The Effect of Rickettsia bellii on Anaplasma marginale Infection in Dermacentor andersoni Cell Culture
Abstract
1. Introduction
2. Materials and Methods
2.1. DAE100 Cell Maintenance
2.2. Bacteria Preparation
2.3. Coinfections
2.4. Superinfection
2.5. RNA Extraction
2.6. RT-qPCR
2.7. Validation and Statistics
3. Results
3.1. Coinfection with an R. bellii MOI of 1
3.2. Coinfection with an R. bellii MOI of 10
3.3. Superinfection
3.4. DAE100 Growth Curves
3.5. R. bellii Growth Comparison
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McCallon, B.R. Prevalence and Economic Aspects of Anaplasmosis. In Proceedings of the 6th National Anaplasmosis Conference, Las Vegas, NV, USA, 19–20 March 1973; pp. 1–3. [Google Scholar]
- Kocan, K.M.; de la Fuente, J. Co-Feeding Studies of Ticks Infected with Anaplasma marginale. Vet. Parasitol. 2003, 112, 295–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eriks, I.S.; Stiller, D.; Palmer, G.H. Impact of persistent Anaplasma marginale rickettsemia on tick infection and transmission. J. Clin. Microbiol. 1993, 31, 2091–2096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kocan, K.M.; de la Fuente, J.; Guglielmone, A.A.; Meléndez, R.D. Antigens and Alternatives for Control of Anaplasma marginale Infection in Cattle. Clin. Microbiol. Rev. 2003, 16, 698–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toillion, A.R.; Reppert, E.J.; Amachawadi, R.G.; Olson, K.C.; Coetzee, J.F.; Kang, Q.; Reif, K.E. Effect of Protracted Free-Choice Chlortetracycline-Medicated Mineral for Anaplasmosis Control on Escherichia coli Chlortetracycline Resistance Profile from Pastured Beef Cattle. Microorganisms 2021, 9, 2495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- George, J.E.; Pound, J.M.; Davey, R.B. Chemical Control of Ticks on Cattle and the Resistance of These Parasites to Acaricides. Parasitology 2004, 129, S353–S366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edvantoro, B.B.; Naidu, R.; Megharaj, M.; Singleton, I. Changes in Microbial Properties Associated with Long-Term Arsenic and DDT Contaminated Soils at Disused Cattle Dip Sites. Ecotoxicol. Environ. Saf. 2003, 55, 344–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gall, C.A.; Reif, K.E.; Scoles, G.A.; Mason, K.L.; Mousel, M.; Noh, S.M.; Brayton, K.A. The Bacterial Microbiome of Dermacentor andersoni Ticks Influences Pathogen Susceptibility. ISME J. 2016, 10, 1846–1855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krawczak, F.S.; Labruna, M.B.; Hecht, J.A.; Paddock, C.D.; Karpathy, S.E. Genotypic Characterization of Rickettsia bellii Reveals Distinct Lineages in the United States and South America. BioMed. Res. Int. 2018, 2018, 8505483. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgdorfer, W.; Hayes, S.F.; Mavros, A.J. Nonpathogenic rickettsiae in Dermacentor andersoni: A limiting factor for the distribution of Rickettsia rickettsii. In Proceedings of the Rickettsiae and Rickettsial Diseases Proceedings, Hamilton, MT, USA, 3–5 September 1980; Burgdorfer, W., Anacker, R.L., Eds.; Academic Press: Cambridge, MA, USA, 1981; pp. 585–594. [Google Scholar]
