Next Article in Journal
The Effect of Fruit and Berry Pomaces on the Growth Dynamics of Microorganisms and Sensory Properties of Marinated Rainbow Trout
Previous Article in Journal
Long COVID or Post-COVID-19 Condition: Past, Present and Future Research Directions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane

1
State Key Laboratory of Characteristic Chinese Medicine Resources in Southwest China, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
2
School of Basic Medicine, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
3
Key Laboratory of Drug-Targeting and Drug Delivery System of the Education Ministry and Sichuan Province, Sichuan Engineering Laboratory for Plant-Sourced Drug and Sichuan Research Center for Drug Precision Industrial Technology, West China School of Pharmacy, Sichuan University, Chengdu 610041, China
4
Innovative Institute of Chinese Medicine and Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu 611137, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Microorganisms 2023, 11(12), 2958; https://doi.org/10.3390/microorganisms11122958
Submission received: 13 November 2023 / Revised: 25 November 2023 / Accepted: 30 November 2023 / Published: 11 December 2023
(This article belongs to the Section Antimicrobial Agents and Resistance)

Abstract

The abnormal proliferation of Cutibacterium acnes is the main cause of acne vulgaris. Natural antibacterial plant extracts have gained great interest due to the efficacy and safety of their use in skin care products. Bletilla striata is a common externally used traditional Chinese medicine, and several of its isolated stilbenes were reported to exhibit good antibacterial activity. In this study, the antimicrobial activity of stilbenes from B. striata (BSS) against C. acnes and its potential effect on cell membrane were elucidated by determining the minimum inhibitory concentration (MIC), minimum bactericidal concentration (MBC), bacterial growth curve, adenosine triphosphate (ATP) levels, membrane potential (MP), and the expression of genes related to fatty acid biosynthesis in the cell membrane. In addition, the morphological changes in C. acnes by BSS were observed using transmission electron microscopy (TEM). Experimentally, we verified that BSS possessed significant antibacterial activity against C. acnes, with an MIC and MBC of 15.62 μg/mL and 62.5 μg/mL, respectively. The growth curve indicated that BSS at 2 MIC, MIC, 1/2 MIC, and 1/4 MIC concentrations inhibited the growth of C. acnes. TEM images demonstrated that BSS at an MIC concentration disrupted the morphological structure and cell membrane in C. acnes. Furthermore, the BSS at the 2 MIC, MIC, and 1/2 MIC concentrations caused a decrease in the intracellular ATP levels and the depolarization of the cell membrane as well as BSS at an MIC concentration inhibited the expression of fatty acid biosynthesis-associated genes. In conclusion, BSS could exert good antimicrobial activity by interfering with cell membrane in C. acnes, which have the potential to be developed as a natural antiacne additive.

1. Introduction

Globally, acne vulgaris is an inflammatory skin condition that affects 9.38% of the population, making it the eighth most prevalent disease [1,2]. Acne is mainly caused by the bacterium Cutibacterium acnes, a common bacterium found on human skin [3]. It is true that antibiotics are effective against sensitive C. acnes, but they are also resistant due to monotherapy and overuse [4]. Among other treatments, retinoids and benzoyl peroxide are limited by patient compliance because of unpleasant side effects [5]. As a result, there is a need for new effective treatments that have fewer side effects.
Bletilla striata, a perennial herb of the genus Bletilla (Orchidaceae), is mainly distributed in China, including the Guangxi, Yunnan, and Sichuan provinces [6]. Its dry tubers have been commonly used in traditional medicine for centuries to treat various diseases, including lung disorders, gastrointestinal disorders, traumatic bleeding, burns, and ulcers [7,8]. It has been reported that B. striata contains stilbenes (bibenzyls and phenanthrenes) and polysaccharides [9,10]. There has been evidence that stilbenes from B. striata (BSS) possess anti-inflammatory, antitumor, and antibacterial properties [11,12], indicating that BSS has medical benefits to be promising healthcare products.
But there have been few studies evaluating the effectiveness of BSS for C. acnes. Therefore, the main active components of BSS were identified and analyzed by HPLC/Q-TOF-MS in the study. The inhibitory effect of BSS on C. acnes was tested in vitro, and its potential effect on cell membrane was further explored. This study provides new insights into how BSS may act against C. acnes.

2. Materials and Methods

2.1. Chemicals

Doxycycline hydrochloride (purity ≥ 98.0%, Lot No: D14332) was purchased from Frontier Scientific, Inc. (Newark, DE, USA). 2,3,5-Triphenyltetrazolium chloride (TTC, purity ≥ 98.0%, Lot No: BCCH3368) was acquired from Sigma-Aldrich (Wien, Austria).

2.2. Bacterial Strains and Culture

C. acnes (ATCC 11827) was obtained from Guangdong Microbial Culture Collection Center (Guangzhou, China). It was anaerobically incubated in a Brain Heart Infusion (BHI) Broth (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) agar plate at 37 °C.

2.3. Extraction of Stilbenes from B. striata

B. striata was procured from the Sichuan Provincial Chinese Medicine Drinking Tablets Co., Ltd. and identified by the Associate Professor Gao Jihai of Chengdu University of Traditional Chinese Medicine. The tubers of B. striata (5 kg) were extracted with 65% ethanol three times under reflux, for 1 h each time. The extract was evaporated under reduced pressure to yield a residue that was later suspended in water. The solution was then loaded to a polyamide chromatography column. Afterwards, the column was eluted with 20% ethanol to remove the impurities. And, the mobile phase of 95% ethanol was collected until the stilbenes were completely eluted. The solution was filtered and concentrated to obtain 20 g of extract with a content of 0.4%.

