Probiotic Properties and Antioxidant Activity In Vitro of Lactic Acid Bacteria
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Species and Culture Conditions
2.2. Extraction Procedures
2.3. Liquid Liquid Extraction (LLE)
2.4. Assay Antioxidant Activity of LAB Species In Vitro
Scavenging of a, a-Diphenyl-β-Picrylhydrazyl (DDPH) Free Radical
2.5. Inhibition against Peroxyl Radical Induced DNA Scission
2.6. Evaluation of Probiotic Properties
2.6.1. Tolerance to Acids
2.6.2. Resistance to Simulated Gastrointestinal Conditions
2.6.3. Antibiotic Resistance
2.7. Genomic DNA Extraction
2.8. Identification of Genes Encoding Bacteriocin Production
2.9. Statistical Analysis
3. Results and Discussion
3.1. Resistance to Simulated Gastric and Intestinal Fluids
3.2. Gradient Concentration Strip (Etest) Method
3.3. Antioxidant Activity In Vitro of LAB
3.4. Inhibition against Peroxyl Radical Induced DNA Scission
3.5. Detection of Bacteriocin Structural Genes
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Food and Agriculture Organization/World Health Organization. Evaluation of Health and Nutritional Properties of Pro-Biotics in Food Including Powder Milk with Live Lactic Acid Bacteria: Report of a Joint FAO/WHO Expert Consultation 2006. 25 November 2008. Available online: http://pc.ilele.hk/public/pdf/20190225/bd3689dfc2fd663bb36def1b672ce0a4.pdf (accessed on 1 October 2021).
- Burgain, J.; Gaiani, C.; Linder, M.; Scher, J. Encapsulation of probiotic living cells: From laboratory scale to industrial applications. J. Food Eng. 2011, 104, 467–483. [Google Scholar] [CrossRef] [Scilit]
- Cook, M.T.; Tzortzis, G.; Charalampopoulos, D.; Khutoryanskiy, V.V. Microencapsulation of probiotics for gastrointestinal delivery. J. Control. Release 2012, 162, 56–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Javanshir, N.; Hosseini, G.N.G.; Sadeghi, M.; Esmaeili, R.; Satarikia, F.; Ahmadian, G.; Allahyari, N. Evaluation of the Function of Probiotics, Emphasizing the Role of Their Binding to the Intestinal Epithelium in the Stability and Their Effects on the Immune System. Biol. Proced. 2021, 23, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anal, A.K.; Singh, H. Recent advances in microencapsulation of probiotics for industrial applications and targeted delivery. Trends Food Sci. Technol. 2007, 18, 240–251. [Google Scholar] [CrossRef] [Scilit]
- Ammor, M.S.; Flórez, A.B.; Mayo, B. Antibiotic resistance in non-enterococcal lactic acid bacteria and Bifidobacteria. Food Microb. 2007, 24, 559–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Devirgiliis, C.; Barile, S.; Perozzi, G. Antibiotic resistance determinants in the interplay between food and gut microbiota. Genes Nutr. 2011, 6, 275–284. [Google Scholar] [CrossRef] [Scilit]
- Champagne, C.P.; Kailasapathy, K. Encapsulation of probiotics. In Delivery and Controlled Release of Bioactives in Foods and Nutraceuticals; Garti, N., Ed.; Woodhead Publishing: Swaston, UK, 2008; pp. 344–369. [Google Scholar]
- Stefanska, I.; Kwiecien, E.; Józwiak-Piasecka, K.; Garbowska, M.; Binek, M.; Rzewuska, M. Antimicrobial Susceptibility of Lactic Acid Bacteria Strains of Potential Use as Feed Additives—The Basic Safety and Usefulness Criterion. Front. Vet. Sci. 2021, 8, 687071. [Google Scholar] [CrossRef] [Scilit]
- Son, S.H.; Jeon, H.L.; Yang, S.J.; Sim, M.H.; Kim, Y.J.; Lee, N.K.; Paik, H.D. Probiotic lactic acid bacteria isolated from traditional Korean fermented foods based on β-glucosidase activity. Food Sci. Biotechnol. 2018, 27, 123–129. [Google Scholar] [CrossRef] [Scilit]
