Prevalence, Antimicrobial Susceptibility, and Resistance Genes of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers Sold in Open Markets of Dakar, Senegal
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling, Bacterial Isolation, and Identification
2.2. Antimicrobial Susceptibility Testing and ESBL Confirmation
2.3. Detection of ESBL Resistance Genes
2.4. Statistical Analysis
3. Results
3.1. Prevalence of Extended-Spectrum β-Lactamase-Producing Escherichia coli in Broilers
3.2. Antibiotic Resistance Profile of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers
3.3. Carriage of Extended-Spectrum β-Lactamase-Encoding Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Geser, N.; Stephan, R.; Hächler, H. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res. 2012, 8, 21. [Google Scholar] [CrossRef] [PubMed]
- Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Report of the 6th Meeting of the WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance with AGISAR 5-Year Strategic Framework to Support Implementation of the Global Action Plan on Antimicrobial Resistance (2015–2019), 10–12 June 2015, Seoul, Republic of Korea [Internet]. World Health Organization; 2015. Available online: https://iris.who.int/handle/10665/190954 (accessed on 17 October 2024).
- Robinson, T.P.; Bu, D.P.; Carrique-Mas, J.; Fèvre, E.M.; Gilbert, M.; Grace, D.; Hay, S.I.; Jiwakanon, J.; Kakkar, M.; Kariuki, S.; et al. Antibiotic resistance is the quintessential One Health issue. Trans. R. Soc. Trop. Med. Hyg. 2016, 110, 377–380. [Google Scholar] [CrossRef]
- Bush, K.; Bradford, P.A. β-Lactams and β-Lactamase Inhibitors: An Overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef]
- Wilke, M.S.; Lovering, A.L.; Strynadka, N.C.J. Beta-lactam antibiotic resistance: A current structural perspective. Curr. Opin. Microbiol. 2005, 8, 525–533. [Google Scholar] [CrossRef] [PubMed]
- Gaynes, R. The Discovery of Penicillin—New Insights After More Than 75 Years of Clinical Use. Emerg. Infect. Dis. 2017, 23, 849. [Google Scholar] [CrossRef]
- Chantziaras, I.; Boyen, F.; Callens, B.; Dewulf, J. Correlation between veterinary antimicrobial use and antimicrobial resistance in food-producing animals: A report on seven countries. J. Antimicrob. Chemother. 2014, 69, 827–834. [Google Scholar] [CrossRef]
- Landers, T.F.; Cohen, B.; Wittum, T.E.; Larson, E.L. A review of antibiotic use in food animals: Perspective, policy, and potential. Public Health Rep. 2012, 127, 4–22. [Google Scholar] [CrossRef]
- Livermore, D.M. beta-Lactamases-the Threat Renews. Curr. Protein Pept. Sci. 2009, 10, 397–400. [Google Scholar] [CrossRef]
- Philippon, A.; Slama, P.; Dény, P.; Labia, R. A Structure-Based Classification of Class A β-Lactamases, a Broadly Diverse Family of Enzymes. Clin. Microbiol. Rev. 2016, 29, 29–57. [Google Scholar] [CrossRef]
- Bush, K.; Jacoby, G.A. Updated functional classification of beta-lactamases. Antimicrob. Agents Chemother. 2010, 54, 969–976. [Google Scholar] [CrossRef] [PubMed]
- Ur Rahman, S.; Ali, T.; Ali, I.; Khan, N.A.; Han, B.; Gao, J. The Growing Genetic and Functional Diversity of Extended Spectrum Beta-Lactamases. BioMed Res. Int. 2018, 2018, 9519718. [Google Scholar] [CrossRef]
- Husna, A.; Rahman, M.M.; Badruzzaman, A.T.M.; Sikder, M.H.; Islam, M.R.; Rahman, M.T.; Alam, J.; Ashour, H.M. Extended-Spectrum β-Lactamases (ESBL): Challenges and Opportunities. Biomedicines 2023, 11, 2937. [Google Scholar] [CrossRef] [PubMed]
- Bush, K.; Bradford, P.A. Epidemiology of β-Lactamase-Producing Pathogens. Clin. Microbiol. Rev. 2020, 33, e00047-19. [Google Scholar] [CrossRef]
- Ramadan, A.A.; Abdelaziz, N.A.; Amin, M.A.; Aziz, R.K. Novel blaCTX-M variants and genotype-phenotype correlations among clinical isolates of extended spectrum beta lactamase-producing Escherichia coli. Sci. Rep. 2019, 9, 4224. [Google Scholar] [CrossRef] [PubMed]
- Ruppé, E. Network for Enhancing Tricycle ESBL Surveillance Efficiency (NETESE) group Lessons from a global antimicrobial resistance surveillance network. Bull. World Health Organ. 2023, 101, 672–678. [Google Scholar] [CrossRef]
- WHO Integrated Global Surveillance on ESBL-Producing E. coli Using a “One Health” Approach: Implementation and Opportunities [Internet]. Available online: https://www.who.int/publications/i/item/9789240021402 (accessed on 17 October 2024).