2.4. Instrumentation and HPLC/Q-TOF-MS Conditions

High-performance liquid chromatography (HPLC) was performed using an Agilent 1260-Bruker tims-TOF-MS system, equipped with a binary solvent delivery system, an autosampler, and a DAD system. The separation was conducted on an Agilent Poroshell 120 EC-C18 column (4.6 mm × 150 mm, 4 μm, Agilent, Santa Clara, CA, USA). The mobile phase consisted of (A) methanol and (B) 0.1% glacial acetic acid in water. The HPLC elution conditions were as follows: 30–95% A (0–55 min) and 95–100% A (55–60 min). The flow rate was kept at 0.4 mL/min. The column was maintained at 40 °C. Mass spectra were obtained using a high-definition mass spectrometer (HDMS) (Bruker Daltonics, Billerica, MA, USA) equipped with an electrospray ionization source. Electrospray ionization (ESI) mass spectra were acquired over the m/z 50–1300 range. Negative mode was obtained and the capillary voltage was set to 3000 V.

2.5. Determination of MIC and MBC

The MIC of BSS against C. acnes was determined by the broth microdilution method combined with the triphenyl tetrazolium chloride (TTC) indicator method [13,14]. The serial two-fold dilutions of BSS were prepared in 96-well plates (100 μL per well) using BHI broth as a diluent, followed by adding 100 μL of bacterial suspension (1.5 × 106 CFU/mL) to each well to obtain the final concentrations of 125.00–0.49 μg/mL. Doxycycline hydrochloride (2.50–0.01 μg/mL) was used as the positive control and 0.2% DMSO was used as the negative control. After anaerobic incubation at 37 °C for 48 h, 30 μL 0.5% (w/v) TTC solution was added to the wells as an indicator and cultured at 37 °C for 1.5 h. Tetrazolium salts can be reduced by active bacteria to red-colored formazan, so the MIC is calculated as the lowest drug concentration in the wells that did not turn red. Afterwards, MBC was determined by inoculating 10 μL culture on BHI agar plates and incubating it anaerobically at 37 °C for 48–72 h. The MBC is considered to be the lowest drug concentration at which no bacteria grew.

2.6. Determination of Growth Curve

The effect of BSS on the growth of C. acnes was assessed by determining the growth curve [15]. One hundred microliters of BSS at different concentrations were added to 96-well plates, followed by adding 100 μL of bacterial suspension (1.5 × 106 CFU/mL) to each well to obtain the final concentrations of 2 MIC, MIC, 1/2 MIC, and 1/4 MIC, and a bacterial suspension containing 0.2% DMSO was used as the control. The cultures were anaerobically incubated at 37 °C for 72 h, and the absorbance values were measured at 600 nm every 4 h during the incubation period using the FlexStation 3 multimode microplate reader (Molecular Devices, San Jose, CA, USA).

2.7. Observation of TEM

The effect of BSS on the morphology of C. acnes was observed by TEM [16]. Bacterial suspension (1.5 × 108 CFU/mL) was treated with the MIC concentration of BSS, and bacterial suspension containing 0.2% DMSO was used as the control. After anaerobic incubation at 37 °C for 48 h, the bacteria were collected by centrifugation (6000 rpm, 4 °C, 10 min) and washed with PBS (0.01 M, pH 7.2), fixed overnight with 2.5% glutaraldehyde, refixed with 1% osmium tetroxide. This was followed by progressive dehydration using acetone solution, and then permeabilized, embedded, sectioned, and stained. Finally, the samples were observed using the JEM-1400FLASH TEM (JEOL, Akishima, Japan).

2.8. Determination of Intracellular ATP Levels of C. acnes

The effect of BSS on the intracellular ATP levels of C. acnes was determined by BacTiter-Glo™ Microbial Cell Viability Assay (Promega Corporation, Madison, WI, USA) [17]. One hundred microliters of bacterial suspension (1.5 × 108 CFU/mL) containing 2 MIC, MIC, and 1/2 MIC concentrations were pipetted into 96-well plates, respectively. And, bacterial suspension containing 0.2% DMSO was used as the control. After anaerobic incubation at 37 °C for 3 h, 100 µL of BacTiter-Glo™ reagent was added. The sample’s ATP luminescence was measured using the FlexStation 3 multimode microplate reader and expressed in relative luminescence units (RLUs).

2.9. Measurement of MP

The effect of BSS on MP of C. acnes was analyzed by measuring Rhodamine fluorescence value [18]. Bacterial suspension (1.5 × 108 CFU/mL) was treated with BSS at the final concentrations of 2 MIC, MIC, and 1/2 MIC, and bacterial suspension containing 0.2% DMSO was used as the control. After anaerobic incubation at 37 °C for 3 h, bacterial suspension was centrifuged (6000 rpm, 5 min), washed, and resuspended with PBS. Rhodamine 123 (Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China) was added to the final concentration of 2 μg/mL. After incubation for another 30 min under dark conditions, the samples were washed and resuspended with PBS. Subsequently, the sample’s fluorescence intensity was measured at excitation and emission wavelengths of 480 nm and 530 nm using the FlexStation 3 multimode microplate reader.

2.10. Real-Time Quantitative PCR (qRT-PCR) Analysis

A qRT-PCR analysis of C. acnes was conducted to determine whether BSS affected the expression of fatty acid biosynthesis genes [19]. C. acnes was incubated to the logarithmic growth phase before being treated with BSS at a concentration of MIC for 12 h, and the bacterial suspension containing 0.2% DMSO was used as the control. According to the manufacturer’s instructions, the total RNA of C. acnes was extracted with Trizol reagent (Beyotime Biotechnology, Shanghai, China) and its concentration was measured; then, RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Vilnius, Lithuania). Finally, the expression of fatty acid biosynthesis-related genes (acpS, fabD, fabH, fabG, and fabI) was determined by qRT-PCR using PowerUpTM SYBRTM Green Master Mix (Thermo Fisher Scientific, Vilnius, Lithuania). gyrB was used as the housekeeping gene. Gene expression was analyzed by 2−ΔΔCt method. Primers are shown in Table 1.