- Mimura, T.; Rizzello, F.; Helwig, U.; Poggioli, G.; Schreiber, S.; Talbot, I.C.; Nicholls, R.J.; Gionchetti, P.; Campieri, M.; Kamm, M.A. Once daily high dose probiotic therapy (VSL#3) for maintaining remission in recurrent or refractory pouchitis. Gut 2004, 53, 108–114. [Google Scholar]
- Holzapfel, W.H.; Haberer, P.; Geisen, R.; Björkroth, J.; Schillinger, U. Taxonomy and important features of probiotic microorganisms in food and nutrition. Am. J. Clin. Nutr. 2001, 73, 365–373. [Google Scholar] [CrossRef] [Scilit]
- Saad, M.; Delattre, C.; Urdaci, M.; Schmitter, J.M.; Bressollier, P. An overview of the last advances in probiotic and prebiotic field. LWT-Food Sci. Technol. 2013, 50, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Kumar, B.V.; Vijayendra, S.V.N.; Reddy, O.V.S. Trends in dairy and non-dairy probiotic products-a review. J. Food Sci. Technol. 2015, 52, 6112–6124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mokoena, M.P. Lactic Acid Bacteria and Their Bacteriocins: Classification, Biosynthesis and Applications against Uropathogens: A Mini-Review. Molecules 2017, 22, 1255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Todorov, S.D.; Kang, H.J.; Ivanova, I.V.; Holzapfel, W.H. Bacteriocins from LAB and Other Alternative Approaches for the Control of Clostridium and Clostridiodes Related Gastrointestinal Colitis. Front. Bioeng. Biotechnol. 2020, 8, 581778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perales-Adán, J.; Rubiño, S.; Martínez-Bueno, M.; Valdivia, E.; Montalbán-López, M.; Cebrián, R.; Maqueda, M. LAB Bacteriocins Controlling the Food Isolated (Drug-Resistant) Staphylococci. Front. Microbiol. 2018, 9, 1143. [Google Scholar] [CrossRef] [Scilit]
- Zacharof, M.P.; Lovitt, R.W. Bacteriocins Produced by Lactic Acid Bacteria: A Review Article. APCBEE Procedia 2012, 2, 50–56. [Google Scholar] [CrossRef] [Scilit]
- Azizi, F.; Habibi Najafi, M.B.; Edalatian Dovom, M.R. The Biodiversity of Lactobacillus spp. from Iranian Raw Milk Motal Cheese and Antibacterial Evaluation Based on Bacteriocin-Encoding Genes. AMB Express 2017, 7, 176. [Google Scholar] [CrossRef] [Scilit]
- Billström, H.; Lund, B.; Sullivan, A.; Nord, C.E. Virulence and antimicrobial resistance in clinical Enterococcus faecium. Int. J. Antimicrob. Agents. 2008, 32, 374–377. [Google Scholar] [CrossRef] [Scilit]
- European Food Safety Authority (EFSA). Guidance on the Assessment of Bacterial Susceptibility to Antimicrobials of Human and Veterinary Importance. EFSA J. 2012, 10, 2740. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Liu, C.; Li, D.; Zhao, Y.; Zhang, X.; Zeng, X.; Yang, Z.; Li, S. Antioxidant Activity of an Exopolysaccharide Isolated from Lactobacillus plantarum C88. Int. J. Biol. Macromol. 2013, 54, 270–275. [Google Scholar] [CrossRef] [Scilit]
- Carocho, M.; Ferreira, I.C. A review on antioxidants, prooxidants and related controversy: Natural and synthetic compounds, screening and analysis methodologies and future perspectives. Food Chem. Toxicol. 2013, 51, 15–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.; Lee, J.Y.; Jeong, Y.; Kang, C.H. Antioxidant Activity and Probiotic Properties of Lactic Acid Bacteria. Fermentation 2022, 8, 29. [Google Scholar] [CrossRef] [Scilit]
- Fenster, C.P.; Weinsier, R.L.; Darley-Usmar, V.M.; Patel, R.P. Obesity, aerobic exercise, and vascular disease: The role of oxidant stress. Obes. Res. 2002, 10, 964–968. [Google Scholar] [PubMed]
- Jeon, H.J.; Choi, H.S.; Lee, O.H.; Jeon, Y.J.; Lee, B.Y. Inhibition of reactive oxygen species (ROS) and nitric oxide (NO) by Gelidium elegans using alternative drying and extraction conditions in 3T3-L1 and RAW264.7 cells. Prev. Nutr. Food Sci. 2012, 17, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Lai, Y.S.; Hsu, W.H.; Huang, J.J.; Wu, S.C. Antioxidant and anti-inflammatory effects of pigeon pea (Cajanus cajan L.) extracts on hydrogen peroxide-and lipopolysaccharide-treated RAW264. 7 macrophages. Food Funct. 2012, 3, 1294–1301. [Google Scholar] [CrossRef] [Scilit]
