Google Scholar] [CrossRef]
- Woufers, J.A.; Sander, J.-W.; Kok, J.; De Vos, W.M.; Kuipers, O.P.; Abee, T. Clustered organization and transcriptional analysis of a family of five csp genes of Lactococcus/actis MGl363. Microbiology 1998, 144, 2885–2893. [Google Scholar] [CrossRef]
- Weissman, J.L.; Laljani, R.M.R.; Fagan, W.F.; Johnson, P.L.F. Visualization and prediction of CRISPR incidence in microbial trait-space to identify drivers of antiviral immune strategy. ISME J. 2019, 13, 2589–2602. [Google Scholar] [CrossRef]
- Wang, S.; Yang, B.; Ross, R.P.; Stanton, C.; Zhao, J.; Zhang, H.; Chen, W. Comparative Genomics Analysis of Lactobacillus ruminis from Different Niches. Genes 2020, 11, 70. [Google Scholar] [CrossRef]
| Primer | Sequence (5′-3′) | Target Gene |
|---|---|---|
| CR1-fwd (yc70) | TGCTGAGACAACCTAGTCTCTC | CRISPR I |
| CR1-rev | TAAACAGAGCCTCCCTATCC | |
| CR2-fwd | TTAGCCCCTACCATAGTGCTG | CRISPR II |
| CR2-rev | TTAGTCTAACACTTTCTGGAAGC | |
| CR3-fwd | CTGAGATTAATAGTGCGATTACG | CRISPR III |
| CR3-rev | GCTGGATATTCGTATAACATGTC | |
| CRP4-fwd | GATTCAGTTCCTCATAGAGC | CRISPR IV |
| CRP4-rev | GACCTCAACCAATCGATTG |
| Primer Name | Amplicon Size (bp) | Primer DNA Sequence | Reference |
|---|---|---|---|
| ComXF | 497 | ATGGAACAAGAAGTTTTTGTTAAGGC | [33] |
| ComXR | TCAGTCTTCTTCATTACATGGATCAA | ||
| ureC-F | 1340 | GGGGATAGCGTACGTCTTGG | [39] |
| ureC-R | TCAGCCAGCATCACCCATAACAC | ||
| cspF | 119 | TTATTACCTCTGAAGATGG | [39] |
| cspR | ACGTTGACCTACTTCAACAT | ||
| gdhf | 1353 | TTGCCAAAGCTTCATGACTG | [39] |
| gdhr | ACATGGGAAAGCCAAGTCAG | ||
| prtsF | 1501 | GTGAGGCTTTGGCAGCTAAC | [39] |
| prtsR | TCGCGATATAGACCGGATTC |
| Isolate Number | Sampling Location |
|---|---|
| B5 | Uşak |
| B6 | Uşak |
| B8 | Uşak |
| T2.1 | Konya-Karapınar |
| T3.10 | Konya-Karapınar |
| T3.1 | Konya-Karapınar |
| T3.9 | Konya-Karapınar |
| T6.9 | Konya-Karapınar |
| T4.1 | Konya-Karapınar |
| T6.5 | Konya-Karapınar |
| T6.7 | Konya-Karapınar |
| T6.4 | Konya-Karapınar |
| T6.13 | Konya-Karapınar |
| T6.14 | Konya-Karapınar |
| T6.1 | Konya-Karapınar |
| T3.2 | Konya-Karapınar |
| Tokat 2.7 | Tokat |
| Tokat 3.7 | Tokat |
| K31 | AFYON Dinar |
| KF30 | AFYON Dinar |
| HC1.3 | AFYON Dinar |
| A142 | AFYON Dinar |
| H35 | AFYON Dinar |
| AL | AFYON Dinar |
| Isolate Number | 3 h | 6 h | 24 h |
|---|---|---|---|
| B5 | 6.09 | 5.72 | 4.7 |
| B6 | 6.29 | 5.79 | 4.5 |
| B8 | 6.28 | 5.68 | 4.41 |
| T2.1 | 6.4 | 6.18 | 4.11 |
| T3.10 | 6.4 | 6.22 | 4.58 |
| T3.1 | 6.16 | 5.46 | 4.07 |
| T3.9 | 6.28 | 5.66 | 4.18 |
| T6.9 | 6.47 | 6.3 | 5.1 |
| T4.1 | 6.42 | 6.1 | 4.11 |
| T6.5 | 6.31 | 5.83 | 4.04 |
| T6.7 | 6.34 | 5.93 | 4.08 |
| T6.4 | 6.23 | 5.65 | 4.37 |
| T6.13 | 6.32 | 6.13 | 4.72 |
| T6.14 | 6.13 | 5.52 | 4.35 |
| T6.1 | 6.22 | 5.56 | 4.04 |
| T3.2 | 6.29 | 5.85 | 4.09 |
| Tokat 2.7 | 6.08 | 5.58 | 4.5 |
| Tokat 3.7 | 6.31 | 5.86 | 4.06 |
| K31 | 6.52 | 6.16 | 3.98 |
| KF30 | 6.03 | 5.67 | 4.39 |
| HC1.3 | 6.13 | 5.67 | 4.47 |
| A142 | 6.1 | 5.58 | 4.39 |
| H35 | 5.89 | 5.44 | 4.11 |
| AL | 6.09 | 5.6 | 4.48 |
| Isolate Number | Location | CRISPR 1 | CRISPR 2 | CRISPR 3 | CRISPR 4 |
|---|---|---|---|---|---|
| B5 | Uşak | − | − | − | + |
| B6 | Uşak | − | − | + | − |
| B8 | Uşak | − | + | − | − |
| T2.1 | Konya-Karapınar | − | − | − | + |