2.11. Statistical Analysis

All experiments were performed in triplicate and data are expressed as the mean ± SD. Statistical analysis was performed using SPSS 22.0 software, and differences were considered statistically significant at p < 0.05 or p < 0.01.

3. Results

3.1. HPLC/Q-TOF-MS Profile of BSS

The HPLC chromatogram of BSS revealed multiple peaks with a retention time from 0 to 60 min (Figure 1). According to the MS spectra and retention time, ten components were identified in stilbenes, including Coelonin, 2,4,7-trimethoxy-9,10-dihydrophenanthrene, Bulbocodin D, etc. The identification and chemical components in the stilbenes sample are shown in Table 2.

3.2. Antimicrobial Activity of BSS against C. acnes

The antibacterial activity of BSS against C. acnes was evaluated by determining MIC and MBC. According to the experimental results, doxycycline hydrochloride had an MIC of 0.31 μg/mL and an MBC of 0.63 μg/mL against C. acnes, and those of BSS were 15.62 μg/mL and 62.5 μg/mL, respectively, demonstrating that BSS had a favorable bacteriostatic activity against C. acnes.

3.3. Inhibitory Effect of BSS on the Growth of C. acnes

The growth curve of C. acnes was plotted to observe the inhibitory effect of BSS on C. acnes growth. As shown in Figure 2, the growth of C. acnes in the control group approximately followed the model S-shaped growth curve, reaching the logarithmic growth phase after 16 h and the stable phase after 64 h. Compared with the control group, the growth of C. acnes was inhibited to different degrees after the treatment with 2 MIC, MIC, 1/2 MIC, and 1/4 MIC concentrations of BSS. Notably, BSS at 2 MIC and MIC concentrations almost inhibited the growth of C. acnes. The experimental results indicated that BSS was effective in suppressing the growth of C. acnes.

3.4. Effect of BSS on the Morphology of C. acnes

The TEM technique was used in this study for the direct observation of changes in the morphological structure of C. acnes by BSS. As shown in Figure 3, the morphological structure of C. acnes in the control group was normal and rod-shaped, with a complete and smooth cell surface and abundant cytoplasmic contents. In comparison with the control group, the BSS treatments of C. acnes led to deformed, curled, and ruptured cells as well as the loss of cytoplasmic contents. The experimental results revealed that BSS could affect the bacterial growth and survival by altering its normal morphological structure as well as destroying the cell wall and cell membrane.

3.5. Effect of BSS on the Intracellular ATP Levels of C. acnes

ATP is the main source of bioenergy for various bacteria. The ATP levels reflect bacterial viability and growth and decrease when the bacteria are damaged or dying [20]. The BacTiter-Glo™ Microbial Cell Viability Assay is a luciferase-based assay to quantify ATP levels [21]. In this study, the changes in the BSS on the intracellular ATP levels of C. acnes were measured by ATP luminescence (RLU). As shown in Figure 4, compared with the control group, the intracellular ATP levels of C. acnes were remarkably reduced in a concentration-dependent manner after the treatment with BSS (p < 0.01). The experimental results suggested that BSS could interfere with bacterial growth and cell viability by decreasing intracellular ATP levels.

3.6. Effect of BSS on MP of C. acnes

Rhodamine 123 is a lipophilic cationic dye, and changes in its fluorescence intensity reflect changes in bacterial MP [22]. A decrease in MP indicates membrane depolarization; conversely, an increase in MP indicates membrane hyperpolarization [23]. Consequently, Rhodamine 123 was used in this study to investigate the effect of BSS on the MP of C. acnes. As expected, the MP of C. acnes treated with BSS was reduced in a concentration-dependent manner (Figure 5). Compared to the control group, the mean fluorescence intensity (MFI) of the 2 MIC and MIC groups was reduced by 37.61% and 21.27% (p < 0.05 or p < 0.01), respectively. The experimental results suggested that BSS could arouse the marked depolarization of the cytoplasmic membrane in C. acnes, leading to cell membrane damage.

3.7. Effect of BSS on Fatty Acid Biosynthesis-Related Gene Expression of C. acnes

Fatty acid synthesis (FAS) in bacteria is vital for cell membrane production [24]. In order to further explore the effect of BSS on cell membrane in C. acnes, the fatty acid biosynthesis pathway after the exposure to BSS was analyzed. As shown in Figure 6, compared with the control group, BSS significantly downregulated the expression of acpS (encoding holo-ACP synthase), fabD (encoding malonyl-CoA-ACP transacylase), fabH (encoding β-ketoacyl-ACP synthase III), fabG (encoding 3-oxoacyl-ACP reductase), and fabI (encoding enoyl-ACP reductase) (p < 0.01). The experimental results indicated that BSS could interfere with fatty acid biosynthesis in the cell membrane by downregulating the gene expression of acpS, fabD, fabH, fabG, and fabI.