- Tang, W.; Li, C.; He, Z.; Pan, F.; Pan, S.; Wang, Y. Probiotic properties and cellular antioxidant activity of Lactobacillus plantarum MA2 isolated from Tibetan Kefir grains. Probiotics Antimicrob. Proteins 2018, 10, 523–533. [Google Scholar] [CrossRef] [Scilit]
- Cizeikiene, D.; Jagelaviciute, J. Investigation of antibacterial activity and probiotic properties of strains belonging to Lactobacillus and Bifidobacterium genera for their potential application in functional food and feed products. Probiotics Antimicrob. Proteins 2021, 13, 1387–1403. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Zhao, Y.; Zhang, L.; Zhang, X.; Huang, L.; Li, D.; Niu, C.; Yang, Z.; Wang, Q. Antioxidant activity of Lactobacillus plantarum strains isolated from traditional Chinese fermented foods. Food Chem. 2012, 135, 1914–1919. [Google Scholar]
- Pieniz, S.; Andreazza, R.; Anghinoni, T.; Camargo, F.; Brandelli, A. Probiotic potential, antimicrobial and antioxidant activities of Enterococcus durans strain LAB18s. Food Control 2014, 37, 251–256. [Google Scholar] [CrossRef] [Scilit]
- Song, M.W.; Chung, Y.; Kim, K.T.; Hong, W.S.; Chang, H.J.; Paik, H.D. Probiotic characteristics of Lactobacillus brevis B13-2 isolated from kimchi and investigation of antioxidant and immune-modulating abilities of its heat-killed cells. LWT-Food Sci. Technol. 2020, 128, 109452. [Google Scholar] [CrossRef] [Scilit]
- Vougiouklaki, D.; Tsironi, T.; Papaparaskevas, J.; Halvatsiotis, P.; Houhoula, D. Characterization of Lacticaseibacillus rhamnosus, Levilactobacillus brevis and Lactiplantibacillus plantarum Metabolites and Evaluation of Their Antimicrobial Activity against Food Pathogens. Appl. Sci. 2022, 12, 660. [Google Scholar] [CrossRef] [Scilit]
- Vougiouklaki, D.; Loka, K.; Tsakni, A.; Houhoula, D. Characterization of Metabolites Production by Lactobacillus gasseri ATCC 33323 and Antioxidant Activity. Nutr. Food Sci. Int. J. 2022, 11, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Lobo, V.; Patil, A.; Phatak, A.; Chandra, N. Free Radicals, Antioxidants and Functional Foods: Impact on Human Health. Pharmacogn. Rev. 2010, 4, 118–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, X.; Xia, Y.; Wang, G.; Yang, Y.; Xiong, Z.; Lv, F.; Zhou, W.; Ai, L. Lactic Acid Bacteria with Antioxidant Activities Alleviating Oxidized Oil Induced Hepatic Injury in Mice. Front. Microbiol. 2018, 9, 2684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, N.; John, J.A.; Shahidi, F. Polyphenol Composition and Antioxidant Potential of Mint Leaves. Food Prod. Process. Nutr. 2019, 1, 1. [Google Scholar] [CrossRef] [Scilit]
- Fang, Z.; Hongfei, Z.; Junyu, Z.; Dziugan, P.; Shanshan, L.; Bolin, Z. Evaluation of Probiotic Properties of Lactobacillus Strains Isolated from Traditional Chinese Cheese. Ann. Microbiol. 2015, 65, 1419–1426. [Google Scholar] [CrossRef] [Scilit]
- Comunian, R.; Daga, E.; Dupre, I.; Paba, A.; Devirgiliis, C.; Piccioni, V.; Perozzi, G.; Zonenschain, D.; Rebecchi, A.; Morelli, L.; et al. Susceptibility to tetracycline and erythromycin of Lactobacillus paracasei strains isolated from traditional Italian fermented foods. Int. J. Food Microbiol. 2010, 138, 151–156. [Google Scholar] [CrossRef] [Scilit]





| Name | Sequence (5′ → 3′) | Size Amplicon | Annealing Temperature | References |
|---|---|---|---|---|
| Brevicin 174A-F | GTCTTAAATGCTAGGCTTGTCA | 766 | 58 | [19] |