- Gundran, R.S.; Cardenio, P.A.; Villanueva, M.A.; Sison, F.B.; Benigno, C.C.; Kreausukon, K.; Pichpol, D.; Punyapornwithaya, V. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended- spectrum β- lactamase- producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res. 2019, 15, 227. [Google Scholar] [CrossRef] [PubMed]
- Weill, F.-X.; Guesnier, F.; Guibert, V.; Timinouni, M.; Demartin, M.; Polomack, L.; Grimont, P.A.D. Multidrug Resistance in Salmonella enterica Serotype Typhimurium from Humans in France (1993 to 2003). J. Clin. Microbiol. 2006, 44, 700. [Google Scholar] [CrossRef] [PubMed]
- Hendriksen, R.S.; Cavaco, L.M.; Guerra, B.; Bortolaia, V.; Agersø, Y.; Svendsen, C.A.; Nielsen, H.N.; Kjeldgaard, J.S.; Pedersen, S.K.; Fertner, M.; et al. Evaluation and validation of laboratory procedures for the surveillance of ESBL-, AmpC-, and carbapenemase-producing Escherichia coli from fresh meat and caecal samples. Front. Microbiol. 2023, 14, 1229542. [Google Scholar] [CrossRef]
- Gatsios, A.; Kim, C.S.; Crawford, J.M. Escherichia coli small molecule metabolism at the host-microorganism interface. Nat. Chem. Biol. 2021, 17, 1016–1026. [Google Scholar] [CrossRef]
- Khan, F.; Tabassum, N.; Pham, D.T.N.; Oloketuyi, S.F.; Kim, Y.-M. Molecules involved in motility regulation in Escherichia coli cells: A review. Biofouling 2020, 36, 889–908. [Google Scholar] [CrossRef] [PubMed]
- Secher, T.; Brehin, C.; Oswald, E. Early settlers: Which E. coli strains do you not want at birth? Am. J. Physiol. Gastrointest. Liver Physiol. 2016, 311, G123–G129. [Google Scholar] [CrossRef] [PubMed]
- Puspandari, N.; Sunarno, S.; Febrianti, T.; Febriyana, D.; Saraswati, R.D.; Rooslamiati, I.; Amalia, N.; Nursofiah, S.; Hartoyo, Y.; Herna, H.; et al. Extended spectrum beta-lactamase-producing Escherichia coli surveillance in the human, food chain, and environment sectors: Tricycle project (pilot) in Indonesia. One Health 2021, 13, 100331. [Google Scholar] [CrossRef] [PubMed]
- Milenkov, M.; Proux, C.; Rasolofoarison, T.L.; Rakotomalala, F.A.; Rasoanandrasana, S.; Rahajamanana, V.L.; Rafalimanana, C.; Ravaoarisaina, Z.; Ramahatafandry, I.T.; Westeel, E.; et al. Implementation of the WHO Tricycle protocol for surveillance of extended-spectrum β-lactamase producing Escherichia coli in humans, chickens, and the environment in Madagascar: A prospective genomic epidemiology study. Lancet Microbe 2024, 5, 100850. [Google Scholar] [CrossRef] [PubMed]
- Acharya, J.; Jha, R.; Gompo, T.R.; Chapagain, S.; Shrestha, L.; Rijal, N.; Shrestha, A.; Koirala, P.; Subedi, S.; Tamang, B.; et al. Prevalence of Extended-Spectrum Beta-Lactamase (ESBL)-Producing Escherichia coli in Humans, Food, and Environment in Kathmandu, Nepal: Findings From ESBL E. coli Tricycle Project. Int. J. Microbiol. 2024, 2024, 1094816. [Google Scholar] [CrossRef]
- Sintondji, K.; Fabiyi, K.; Hougbenou, J.; Koudokpon, H.; Lègba, B.; Amoussou, H.; Haukka, K.; Dougnon, V. Prevalence and characterization of ESBL-producing Escherichia coli in healthy pregnant women and hospital environments in Benin: An approach based on Tricycle. Front. Public Health 2023, 11, 1227000. [Google Scholar] [CrossRef]