4. Discussion

Acne is a common skin disease which influences the quality of life and psychosocial function of patients. Usually, chemical drugs can only inhibit microbial infections, suppress the inflammatory response, or reduce the accompanying symptoms, but overuse and tolerance are also problems that cannot be ignored. Therefore, plant extracts have gained popularity because of the greater efficacy and safety of their use in skin care products. Stilbenes are secondary metabolites produced by plants in response to external stimuli such as fungal infection, trauma, and so on [25,26]. Notably, there is growing evidence that stilbenes are abundant in B. striata, which received much attention because of their good biological activities [27]. Modern pharmacological research reveals that BSS has a good antibacterial effect against a variety of bacteria such as methicillin-resistant Staphylococcus aureus, S. aureus, Bacillus subtilis, Escherichia coli, Bacillus cereus var. mycoides, Nocardia gardneri, and so on [28,29,30]. However, their suppressive effect on C. acnes has not been investigated to date. In present study, the MIC and MBC exhibited that BSS had a favorable antimicrobial activity, with MIC and MBC of 15.62 μg/mL and 62.50 μg/mL, respectively. The growth curve showed that BSS had a significant growth inhibitory effect on C. acnes.
Since BSS has good antibacterial activity against C. acnes, we further analyzed the effects of BSS on the bacterial cell membrane. Using TEM, we observed significant morphological changes in C. acnes when exposed to BSS at MIC concentration, with the severe bending and deformation of the bacteria, the rupture of the cell membrane, and the leakage of cytoplasmic contents. As we know, the cell membrane, as a barrier to bacterial life activities, plays a crucial role in maintaining bacterial material and energy homeostasis and is a key target of many antimicrobial agents [31]. MP is the potential difference between the interior and exterior of a biological cell membrane and is significant for ATP production and cellular functioning [32,33]. It has been reported that a change in the external environment of bacteria alters the ion balance on both sides of the membrane, resulting in an alteration of MP [34]. Igbinosa et al. showed that Streptomyces extracts induced cell membrane depolarization, which resulted in cell membrane disruption and bacterial death [35]. In this present study, we found that treatment with BSS caused the depolarization of the cell membrane, which further damaged the cell membrane and affected bacterial survival.
ATP, as a major energy carrier in organisms, is essential for bacterial metabolism and physiological activities [36]. In C. acnes, the anaerobic electron transport chain generates ATP from the Wood–Werkman cycle, and electrons are transferred from NADH to intracellular fumarate via NADH dehydrogenase and fumarate reductase to drive the proton pump for ATP synthesis [37]. It has been suggested that the decrease in intracellular ATP levels may be attributed to a slower rate of ATP synthesis and a faster rate of ATP hydrolysis, as well as cell membrane damage [38]. In our study, it was clearly demonstrated that treatment with BSS induced a decrease in the intracellular ATP levels in C. acnes, leading to a reduction in cell viability as well as affecting bacterial survival.
Fatty acid is an important ingredient for bacteria to synthesize various phospholipids in the cell membrane, and some bacteriostatic agents can target and inhibit the key enzymes in the fatty acid synthesis (FASII) pathway to inhibit fatty acid biosynthesis and achieve the bacteriostatic effect [39,40]. Therefore, scholars at home and abroad have taken the FASII pathway as the focus of developing bacteriostatic substances. The FASII pathway consists of a series of enzymes that sequentially and cyclically recognize and catalyze fatty acid carbon chain substrates covalently carried by acyl carrier protein (ACP) to achieve the synthesis and extension of saturated or unsaturated fatty acid carbon chains of a specific length [41,42]. According to the synthesis process in FASII, FASII is mainly divided into two phases: initiation and elongation cycle. acpS, fabD, and fabH are pivotal genes for the initiation phase of FASII. acpS encodes holo-ACP synthase, which generates holo-ACP by transferring the 4′-phosphopantetheine group of coenzyme A (CoA) to the serine residue of apo-ACP [43]. After apo-ACP is converted to holo-ACP, fabD encodes malonyl-CoA-ACP transacylase, which transfers the malonyl group of malonyl-CoA to holo-ACP to form malonyl-ACP [44]. fabH encodes β-ketoacyl-ACP synthase III, which catalyzes the condensation of malonyl-ACP and acetyl-CoA and is a key enzyme linking the initiation phase and the elongation cycle phase of FASII [45]. fabG and fabI are pivotal genes for the elongation cycle phase of FASII. fabG encodes 3-oxoacyl-ACP reductase, which reduces β-ketoacyl-ACP to β-hydroxyacyl-ACP [46]. fabI encodes enoyl-ACP reductase, which reduces enoyl-ACP to saturated acyl-ACP and is the final step in the elongation cycle phase of FASII [47]. In recent years, the FASII pathway has attracted increasing attention as an important direction for the development of antimicrobial agents. It was reported that anthranilic acid derivatives targeting acpS hindered CoA binding and catalyzing reactions by competitively binding to the CoA binding site [48]. Pang et al. found that Sanggenon D could suppress the initiation of fatty acid biosynthesis by downregulating fabD and fabH expression, as well as by regulating fatty acid carbon chain elongation by downregulating fabG and fabI, which further disrupted the cell membrane of S. aureus [49]. In this present study, the qRT-PCR results revealed that BSS could break the cell membrane in C. acnes by altering the expression of genes involved in fatty acid biosynthesis.
Although chemical drugs are useful for treatments seeking to prevent acne, the widespread use of antibiotics has led to drug resistance. BSS has been shown to exhibit significant antibacterial effects against C. acnes, which could emerge as new products for acne treatment. As a natural extract, BSS may have a higher efficacy and a lower toxicity for replacing or assisting antibacterial agents. However, further investigations need to be carried out to clarify their application value.

5. Conclusions

This study provided evidence that BSS contributed to suppressing the proliferation of C. acnes. Notably, BSS impacted the cell membrane of C. acnes by altering MP and modulating the gene expression of fatty acid biosynthesis. In addition, TEM images demonstrated that BSS disrupted the cell membrane in C. acnes. Taken together, stilbenes could be a natural antibacterial agent to control the negative impact of C. acnes in medicine and healthcare.