| T3.10 | Konya-Karapınar | − | − | − | + |
| T3.1 | Konya-Karapınar | − | − | − | + |
| T3.9 | Konya-Karapınar | − | − | − | + |
| T6.9 | Konya-Karapınar | − | − | − | + |
| T4.1 | Konya-Karapınar | − | − | − | + |
| T6.5 | Konya-Karapınar | − | − | − | + |
| T6.7 | Konya-Karapınar | − | − | − | + |
| T6.4 | Konya-Karapınar | − | − | − | + |
| T6.13 | Konya-Karapınar | − | − | − | + |
| T6.14 | Konya-Karapınar | − | − | − | + |
| T6.1 | Konya-Karapınar | − | − | − | + |
| T3.2 | Konya-Karapınar | − | − | − | + |
| T2.7 | Tokat | − | − | − | + |
| T3.7 | Tokat | − | − | − | + |
| K31 | Afyon-Dinar | − | + | − | − |
| KF30 | Afyon-Dinar | − | + | − | − |
| HC1.3 | Afyon-Dinar | − | + | − | + |
| A14.2 | Afyon-Dinar | − | − | − | + |
| H35 | Afyon-Dinar | − | + | − | − |
| AL | Afyon-Dinar | − | − | − | − |
| Isolate Location, Number | CRISPR Profile | Number of Native Spacers |
|---|---|---|
| Usak, Isolate B6 | CRISPR 3 | 13 native spacer sequences |
| Konya-Karapınar, Isolate T6.7 | CRISPR 4 | 11 native spacer sequences |
| Konya-Karapınar, Isolate T6.14 | CRISPR 4 | 13 native spacer sequences |
| Konya-Karapınar, Isolate T6.9 | CRISPR 4 | 6 native spacer sequences |
| Tokat, Isolate T3.7 | CRISPR 4 | 2 native spacer sequences |
| Konya-Karapınar, Isolate T6.13 | CRISPR 4 | 9 native spacer sequences |
| Isolate Number | comx | ureC | prts | gdh | csp |
|---|---|---|---|---|---|
| B5 | − | − | + | − | − |
| B6 | − | − | + | − | − |
| B8 | − | − | + | − | − |
| T2.1 | − | − | + | − | − |
| T3.1 | − | − | + | − | − |
| T3.2 | − | − | + | − | − |
| T3.9 | − | − | + | − | − |
| T3.10 | − | − | + | − | − |
| T4.1 | − | − | + | − | − |
| T6.1 | − | − | − | − | − |
| T6.4 | + | − | − | − | − |
| T6.5 | + | − | + | − | − |
| T6.7 | + | − | − | − | |
| T6.9 | + | − | − | − | − |
| T6.13 | + | − | + | − | − |
| T3.14 | + | − | + | − | − |
| Tokat 2.7 | + | − | − | − | − |
| Tokat 3.7 | + | − | − | − | − |
| K31 | + | + | + | + | − |
| KF30 | + | − | + | − | − |
| HC1.3 | + | − | + | − | − |
| A14.2 | + | − | + | − | − |
| H35 | + | − | − | + | − |
| AL | + | − | + | − | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Coban, H.S.; Olgun, D.; Temur, İ.; Durak, M.Z. Determination of Technological Properties and CRISPR Profiles of Streptococcus thermophilus Isolates Obtained from Local Yogurt Samples. Microorganisms 2024, 12, 2428. https://doi.org/10.3390/microorganisms12122428
Coban HS, Olgun D, Temur İ, Durak MZ. Determination of Technological Properties and CRISPR Profiles of Streptococcus thermophilus Isolates Obtained from Local Yogurt Samples. Microorganisms. 2024; 12(12):2428. https://doi.org/10.3390/microorganisms12122428
Chicago/Turabian StyleCoban, Hatice Sevgi, Dicle Olgun, İnci Temur, and Muhammed Zeki Durak. 2024. "Determination of Technological Properties and CRISPR Profiles of Streptococcus thermophilus Isolates Obtained from Local Yogurt Samples" Microorganisms 12, no. 12: 2428. https://doi.org/10.3390/microorganisms12122428
APA StyleCoban, H. S., Olgun, D., Temur, İ., & Durak, M. Z. (2024). Determination of Technological Properties and CRISPR Profiles of Streptococcus thermophilus Isolates Obtained from Local Yogurt Samples. Microorganisms, 12(12), 2428. https://doi.org/10.3390/microorganisms12122428