- Sanke-Waïgana, H.; Fall, C.; Gody, J.-C.; Komba, E.K.; Ngaya, G.; Mbecko, J.-R.; Yambiyo, B.M.; Manirakiza, A.; Vernet, G.; Dieye, A.; et al. High Fecal Carriage of Extended-Spectrum β-Lactamase Producing Enterobacteriaceae by Children Admitted to the Pediatric University Hospital Complex in Bangui, Central African Republic. Bacteria 2023, 2, 60–69. [Google Scholar] [CrossRef]
- Karanika, S.; Karantanos, T.; Arvanitis, M.; Grigoras, C.; Mylonakis, E. Fecal Colonization With Extended-spectrum Beta-lactamase-Producing Enterobacteriaceae and Risk Factors Among Healthy Individuals: A Systematic Review and Metaanalysis. Clin. Infect. Dis. 2016, 63, 310–318. [Google Scholar] [CrossRef]
- Banu, R.A.; Alvarez, J.M.; Reid, A.J.; Enbiale, W.; Labi, A.-K.; Ansa, E.D.O.; Annan, E.A.; Akrong, M.O.; Borbor, S.; Adomako, L.A.B.; et al. Extended Spectrum Beta-Lactamase Escherichia coli in River Waters Collected from Two Cities in Ghana, 2018–2020. Trop. Med. Infect. Dis. 2021, 6, 105. [Google Scholar] [CrossRef]
- Kagambèga, A.B.; Dembélé, R.; Traoré, O.; Wane, A.A.; Mohamed, A.H.; Coulibaly, H.; Fall, C.; Bientz, L.; M’Zali, F.; Mayonnove, L.; et al. Isolation and Characterization of Environmental Extended Spectrum β-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae from Ouagadougou, Burkina Faso. Pharmaceuticals 2024, 17, 305. [Google Scholar] [CrossRef]
- Ewers, C. Extended-Spectrum β-Lactamase and AmpC β-Lactamase-Producing Bacteria in Livestock Animals. In Zoonoses: Infections Affecting Humans and Animals; Sing, A., Ed.; Springer International Publishing: Cham, Switzerland, 2023; pp. 547–578. [Google Scholar] [CrossRef]
- Vounba, P.; Arsenault, J.; Bada-Alambédji, R.; Fairbrother, J.M. Prevalence of antimicrobial resistance and potential pathogenicity, and possible spread of third generation cephalosporin resistance, in Escherichia coli isolated from healthy chicken farms in the region of Dakar, Senegal. PLoS ONE 2019, 14, e0214304. [Google Scholar] [CrossRef] [PubMed]
- Emes, E.; Faye, A.; Naylor, N.; Belay, D.; Ngom, B.; Fall, A.G.; Knight, G.; Dione, M. Drivers of Antibiotic Use in Semi-Intensive Poultry Farms: Evidence from a Survey in Senegal. Antibiotics 2023, 12, 460. [Google Scholar] [CrossRef] [PubMed]
Target Genes | Primer Sequences | Amplicon Size (bp) | Annealing Temperature | References |
---|---|---|---|---|
blaTEM | F: TTGGGTGCACGAGTGGGTTA R: TAATTGTTGCCGGGAAGCTA | 873 | 55 °C | [19] |
blaSHV | F: TCGGGCCGCGTAGGCATGAT R: AGCAGGGCGACAATCCCGCG | 628 | 52 °C | [19] |
blaOXA1 | F: ATGAAAAACACAATACATATC R: AATTTAGTGTGTTTAGAATGG | 830 | 56 °C | [20] |
blaCTX-M | F: ATGTGCAGYACCAGTAARGTKATGGC R: TGGGTRAARTARGTSACCAGAAYSAGCGG | 592 | 55 °C | [19] |
blaCTX-M-1 group | F: GGTTAAAAAATCACTGCGTC R: TTACAAACCGTYGGTGACGA | 873 | 50 °C | [19] |
blaCTX-M-15 | F: CACACGTGGAATTTAGGGACT R: GCCGTCTAAGGCGATAAACA | 995 | 50 °C | [19] |
blaCTX-M-2 group | F: ATGATGACTCAGAGCATTCGCCGC R: TCAGAAACCGTGGGTTACGATTTT | 876 | 56 °C | [19] |
blaCTX-M-8 group | F: TGATGAGACATCGCGTTAAG R: TAACCGTCGGTGACGATTTT | 666 | 52 °C | [19] |
blaCTX-M-9 group | F: GTGACAAAGAGAGTGCAACGG R: ATGATTCTCGCCGCTGAAGCC | 856 | 55 °C | [19] |
blaCTX-M-25 group | R: AACCCACGATGTGGGTAGC R: CCTCGCTGTGCTTGTATCC | 327 | 52 °C | [19] |
Markets | Number of Samples | ESBL-Ec Positive Samples (%) |
---|---|---|
Sandaga | 120 | 74 (61.7) |
Tilene | 120 | 74 (61.7) |
Total | 240 | 148 (61.7) |
Antibiotic Families | Antibiotics | Resistance * N (%) |