Author Contributions

Conceptualization, Q.Y. and L.S.; methodology, Q.Y., C.P. and Q.Z.; software, F.P.; validation, C.S.; formal analysis, F.X.; investigation, Q.Y. and L.S.; resources, M.S.; data curation, J.L.; writing—original draft preparation, Q.Y.; writing—review and editing, F.P. and Q.Z.; visualization, F.P. and L.S.; supervision, C.S. and F.X.; project administration, C.P. and Q.Z.; funding acquisition, C.P. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by Multi-dimensional Evaluation of Traditional Chinese Medicine Resources with Characteristics in Southwest China (ZYYCXTD-D-202209); Multi-dimensional Evaluation and Product Development Innovation Team of Characteristic Chinese Medicine Resources in Southwest China (2022C001); the National Natural Science Foundation of China (81891012) and the Regional Joint Fund of National Natural Science Foundation of China (U19A2010).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data included in this study are available upon request through contact with the corresponding author.

Acknowledgments

We are grateful to Yuncai Tian for their valuable technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Arooj, A.; Rehman, A.U.; Iqbal, M.; Naz, I.; Alhodaib, A.; Ahmed, N. Development of adapalene loaded liposome based gel for acne. Gels 2023, 9, 135. [Google Scholar] [CrossRef] [Scilit]
  2. Dréno, B.; Dagnelie, M.A.; Khammari, A.; Corvec, S. The skin microbiome: A new actor in inflammatory acne. Am. J. Clin. Dermatol. 2020, 21, 18–24. [Google Scholar] [CrossRef] [Scilit]
  3. Matsumoto, Y.; Tateyama, Y.; Sugita, T. Evaluation of antibacterial drugs using silkworms infected by Cutibacterium acnes. Insects 2021, 12, 619. [Google Scholar] [CrossRef] [Scilit]
  4. Taylor, E.J.; Yu, Y.; Champer, J.; Kim, J. Resveratrol demonstrates antimicrobial effects against Propionibacterium acnes in vitro. Dermatol. Ther. 2014, 4, 249–257. [Google Scholar] [CrossRef] [Scilit]
  5. Tripathi, S.V.; Gustafson, C.J.; Huang, K.E.; Feldman, S.R. Side effects of common acne treatments. Expert Opin. Drug. Saf. 2013, 12, 39–51. [Google Scholar] [CrossRef] [Scilit]
  6. Zhai, W.; Wei, E.; Li, R.; Ji, T.; Jiang, Y.; Wang, X.; Liu, Y.; Ding, Z.; Zhou, H. Characterization and evaluation of the pro-coagulant and immunomodulatory activities of polysaccharides from Bletilla striata. ACS Omega 2021, 6, 656–665. [Google Scholar] [CrossRef] [Scilit]
  7. Bae, J.Y.; Lee, J.W.; Jin, Q.; Jang, H.; Lee, D.; Kim, Y.; Hong, J.T.; Lee, M.K.; Lee, M.S.; Hwang, B.Y. Chemical constituents isolated from Bletilla striata and their inhibitory effects on nitric oxide production in RAW 264.7 Cells. Chem Biodivers 2017, 14, e1600243. [Google Scholar] [CrossRef] [Scilit]
  8. Nishidono, Y.; Ishii, T.; Okada, R.; Norimoto, H.; Murayama, C.; He, D.; Okuyama, T.; Nishizawa, M.; Tanaka, K. Effect of heat processing on the chemical constituents and NO-suppressing activity of Bletilla Tuber. J. Nat. Med 2020, 74, 219–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Jiang, S.; Wang, M.; Jiang, L.; Xie, Q.; Yuan, H.; Yang, Y.; Zafar, S.; Liu, Y.; Jian, Y.; Li, B.; et al. The medicinal uses of the genus Bletilla in traditional Chinese medicine: A phytochemical and pharmacological review. J. Ethnopharmacol. 2021, 280, 114263. [Google Scholar] [CrossRef] [Scilit]
  10. Jakfar, S.; Lin, T.C.; Chen, Z.Y.; Yang, I.H.; Gani, B.A.; Ningsih, D.S.; Kusuma, H.; Chang, C.T.; Lin, F.H. A polysaccharide isolated from the herb Bletilla striata combined with methylcellulose to form a hydrogel via self-assembly as a wound dressing. Int. J. Mol. Sci. 2022, 23, 12019. [Google Scholar] [CrossRef] [Scilit]
  11. Woo, K.W.; Park, J.E.; Choi, S.U.; Kim, K.H.; Lee, K.R. Phytochemical constituents of Bletilla striata and their cytotoxic activity. Nat. Prod. Sci. 2014, 20, 91–94. [Google Scholar]
  12. Kao, T.I.; Chen, P.J.; Wang, Y.H.; Tseng, H.H.; Chang, S.H.; Wu, T.S.; Yang, S.H.; Lee, Y.T.; Hwang, T.L. Bletinib ameliorates neutrophilic inflammation and lung injury by inhibiting Src family kinase phosphorylation and activity. Br. J. Pharmacol. 2021, 178, 4069–4084. [Google Scholar] [CrossRef] [Scilit]
  13. Maheshwari, M.; Safar Althubiani, A.; Hasan Abulreesh, H.; Abul Qais, F.; Shavez Khan, M.; Ahmad, I. Bioactive extracts of Carum copticum L. enhances efficacy of ciprofloxacin against MDR enteric bacteria. Saudi J. Biol. Sci. 2019, 26, 1848–1855. [Google Scholar] [CrossRef] [Scilit]