| Brevicin 174A-R | CTGGCAAGACAAACGGTTAG | |||
| PlnA-F | TAGAAATAATTCCTCCGTACTTC | 573 | 57 | |
| PlnA-R | ATTAGCGATGTAGTGTCATCCA | |||
| plnEF-F | TATGAATTGAAAGGGTCCGT | 616 | 56 | |
| plnEF-R | GTTCCAAATAACATCATACAAGG | |||
| Pediocin PA-1-F | AAAGATACTGCGTTGATAGG | 1220 | 50 | |
| Pediocin PA-1-R | GAGAAGCCATGCTGAAAG |
| Species | Initial Log (CFU/mL) | Gastric Juice | ||
|---|---|---|---|---|
| 1 h | 2 h | 3 h | ||
| Lactobacillus gasseri ATCC 33323 | 7.97 | 7.96 (99.87%) | 7.89 (99.0%) | 7.83 (98.24%) |
| Lactiplantibacillus plantarum ATCC 14917 | 7.94 | 7.92 (99.75%) | 7.86 (98.99%) | 7.84 (98.74%) |
| Lacticaseibacillus rhamnosus GG ATCC 53103 | 8.00 | 7.99 (99.86%) | 7.99 (99.86%) | 7.91 (98.86%) |
| Levilactobacillus brevis ATCC 8287 | 8.02 | 8.00 (99.75%) | 7.91 (98.63%) | 7.88 (98.25%) |
| Species | Initial Log (CFU/mL) | Intestinal Juice | |||
|---|---|---|---|---|---|
| 3 h | 6 h | 9 h | 12 h | ||
| Lactobacillus gasseri ATCC 33323 | 7.83 | 7.02 (89.65%) | 6.15 (78.55%) | 5.82 (74.33%) | 3.87 (49.43%) |
| Lactiplantibacillus plantarum ATCC 14917 | 7.84 | 7.56 (96.42%) | 7.39 (94.26%) | 7.24 (92.35%) | 7.09 (90.43%) |
| Lacticaseibacillus rhamnosus GG ATCC 53103 | 7.91 | 7.67 (96.97%) | 7.42 (93.81%) | 7.13 (90.14%) | 6.97 (88.12%) |
| Levilactobacillus brevis ATCC 8287 | 7.88 | 7.53 (95.56%) | 7.13 (90.48%) | 6.87 (87.18%) | 6.52 (82.74%) |
| Species | MIC (μg/mL) | |||||||
|---|---|---|---|---|---|---|---|---|
| GM | K | TE | CH | A | E | CL | S | |
| Microbiological cut-off values (μg/mL) proposed by EFSA for obligate heterofermentative Lactobacillus | ||||||||
| 16 | 32 | 8 | 4 | 2 | 1 | 1 | 64 | |
| Lactobacillus gasseri | 14 | 28 | 6 | 3 | 1 | 1 | 1 | 64 |
| Levilactobacillus brevis | 1 | 16 | 3 | 2 | 0.125 | 0.50 | 0.32 | 32 |
| Microbiological cut-off values (μg/mL) proposed by EFSA for Lactobacillus plantarum/pentosus | ||||||||
| 16 | 64 | 32 | 8 | 2 | 1 | 2 | n.r | |
| Lactiplantibacillus plantarum | 4 | 12 | 4 | 3 | 0.25 | 0.75 | 0.25 | - |
| Microbiological cut-off values (μg/mL) proposed by EFSA for Lactobacillus rhamnosus | ||||||||
| 16 | 64 | 8 | 4 | 4 | 1 | 4 | 32 | |
| Lacticaseibacillus rhamnosus | 8 | 42 | 0.75 | 0.38 | 2 | 0.75 | 2 | 24 |
| Bacteriocinogenic Isolates | Bacteriocin Gene | |||
|---|---|---|---|---|
| PlnA | PlnEF | Pediocin PA-1 | Bre174A | |
| Levilactobacillus brevis ATCC 8287 | - | - | - | - |
| Lactiplantibacillus plantarum ATCC 14917 | - | + | + | - |
| Lacticaseibacillus rhamnosus GG ATCC 53103 | - | + | + | - |
| Lactobacillus gasseri ATCC 33323 | - | - | + | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vougiouklaki, D.; Tsironi, T.; Tsantes, A.G.; Tsakali, E.; Van Impe, J.F.M.; Houhoula, D. Probiotic Properties and Antioxidant Activity In Vitro of Lactic Acid Bacteria. Microorganisms 2023, 11, 1264. https://doi.org/10.3390/microorganisms11051264
Vougiouklaki D, Tsironi T, Tsantes AG, Tsakali E, Van Impe JFM, Houhoula D. Probiotic Properties and Antioxidant Activity In Vitro of Lactic Acid Bacteria. Microorganisms. 2023; 11(5):1264. https://doi.org/10.3390/microorganisms11051264
Chicago/Turabian StyleVougiouklaki, Despina, Theofania Tsironi, Andreas G. Tsantes, Efstathia Tsakali, Jan F. M. Van Impe, and Dimitra Houhoula. 2023. "Probiotic Properties and Antioxidant Activity In Vitro of Lactic Acid Bacteria" Microorganisms 11, no. 5: 1264. https://doi.org/10.3390/microorganisms11051264
APA StyleVougiouklaki, D., Tsironi, T., Tsantes, A. G., Tsakali, E., Van Impe, J. F. M., & Houhoula, D. (2023). Probiotic Properties and Antioxidant Activity In Vitro of Lactic Acid Bacteria. Microorganisms, 11(5), 1264. https://doi.org/10.3390/microorganisms11051264