---|---|---|
β-lactams | Ampicillin | 186 (100) |
Ticarcillin | 186 (100) | |
Amoxicillin + clavulanic acid | 0 | |
Cefalotin | 186 (100) | |
Cefotaxime | 186 (100) | |
Ceftazidime | 156 (83.9) | |
Cefepime | 157 (84.4) | |
Aztreonam | 183 (98.4) | |
Cefoxitin | 36 (19.4) | |
Imipenem | 0 | |
Quinolone | Nalidixic acid | 151 (81.2) |
Fluoroquinolone | Ciprofloxacin | 123 (66.1) |
Aminoglycoside | Gentamicin | 59 (31.8) |
Tetracycline | Tetracycline | 166 (82.2) |
Sulfonamide | Trimethoprim + sulfamethoxazole | 139 (74.8) |
ESBL Genes | Nb Isolates (%) | ||
---|---|---|---|
blaCTX-M family | blaCTX-M-1 group | blaCTX-M15 variant | 58 (31.2%) |
Non-blaCTX-M15 variant * | 37 (19.9%) | ||
blaCTX-M2 group | 53 (28.5%) | ||
blaCTX-M8 group | 19 (10.2%) | ||
blaCTX-M9 group | 57 (30.6%) | ||
blaCTX-M25 group | 0 | ||
Other blaCTX-M ** | 4 (2.2%) | ||
blaTEM family | 49 (26.3%) | ||
blaOXA family | 5 (2.7%) | ||
blaSHV family | 0 |
ESBL Gene Combination | Nb Isolates (%) |
---|---|
blaCTX-M1 + blaCTX-M8 + blaCTX-M9 | 4 (2.2%) |
blaCTX-M15 + blaCTX-M8 + blaTEM | 4 (2.2%) |
blaCTX-M15 + blaOXA + blaTEM | 3 (1.6%) |
blaCTX-M15 + blaCTX-M8 + blaTEM | 2 (1.1%) |
blaCTX-M15 + blaCTX-M2 + blaCTX-M9 | 1 (0.5%) |
blaCTX-M15 + blaCTX-M2 + blaTEM | 1 (0.5%) |
blaCTX-M15 + blaCTX-M9 + blaTEM | 1 (0.5%) |
blaCTX-M1 + blaCTX-M2 + blaTEM | 1 (0.5%) |
blaCTX-M2 + blaCTX-M9 + blaTEM | 1 (0.5%) |
blaCTX-M15 + blaTEM | 19 (10.2%) |
blaCTX-M1 + blaTEM | 9 (4.8%) |
blaCTX-M2 + blaTEM | 6 (3.2%) |
blaCTX-M1 + blaCTX-M9 | 6 (3.2%) |
blaCTX-M15 + blaCTX-M2 | 5 (2.7%) |
blaCTX-M15 + blaCTX-M8 | 5 (2.7%) |
blaCTX-M1 + blaCTX-M8 | 2 (1.1%) |
blaCTX-M2 + blaCTX-M9 | 2 (1.1%) |
blaCTX-M2 + blaOXA | 2 (1.1%) |
blaCTX-M15 + blaCTX-M9 | 1 (0.5%) |
blaCTX-M8 + blaCTX-M9 | 1 (0.5%) |
blaCTX-M8 + blaTEM | 1 (0.5%) |
blaCTX-M9 + blaTEM | 1 (0.5%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cissé, A.; Sambe Ba, B.; Sow, O.; Wane, A.A.; Ndiaye, I.; Fall, C.; Camara, M.; Dieye, Y. Prevalence, Antimicrobial Susceptibility, and Resistance Genes of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers Sold in Open Markets of Dakar, Senegal. Microorganisms 2024, 12, 2357. https://doi.org/10.3390/microorganisms12112357
Cissé A, Sambe Ba B, Sow O, Wane AA, Ndiaye I, Fall C, Camara M, Dieye Y. Prevalence, Antimicrobial Susceptibility, and Resistance Genes of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers Sold in Open Markets of Dakar, Senegal. Microorganisms. 2024; 12(11):2357. https://doi.org/10.3390/microorganisms12112357
Chicago/Turabian StyleCissé, Abdoulaye, Bissoume Sambe Ba, Ousmane Sow, Abdoul Aziz Wane, Issa Ndiaye, Cheikh Fall, Makhtar Camara, and Yakhya Dieye. 2024. "Prevalence, Antimicrobial Susceptibility, and Resistance Genes of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers Sold in Open Markets of Dakar, Senegal" Microorganisms 12, no. 11: 2357. https://doi.org/10.3390/microorganisms12112357
APA StyleCissé, A., Sambe Ba, B., Sow, O., Wane, A. A., Ndiaye, I., Fall, C., Camara, M., & Dieye, Y. (2024). Prevalence, Antimicrobial Susceptibility, and Resistance Genes of Extended-Spectrum β-Lactamase-Producing Escherichia coli from Broilers Sold in Open Markets of Dakar, Senegal. Microorganisms, 12(11), 2357. https://doi.org/10.3390/microorganisms12112357