  14. Miazga-Karska, M.; Michalak, K.; Ginalska, G. Anti-acne action of peptides isolated from burdock root-preliminary studies and pilot testing. Molecules 2020, 25, 2027. [Google Scholar] [CrossRef] [Scilit]
  15. Chen, J.; Zhang, J.; Zhu, L.; Qian, C.; Tian, H.; Zhao, Z.; Jin, L.; Yang, D. Antibacterial activity of the essential oil from Litsea cubeba against Cutibacterium acnes and the investigations of its potential mechanism by gas chromatography-mass spectrometry metabolomics. Front. Microbiol. 2022, 13, 823845. [Google Scholar] [CrossRef] [Scilit]
  16. Theansungnoen, T.; Phosri, S.; Bumrungthai, S.; Daduang, J.; Klaynongsruang, S.; Daduang, S. Novel non-cytotoxic antimicrobial peptides WSKK11 and WSRR11 with potent activity against Cutibacterium acnes. J. Antimicrob. Chemother. 2022, 77, 1012–1019. [Google Scholar] [CrossRef] [Scilit]
  17. O’Malley, T.; Alling, T.; Early, J.V.; Wescott, H.A.; Kumar, A.; Moraski, G.C.; Miller, M.J.; Masquelin, T.; Hipskind, P.A.; Parish, T. Imidazopyridine compounds inhibit mycobacterial growth by depleting ATP levels. Antimicrob. Agents Chemother. 2018, 62, e02439-17. [Google Scholar] [CrossRef] [Scilit]
  18. Guo, F.; Chen, Q.; Liang, Q.; Zhang, M.; Chen, W.; Chen, H.; Yun, Y.; Zhong, Q.; Chen, W. Antimicrobial activity and proposed action mechanism of linalool against Pseudomonas fluorescens. Front. Microbiol. 2021, 12, 562094. [Google Scholar] [CrossRef] [Scilit]
  19. Aggarwal, S.D.; Gullett, J.M.; Fedder, T.; Safi, J.P.F.; Rock, C.O.; Hiller, N.L. Competence-associated peptide BriC alters fatty acid biosynthesis in Streptococcus pneumoniae. mSphere 2021, 6, e0014521. [Google Scholar] [CrossRef] [Scilit]
  20. Rashdan, H.R.M.; Shehadi, I.A.; Abdelrahman, M.T.; Hemdan, B.A. Antibacterial activities and molecular docking of novel sulfone biscompound containing bioactive 1,2,3-triazole moiety. Molecules 2021, 26, 4817. [Google Scholar] [CrossRef] [Scilit]
  21. Yussof, A.; Cammalleri, B.; Fayemiwo, O.; Lopez, S.; Chu, T. Antibacterial and sporicidal activity evaluation of theaflavin-3,3′-digallate. Int. J. Mol. Sci. 2022, 23, 2153. [Google Scholar] [CrossRef] [Scilit]
  22. Song, W.; Xin, J.; Yu, C.; Xia, C.; Pan, Y. Alkyl ferulic acid esters: Evaluating their structure and antibacterial properties. Front. Microbiol. 2023, 14, 1135308. [Google Scholar] [CrossRef] [Scilit]
  23. Reddy, G.K.K.; Nancharaiah, Y.V. Alkylimidazolium Ionic liquids as antifungal alternatives: Antibiofilm activity against Candida albicans and underlying mechanism of action. Front. Microbiol. 2020, 11, 730. [Google Scholar] [CrossRef] [Scilit]
  24. Zheng, C.J.; Yoo, J.S.; Lee, T.G.; Cho, H.Y.; Kim, Y.H.; Kim, W.G. Fatty acid synthesis is a target for antibacterial activity of unsaturated fatty acids. FEBS Lett. 2005, 579, 5157–5162. [Google Scholar] [CrossRef] [Scilit]
  25. Chong, J.; Poutaraud, A.; Hugueney, P. Metabolism and roles of stilbenes in plants. Plant Sci. 2009, 177, 143–155. [Google Scholar] [CrossRef] [Scilit]
  26. Reinecke, T. Inducible enzymes of the 9,10-dihydro-phenanthrene pathway. sterile orchid plants responding to fungal infection. Mol. Plant Microbe 1994, 7, 449–454. [Google Scholar] [CrossRef] [Scilit]
  27. Xu, D.; Pan, Y.; Chen, J. Chemical constituents, pharmacologic properties, and clinical applications of Bletilla striata. Front. Pharmacol. 2019, 10, 1168. [Google Scholar] [CrossRef] [Scilit]
  28. Jiang, S.; Chen, C.F.; Ma, X.P.; Wang, M.Y.; Wang, W.; Xia, Y.; Zhang, N.; Wu, M.K.; Pan, W.D. Antibacterial stilbenes from the tubers of Bletilla striata. Fitoterapia 2019, 138, 104350. [Google Scholar] [CrossRef] [Scilit]
  29. Jiang, S.; Wan, K.; Lou, H.Y.; Yi, P.; Zhang, N.; Zhou, M.; Song, Z.Q.; Wang, W.; Wu, M.K.; Pan, W.D. Antibacterial bibenzyl derivatives from the tubers of Bletilla striata. Phytochemistry 2019, 162, 216–223. [Google Scholar] [CrossRef] [Scilit]
  30. Takagi, S.; Yamaki, M.; Inoue, K. Antimicrobial agents from Bletilla striata. Phytochemistry 1983, 22, 1011–1015. [Google Scholar] [CrossRef] [Scilit]
  31. Yao, X.L.; Zhu, X.R.; Pan, S.Y.; Fang, Y.P.; Jiang, F.T.; Phillips, G.O.; Xu, X.Y. Antimicrobial activity of nobiletin and tangeretin against Pseudomonas. Food Chem. 2012, 132, 1883–1890. [Google Scholar] [CrossRef] [Scilit]