- Aliota, M.T.; Peinado, S.A.; Velez, I.D.; Osorio, J.E. The WMel Strain of Wolbachia Reduces Transmission of Zika Virus by Aedes aegypti. Sci. Rep. 2016, 6, 28792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scoles, G.A.; Ueti, M.W.; Noh, S.M.; Knowles, D.P.; Palmer, G.H. Conservation of Transmission Phenotype of Anaplasma marginale (Rickettsiales: Anaplasmataceae) Strains among Dermacentor and Rhipicephalus Ticks (Acari: Ixodidae). J. Med. Entomol. 2007, 44, 484–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cull, B.; Burkhardt, N.Y.; Wang, X.-R.; Thorpe, C.J.; Oliver, J.D.; Kurtti, T.J.; Munderloh, U.G. The Ixodes scapularis Symbiont Rickettsia buchneri Inhibits Growth of Pathogenic Rickettsiaceae in Tick Cells: Implications for Vector Competence. Front. Vet. Sci. 2022, 8, 748427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simser, J.A.; Palmer, A.T.; Munderloh, U.G.; Kurtti, T.J. Isolation of a Spotted Fever Group Rickettsia, Rickettsia peacockii, in a Rocky Mountain Wood Tick, Dermacentor andersoni, Cell Line. Appl. Environ. Microbiol. 2001, 67, 546–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munderloh, U.G.; Kurtti, T.J. Formulation of Medium for Tick Cell Culture. Exp. Appl. Acarol. 1989, 7, 219–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solyman, M.S.M.; Ujczo, J.; Brayton, K.A.; Shaw, D.K.; Schneider, D.A.; Noh, S.M. Iron Reduction in Dermacentor andersoni Tick Cells Inhibits Anaplasma marginale Replication. Int. J. Mol. Sci. 2022, 23, 3941. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliver, J.D.; Burkhardt, N.Y.; Felsheim, R.F.; Kurtti, T.J.; Munderloh, U.G. Motility Characteristics are Altered for Rickettsia bellii Transformed to Overexpress a Heterologous rickA Gene. Appl. Environ. Microbiol. 2014, 80, 1170–1176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kambris, Z.; Cook, P.E.; Phuc, H.K.; Sinkins, S.P. Immune Activation by Life-Shortening Wolbachia and Reduced Filarial Competence in Mosquitoes. Science 2009, 326, 134–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, N.-L.; Kocan, K.M.; Blouin, E.F.; Murphy, G.L. Developmental Studies of Anaplasma marginale (Rickettsiales: Anaplasmataceae) in Male Dermacentor andersoni (Acari: Ixodidae) Infected as Adults by Using Nonradioactive in Situ Hybridization and Microscopy. J. Med. Entomol. 1996, 33, 911–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munderloh, U.G.; Blouin, E.F.; Kocan, K.M.; Ge, N.L.; Edwards, W.L.; Kurtti, T.J. Establishment of the Tick (Acari: Ixodidae)-Borne Cattle Pathogen Anaplasma marginale (Rickettsiales: Anaplasmataceae) in Tick Cell Culture. J. Med. Entomol. 1996, 33, 656–664. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Species | Gene | Forward | Reverse | Amplicon Size (bp) |
|---|---|---|---|---|
| D. andersoni | GAPDH | ggtcatctctgctccatctg | tgctcacaatcttcatgcttg | 89 |
| A. marginale | msp5 | cttccgaagttgtaagtgagggca | cttatcggcatggtcgcctagttt | 203 |
| R. bellii | rpoB | gcttaaagatcgcaaagggattatagacg | cctgccgacattctttcaactactg | 144 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aspinwall, J.A.; Jarvis, S.M.; Noh, S.M.; Brayton, K.A. The Effect of Rickettsia bellii on Anaplasma marginale Infection in Dermacentor andersoni Cell Culture. Microorganisms 2023, 11, 1096. https://doi.org/10.3390/microorganisms11051096
Aspinwall JA, Jarvis SM, Noh SM, Brayton KA. The Effect of Rickettsia bellii on Anaplasma marginale Infection in Dermacentor andersoni Cell Culture. Microorganisms. 2023; 11(5):1096. https://doi.org/10.3390/microorganisms11051096
Chicago/Turabian StyleAspinwall, Joseph A., Shelby M. Jarvis, Susan M. Noh, and Kelly A. Brayton. 2023. "The Effect of Rickettsia bellii on Anaplasma marginale Infection in Dermacentor andersoni Cell Culture" Microorganisms 11, no. 5: 1096. https://doi.org/10.3390/microorganisms11051096
APA StyleAspinwall, J. A., Jarvis, S. M., Noh, S. M., & Brayton, K. A. (2023). The Effect of Rickettsia bellii on Anaplasma marginale Infection in Dermacentor andersoni Cell Culture. Microorganisms, 11(5), 1096. https://doi.org/10.3390/microorganisms11051096