  32. Fang, Z.; Xu, L.Z.; Lin, Y.L.; Cai, X.X.; Wang, S.Y. The preservative potential of octopus scraps peptides-Zinc chelate against Staphylococcus aureus: Its fabrication, antibacterial activity and action mode. Food Control 2019, 98, 24–33. [Google Scholar] [CrossRef] [Scilit]
  33. Xu, C.; Li, J.L.; Yang, L.Q.; Shi, F.; Yang, L.; Ye, M. Antibacterial activity and a membrane damage mechanism of Lachnum YM30 melanin against Vibrio parahaemolyticus and Staphylococcus aureus. Food Control 2017, 73, 1445–1451. [Google Scholar] [CrossRef] [Scilit]
  34. Shu, H.; Chen, H.; Wang, X.; Hu, Y.; Yun, Y.; Zhong, Q.; Chen, W.; Chen, W. Antimicrobial activity and proposed action mechanism of 3-carene against Brochothrix thermosphacta and Pseudomonas fluorescens. Molecules 2019, 24, 3246. [Google Scholar] [CrossRef] [Scilit]
  35. Igbinosa, E.O.; Beshiru, A.; Igbinosa, I.H. Mechanism of action of secondary metabolites from marine-derived Streptoymces on bacterial isolates by membrane permeability. Microb. Pathog. 2020, 149, 104532. [Google Scholar] [CrossRef] [Scilit]
  36. Deng, Y.; Beahm, D.R.; Ionov, S.; Sarpeshkar, R. Measuring and modeling energy and power consumption in living microbial cells with a synthetic ATP reporter. BMC Biol. 2021, 19, 101. [Google Scholar] [CrossRef] [Scilit]
  37. McCubbin, T.; Gonzalez-Garcia, R.A.; Palfreyman, R.W.; Stowers, C.; Nielsen, L.K.; Marcellin, E. A pan-genome guided metabolic network reconstruction of five Propionibacterium species reveals extensive metabolic diversity. Genes 2020, 11, 1115. [Google Scholar] [CrossRef] [Scilit]
  38. Burt, S. Essential oils: Their antibacterial properties and potential applications in foods—A review. Int. J. Food Microbiol. 2004, 94, 223–253. [Google Scholar] [CrossRef] [Scilit]
  39. Yao, J.; Rock, C.O. Bacterial fatty acid metabolism in modern antibiotic discovery. BBA-Mol. Cell Biol. Lipids 2017, 1862, 1300–1309. [Google Scholar] [CrossRef] [Scilit]
  40. Lambert, C.; Poyart, C.; Gruss, A.; Fouet, A. FabT, a bacterial transcriptional repressor that limits futile fatty acid biosynthesis. Microbiol. Mol. Biol. Rev. 2022, 86, e0002922. [Google Scholar] [CrossRef] [Scilit]
  41. McNaught, K.J.; Kuatsjah, E.; Zahn, M.; Prates, É.T.; Shao, H.; Bentley, G.J.; Pickford, A.R.; Gruber, J.N.; Hestmark, K.V.; Jacobson, D.A.; et al. Initiation of fatty acid biosynthesis in Pseudomonas putida KT2440. Metab. Eng. 2023, 76, 193–203. [Google Scholar] [CrossRef] [Scilit]
  42. Radka, C.D.; Rock, C.O. Mining fatty acid biosynthesis for new antimicrobials. Annu. Rev. Microbiol. 2022, 76, 281–304. [Google Scholar] [CrossRef] [Scilit]
  43. Chirgadze, N.Y.; Briggs, S.L.; McAllister, K.A.; Fischl, A.S.; Zhao, G. Crystal structure of Streptococcus pneumoniae acyl carrier protein synthase: An essential enzyme in bacterial fatty acid biosynthesis. Embo J. 2000, 19, 5281–5287. [Google Scholar] [CrossRef] [Scilit]
  44. Hong, S.K.; Kim, K.H.; Park, J.K.; Jeong, K.W.; Kim, Y.; Kim, E.E. New design platform for malonyl-CoA-acyl carrier protein transacylase. FEBS Lett. 2010, 584, 1240–1244. [Google Scholar] [CrossRef] [Scilit]
  45. Whaley, S.G.; Radka, C.D.; Subramanian, C.; Frank, M.W.; Rock, C.O. Malonyl-acyl carrier protein decarboxylase activity promotes fatty acid and cell envelope biosynthesis in Proteobacteria. J. Biol. Chem. 2021, 297, 101434. [Google Scholar] [CrossRef] [Scilit]
  46. Cross, E.M.; Adams, F.G.; Waters, J.K.; Aragão, D.; Eijkelkamp, B.A.; Forwood, J.K. Insights into acinetobacter baumannii fatty acid synthesis 3-oxoacyl-ACP reductases. Sci. Rep. 2021, 11, 7050. [Google Scholar] [CrossRef] [Scilit]
  47. Khan, R.; Zeb, A.; Roy, N.; Thapa Magar, R.; Kim, H.J.; Lee, K.W.; Lee, S.W. Biochemical and structural basis of triclosan resistance in a novel enoyl-acyl carrier protein reductase. Antimicrob. Agents Chemother. 2018, 62, e00648-18. [Google Scholar] [CrossRef]
  48. Joseph-McCarthy, D.; Parris, K.; Huang, A.; Failli, A.; Quagliato, D.; Dushin, E.G.; Novikova, E.; Severina, E.; Tuckman, M.; Petersen, P.J.; et al. Use of structure-based drug design approaches to obtain novel anthranilic acid acyl carrier protein synthase inhibitors. J. Med. Chem. 2005, 48, 7960–7969. [Google Scholar] [CrossRef] [Scilit]
  49. Pang, D.R.; Wang, W.F.; Li, E.N.; Shen, W.Z.; Mu, L.X.; Liao, S.T.; Liu, F. Sanggenon D from root bark of mulberry inhibits the growth of Staphylococcus aureus by moderating the fatty acid biosynthesis system. Ind. Crop. Prod. 2019, 140, 111719. [Google Scholar] [CrossRef] [Scilit]
Figure 1. HPLC/Q-TOF-MS analysis of BSS.
Figure 1. HPLC/Q-TOF-MS analysis of BSS.
Microorganisms 11 02958 g001
Figure 2. Growth curve of C. acnes treated with different concentrations of BSS. Bars represent the standard deviation (n = 3).
Figure 2. Growth curve of C. acnes treated with different concentrations of BSS. Bars represent the standard deviation (n = 3).
Microorganisms 11 02958 g002
Figure 3. Effect of BSS on the morphology of C. acnes. (A) TEM image of C. acnes at 12,000× magnification; scale bar: 1 μm. (B) TEM image of C. acnes at 50,000× magnification, scale bar: 200 nm.
Figure 3. Effect of BSS on the morphology of C. acnes. (A) TEM image of C. acnes at 12,000× magnification; scale bar: 1 μm. (B) TEM image of C. acnes at 50,000× magnification, scale bar: 200 nm.
Microorganisms 11 02958 g003
Figure 4. Effect of BSS on intracellular ATP levels of C. acnes. Data are expressed as the mean ± SD (n = 3). ** p < 0.01 indicates significant differences compared with the control group.
Figure 4. Effect of BSS on intracellular ATP levels of C. acnes. Data are expressed as the mean ± SD (n = 3). ** p < 0.01 indicates significant differences compared with the control group.
Microorganisms 11 02958 g004
Figure 5. Effect of BSS on the MP of C. acnes. Data are expressed as the mean ± SD (n = 3). * p < 0.05 and ** p < 0.01 indicate significant differences compared with the control group.
Figure 5. Effect of BSS on the MP of C. acnes. Data are expressed as the mean ± SD (n = 3). * p < 0.05 and ** p < 0.01 indicate significant differences compared with the control group.
Microorganisms 11 02958 g005
Figure 6. Effect of BSS on fatty acid biosynthesis-related gene expression of C. acnes. Data are expressed as the mean ± SD (n = 3). ** p < 0.01 indicates significant differences compared with the control group.
Figure 6. Effect of BSS on fatty acid biosynthesis-related gene expression of C. acnes. Data are expressed as the mean ± SD (n = 3). ** p < 0.01 indicates significant differences compared with the control group.
Microorganisms 11 02958 g006
Table 1. Primers used in qRT-PCR.
Table 1. Primers used in qRT-PCR.
GeneForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
gyrBCTGCCCCAAGTTAACCCGATTGGCATTGCGCTGAATGAAC
acpSTTGGGTGGAGGAGAAGGACTACCTTCGCAGAACACCATCG
fabDCAGCCAACCACAATGGCAAACGGTTCCATATGAGCCGTGT
fabHTTGCTACTCAACCGCTCTGGCAGAGAAGAGGAAGGCGGTG
fabGGTCAGTGGTAGGTCTGCTCGAAACAAGCTTCTCCGGCAGT
fabICGATGCACACCTCTATCGCTGGATCGAGTTTGCGAACAGC
Table 2. Chemical composition of major stilbenes in BSS.
Table 2. Chemical composition of major stilbenes in BSS.
NoComponent NameRetention Time (min)Molecular Formula[M–H]
1Coelonin29.5C15H14O3241.0697
22,4,7-Trimethoxy-9,10-dihydrophenanthrene34.2C17H18O3269.0623
31,3-Dimethoxy-5-phenethylbenzene35.9C16H18O2241.0693
43,5-Dimethoxybibenzyl38.0C15H16O3243.0849
53,3′-Dihydroxy-4-(p-hydroxybenzyl)-5-methoxybibenzyl42.0C22H22O4349.1187
63,3′-Dihydroxy-2-(p-hydroxybenzyl)-5-methoxybibenzyl42.7C22H22O4349.1185
7Bulbocodin D43.7C29H28O5455.1524
83′,5-Dihydroxy-2-(p-hydroxybenzyl)-3-methoxybibenzyl44.7C22H22O4349.1186
9Gymconopin D49.1C23H24O4363.1329
10Bulbocol49.9C23H24O4363.1329
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, Q.; Sun, L.; Peng, F.; Sun, C.; Xiong, F.; Sun, M.; Liu, J.; Peng, C.; Zhou, Q. Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane. Microorganisms 2023, 11, 2958. https://doi.org/10.3390/microorganisms11122958

AMA Style

Yu Q, Sun L, Peng F, Sun C, Xiong F, Sun M, Liu J, Peng C, Zhou Q. Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane. Microorganisms. 2023; 11(12):2958. https://doi.org/10.3390/microorganisms11122958

Chicago/Turabian Style

Yu, Qian, Luyao Sun, Fu Peng, Chen Sun, Fang Xiong, Meiji Sun, Juan Liu, Cheng Peng, and Qinmei Zhou. 2023. "Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane" Microorganisms 11, no. 12: 2958. https://doi.org/10.3390/microorganisms11122958

APA Style

Yu, Q., Sun, L., Peng, F., Sun, C., Xiong, F., Sun, M., Liu, J., Peng, C., & Zhou, Q. (2023). Antimicrobial Activity of Stilbenes from Bletilla striata against Cutibacterium acnes and Its Effect on Cell Membrane. Microorganisms, 11(12), 2958. https://doi.org/10.3390/microorganisms11122958

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop