Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B
Abstract
1. Introduction
2. Materials and Methods
2.1. Residual Sample Materials Used for the Test Comparison, Inclusion and Exclusion Criteria
2.2. Nucleic Acid Extraction and Storage
2.3. Real-Time Screening PCR Assays for Giardia duodenalis and Differentiation Assays for the Assemblages A and B
2.4. Diagnostics Accuracy Estimation, Agreement, and Comparison of Obtained Cycle Threshold (Ct) Values
2.5. Ethics
3. Results
3.1. Sensitivity and Specificity of the Screening and Differentiation PCRs, Agreement between the Compared Assays, and Accuracy-Adjusted Prevalence Estimations
3.2. Comparison of the Recorded Cycle Threshold Values with the Assessed Screening and Differentiation PCRs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Target Pathogen | Target Gene | Forward Primer Sequence | Reverse Primer Sequence | Probe Sequence | Reference, Where the Detailed Protocol Can Be Found |
|---|---|---|---|---|---|
| Giardia duodenalis | bp | 5′-CATCCGCGAGGAGGTCAA-3′ | 5′-GCAGCCATGGTGTCGATCT-3′ | 5′-AAGTCCGCCGACAACATGTACCTAACGA-3′ | [25] |
| Giardia duodenalis | 18S rRNA | 5′-GACGGCTCAGGACAACGGTT-3′ | 5′-TTGCCAGCGGTGTCCG-3′ | 5′-CCCGCGGCGGTCCCTGCTAG-3′ | [26] |
| Giardia duodenalis | gdh | 5′-CTGAAGAACTCCCTCACCAC-3′ | 5′-CAGAAGCGCATGACCTCGTTG-3′ | 5′-CAAGGGCGGCTCCGACTTTGACCCAA-3′ | [27] |
| Giardia duodenalis assemblage A | bp | 5′-CCTCAAGAGCCTGAACGATCTC-3′ | 5′-AGCTGGTCGTACATCTTCTTCCTT-3′ | 5′-TTCTCCGTGGCAATGCCCGTCT-3′ | [25] |
| Giardia duodenalis assemblage A | bp | 5′-CCTCAAGAGCCTGAACGATCTC-3′ | 5′-AGCTGGTCGTACATCTTCTTCCTT-3′ | 5‘-TGGC+A+ATGCC+CG+TCT-3‘ | [28] |
| Giardia duodenalis assemblage A | tpi | 5′-CATTGCCCCTTCCGCC-3′ | 5′-CTGCGCTGCTATCCTCAACTG-3′ | 5′-CCATTGCGGCAAACA-3′ | [29] |
| Giardia duodenalis assemblage B | bp | 5′-CCTCAAGAGCCTGAACGACCTC-3′ | 5′-AGCTGGTCATACATCTTCTTCCTC-3′ | 5′-TTCTCCGTGGCGATGCCTGTCT-3′ | [25] |
| Giardia duodenalis assemblage B | bp | 5′-CCTCAAGAGCCTGAACGACCTC-3′ | 5′-AGCTGGTCATACATCTTCTTCCTC-3′ | 5′-TGGCG+ATGC+C+T+GTCT-3′ | [28] |
| Giardia duodenalis assemblage B | tpi | 5′-GATGAACGCAAGGCCAATAA-3′ | 5′-TCTTTGATTCTCCAATCTCCTTCTT-3′ | 5′-AATATTGCTCAGCTCGAG-3′ | [29] |
| Phocid herpes virus | gB | 5′-GGGCGAATCACAGATTGAATC-3′ | 5′-GCGGTTCCAAACGTACCAA-3′ | 5′-TTTTTATGTGTCCGCCACCATCTGGATC-3′ | [48] |
| Run Conditions for All Three G. duodenalis-Specific Screening Assays | Run Conditions for the Assemblage-Specific Assays Targeting the bg Gene without Locked Nucleic Acids | Run Conditions for the Assemblage-Specific Assays Targeting the bg Gene with Locked Nucleic Acids | Run Conditions for the Assemblage-Specific Assays Targeting the tri Gene | |
|---|---|---|---|---|
| Reaction chemistry | ||||
| Reaction volume (µL) | 20 | 20 | 20 | 20 |
| Forward primer concentration (pmol/µL) | 12.5 (18S rRNA gene), 20 (gdh gene), 30 (bp gene) | 30 (both assemblages) | 30 (both assemblages) | 30 (both assemblages) |
| Reverse primer concentration (pmol/µL) | 12.5 (18S rRNA gene), 20 (gdh gene), 30 (bp gene) | 30 (both assemblages) | 30 (both assemblages) | 90 (both assemblages) |
| Probe concentration (pmol/µL) | 1 (18S rRNA gene), 20 (gdh gene), 0.625 (bp gene) | 20 (both assemblages) | 20 (both assemblages) | 10 (both assemblages) |
| Final Mg2+ concentration (nM) | 3 | 4 | 3 | 3 |
| Bovine serum albumin (ng/µL) | 100 | 100 | 100 | - |
| Run conditions | ||||
| Initial denaturation | 15 min 95 °C | 15 min 95 °C | 15 min 95 °C | 15 min 95 °C |
| Cycle numbers | 40 | 40 | 50 | 50 |
| Denaturation | 15 sec 95 °C | 15 sec 95 °C | 10 sec 95 °C | 15 sec 95 °C |
| Annealing | Combined annealing/amplification: 60 sec 60 °C | Combined annealing/amplification: 60 sec 60 °C | 8 sec 58 °C | Combined annealing/amplification: 60 sec 60 °C |
| Amplification | 3 sec 72 °C | |||
| Hold | 10 sec 40 °C | 10 sec 40 °C | 10 sec 40 °C | 10 sec 40 °C |
| Positive Control Insert Based on G. duodenalis Sequences According to the NCBI GenBank Accession Numbers M54878, KJ499992, M36728, AY258616, L02120, and L02116. |
|---|
| 5′-GAATTCGGACGCGGCGGACGGCTCAGGACAACGGTTGCACCCCCCGCGGCGGTCCCTGCTAGCCGGACACCGCTGGCAACCCGGCGCCAGAATTCTCGAGCAGATCCTGAAGAACTCCCTCACCACGCTCCCGATGGGCGGCGGCAAGGGCGGCTCCGACTTTGACCCAAAGGGCAAGTCCGACAACGAGGTCATGCGCTTCTGCCAGTCCTTCGAATTCCGTTCGAGGACATCCGCGAGGAGGTCAAGAAGTCCGCCGACAACATGTACCTAACGATCAAGGAGGAGATCGACACCATGGCTGCAAACTTCCGCGAATTCGGAAGGAGGCCCTCAAGAGCCTGAACGATCTCGAGACGGGCATTGCCACGGAGAACGCAGAAAGGAAGAAGATGTACGACCAGCTCAACGAGAAGGAATTCGGAAGGAGGCCCTCAAGAGCCTGAACGACCTCGAGACAGGCATCGCCACGGAGAACGCCGAGAGGAAGAAGATGTATGACCAGCTCAACGAGAAAGAATTCTGGACGTCGTCATTGCCCCTTCCGCCGTACACCTGTCAACAGCCATTGCGGCAAACACGTCAAAACAGTTGAGGATAGCAGCGCAGAATGTGTACCGAATTCAGAGACCCTGGATGAACGCAAGGCCAATAACACTATGGAGGTGAATATTGCTCAGCTCGAGGCTCTTAAGAAGGAGATTGGAGAATCAAAGAAGTTATGGGAGAATTCAATTTTGGGCGAATCACAGATTGAATCTGATGATACAGCAACATTTTTTATGTGTCCGCCACCATCTGGATCAACGTTGGTACGTTTGGAACCGCCTCGGGCGAATTC-3′ |
| 18S rRNA gene | gdh | bg | |||||
|---|---|---|---|---|---|---|---|
| Negative | Positive | Negative | Positive | Negative | Positive | ||
| 18S rRNA gene | negative | 809 | |||||
| positive | 63 | ||||||
| gdh | negative | 747 | 52 | 799 | |||
| positive | 62 | 11 | 73 | ||||
| bg | negative | 809 | 43 | 780 | 72 | 852 | |
| positive | 0 | 20 | 19 | 1 | 20 | ||
| bg of Assemblage A without LNA | bg of Assemblage A with LNA | tri of Assemblage A | |||||
|---|---|---|---|---|---|---|---|
| Negative | Positive | Negative | Positive | Negative | Positive | ||
| bg of assemblage A without LNA | negative | 45 | |||||
| positive | 8 | ||||||
| bg of assemblage A with LNA | negative | 8 | 0 | 44 | |||
| positive | 1 | 44 | 9 | ||||
| tri of assemblage A | negative | 44 | 0 | 43 | 1 | 44 | |
| positive | 1 | 8 | 1 | 8 | 9 | ||
| bg of Assemblage B without LNA | bg of Assemblage B with LNA | tri of Assemblage B | |||||
|---|---|---|---|---|---|---|---|
| Negative | Positive | Negative | Positive | Negative | Positive | ||
| bg of assemblage B without LNA | negative | 25 | |||||
| positive | 28 | ||||||
| bg of assemblage B with LNA | negative | 21 | 1 | 22 | |||
| positive | 4 | 27 | 31 | ||||
| tri of assemblage B | negative | 25 | 5 | 21 | 9 | 30 | |
| positive | 0 | 23 | 1 | 22 | 23 | ||
References
- Vivancos, V.; González-Alvarez, I.; Bermejo, M.; Gonzalez-Alvarez, M. Giardiasis: Characteristics, Pathogenesis and New Insights about Treatment. Curr. Top. Med. Chem. 2018, 18, 1287–1303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loderstädt, U.; Frickmann, H. Antimicrobial resistance of the enteric protozoon Giardia duodenalis—A narrative review. Eur. J. Microbiol. Immunol. 2021, 11, 29–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leung, A.K.C.; Leung, A.A.M.; Wong, A.H.C.; Sergi, C.M.; Kam, J.K.M. Giardiasis: An Overview. Recent Pat. Inflamm. Allergy Drug. Discov. 2019, 13, 134–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frickmann, H.; Schwarz, N.G.; Wiemer, D.F.; Fischer, M.; Tannich, E.; Scheid, P.L.; Müller, M.; Schotte, U.; Bock, W.; Hagen, R.M. Food and drinking water hygiene and intestinal protozoa in deployed German soldiers. Eur. J. Microbiol. Immunol. 2013, 3, 53–60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frickmann, H.; Warnke, P.; Frey, C.; Schmidt, S.; Janke, C.; Erkens, K.; Schotte, U.; Köller, T.; Maaßen, W.; Podbielski, A.; et al. Surveillance of Food- and Smear-Transmitted Pathogens in European Soldiers with Diarrhea on Deployment in the Tropics: Experience from the European Union Training Mission (EUTM) Mali. Biomed. Res. Int. 2015, 2015, 573904. [Google Scholar] [CrossRef] [Scilit]
- Halfter, M.; Müseler, U.; Hagen, R.M.; Frickmann, H. Enteric pathogens in German police officers after predominantly tropical deployments—A retrospective assessment over 5 years. Eur. J. Microbiol. Immunol. 2020, 10, 172–177. [Google Scholar] [CrossRef] [Scilit]
- Schawaller, M.; Wiemer, D.; Hagen, R.M.; Frickmann, H. Infectious diseases in German military personnel after predominantly tropical deployments: A retrospective assessment over 13 years. BMJ Mil. Health 2020. Epub ahead of print. [Google Scholar] [CrossRef] [Scilit]
- Wiemer, D.; Schwarz, N.G.; Burchard, G.D.; Frickmann, H.; Loderstaedt, U.; Hagen, R.M. Surveillance of enteropathogenic bacteria, protozoa and helminths in travellers returning from the tropics. Eur. J. Microbiol. Immunol. 2020, 10, 147–155. [Google Scholar] [CrossRef] [Scilit]
- Maaßen, W.; Wiemer, D.; Frey, C.; Kreuzberg, C.; Tannich, E.; Hinz, R.; Wille, A.; Fritsch, A.; Hagen, R.M.; Frickmann, H. Microbiological screenings for infection control in unaccompanied minor refugees: The German Armed Forces Medical Service’s experience. Mil. Med. Res. 2017, 4, 13. [Google Scholar] [CrossRef] [Scilit]
- Kann, S.; Bruennert, D.; Hansen, J.; Mendoza, G.A.C.; Gonzalez, J.J.C.; Quintero, C.L.A.; Hanke, M.; Hagen, R.M.; Backhaus, J.; Frickmann, H. High Prevalence of Intestinal Pathogens in Indigenous in Colombia. J. Clin. Med. 2020, 9, 2786. [Google Scholar] [CrossRef] [Scilit]
- Frickmann, H.; Schwarz, N.G.; Rakotozandrindrainy, R.; May, J.; Hagen, R.M. PCR for enteric pathogens in high-prevalence settings. What does a positive signal tell us? Infect. Dis. 2015, 47, 491–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Utzinger, J.; Botero-Kleiven, S.; Castelli, F.; Chiodini, P.L.; Edwards, H.; Köhler, N.; Gulletta, M.; Lebbad, M.; Manser, M.; Matthys, B.; et al. Microscopic diagnosis of sodium acetate-acetic acid-formalin-fixed stool samples for helminths and intestinal protozoa: A comparison among European reference laboratories. Clin. Microbiol. Infect. 2010, 16, 267–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frickmann, H.; Hoffmann, T.; Köller, T.; Hahn, A.; Podbielski, A.; Landt, O.; Loderstädt, U.; Tannich, E. Comparison of five commercial real-time PCRs for in-vitro diagnosis of Entamoeba histolytica, Giardia duodenalis, Cryptosporidium spp., Cyclospora cayetanensis, and Dientamoeba fragilis in human stool samples. Travel Med. Infect. Dis. 2021, 41, 102042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landis, J.R.; Koch, G.G. The measurement of observer agreement for categorical data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds-a review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef] [Scilit]
- Loderstädt, U.; Hagen, R.M.; Hahn, A.; Frickmann, H. New Developments in PCR-Based Diagnostics for Bacterial Pathogens Causing Gastrointestinal Infections-A Narrative Mini-Review on Challenges in the Tropics. Trop. Med. Infect. Dis. 2021, 6, 96. [Google Scholar] [CrossRef] [Scilit]
- Kuk, S.; Yazar, S.; Cetinkaya, U. Stool sample storage conditions for the preservation of Giardia intestinalis DNA. Mem. Inst. Oswaldo Cruz 2012, 107, 965–968. [Google Scholar] [CrossRef] [Scilit]
- Adamska, M.; Leońska-Duniec, A.; Maciejewska, A.; Sawczuk, M.; Skotarczak, B. Comparison of efficiency of various DNA extraction methods from cysts of Giardia intestinalis measured by PCR and TaqMan real time PCR. Parasite 2010, 17, 299–305. [Google Scholar] [CrossRef] [Scilit]
- Heyworth, M.F. Giardia duodenalis genetic assemblages and hosts. Parasite 2016, 23, 13. [Google Scholar] [CrossRef] [Scilit]
- Lasek-Nesselquist, E.; Welch, D.M.; Sogin, M.L. The identification of a new Giardia duodenalis assemblage in marine vertebrates and a preliminary analysis of G. duodenalis population biology in marine systems. Int. J. Parasitol. 2010, 40, 1063–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Argüello-García, R.; Ortega-Pierres, M.G. Giardia duodenalis Virulence—“To Be, or Not To Be”. Curr. Trop. Med. Rep. 2021, 21, 246–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verweij, J.J.; Stensvold, C.R. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin. Microbiol. Rev. 2014, 27, 371–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guy, R.A.; Payment, P.; Krull, U.J.; Horgen, P.A. Real-time PCR for quantification of Giardia and Cryptosporidium in environmental water samples and sewage. Appl. Environ. Microbiol. 2003, 69, 5178–5185. [Google Scholar] [CrossRef] [Scilit]
- Verweij, J.J.; Blangé, R.A.; Templeton, K.; Schinkel, J.; Brienen, E.A.; van Rooyen, M.A.; van Lieshout, L.; Polderman, A.M. Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 2004, 42, 1220–1223. [Google Scholar] [CrossRef] [Scilit]
- Shin, J.H.; Lee, S.E.; Kim, T.S.; Ma, D.W.; Cho, S.H.; Chai, J.Y.; Shin, E.H. Development of Molecular Diagnosis Using Multiplex Real-Time PCR and T4 Phage Internal Control to Simultaneously Detect Cryptosporidium parvum, Giardia lamblia, and Cyclospora cayetanensis from Human Stool Samples. Korean J. Parasitol. 2018, 56, 419–427. [Google Scholar] [CrossRef] [Scilit]
- Alonso, J.L.; Amorós, I.; Cuesta, G. LNA probes in a real-time TaqMan PCR assay for genotyping of Giardia duodenalis in wastewaters. J. Appl. Microbiol. 2010, 108, 1594–1601. [Google Scholar] [CrossRef] [Scilit]
- Elwin, K.; Fairclough, H.V.; Hadfield, S.J.; Chalmers, R.M. Giardia duodenalis typing from stools: A comparison of three approaches to extracting DNA, and validation of a probe-based real-time PCR typing assay. J. Med. Microbiol. 2014, 63, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Almeida, A.; Pozio, E.; Cacciò, S.M. Genotyping of Giardia duodenalis cysts by new real-time PCR assays for detection of mixed infections in human samples. Appl. Environ. Microbiol. 2010, 76, 1895–1901. [Google Scholar] [CrossRef] [Scilit]
- Haque, R.; Roy, S.; Siddique, A.; Mondal, U.; Rahman, S.M.; Mondal, D.; Houpt, E.; Petri, W.A., Jr. Multiplex real-time PCR assay for detection of Entamoeba histolytica, Giardia intestinalis, and Cryptosporidium spp. Am. J. Trop. Med. Hyg. 2007, 76, 713–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amar, C.F.L.; Dear, P.H.; McLauchlin, J. Detection and genotyping by real-time PCR/RFLP analyses of Giardia duodenalis from human faeces. J. Med. Microbiol. 2003, 52, 681–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meggiolaro, M.N.; Roeber, F.; Kobylski, V.; Higgins, D.P.; Šlapeta, J. Comparison of multiplexed-tandem real-time PCR panel with reference real-time PCR molecular diagnostic assays for detection of Giardia intestinalis and Tritrichomonas foetus in cats. Vet. Parasitol. 2019, 266, 12–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Shehri, H.; LaCourse, J.E.; Klimach, O.; Kabatereine, N.B.; Stothard, J.R. Molecular characterisation and taxon assemblage typing of giardiasis in primary school children living close to the shoreline of Lake Albert, Uganda. Parasite Epidemiol. Control. 2018, 4, e00074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adamska, M.; Leońska-Duniec, A.; Maciejewska, A.; Sawczuk, M.; Skotarczak, B. Recovery of DNA of Giardia intestinalis cysts from surface water concentrates measured with PCR and real time PCR. Parasite 2011, 18, 341–343. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Gratz, J.; Amour, C.; Kibiki, G.; Becker, S.; Janaki, L.; Verweij, J.J.; Taniuchi, M.; Sobuz, S.U.; Haque, R.; et al. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J. Clin. Microbiol. 2013, 51, 472–480. [Google Scholar] [CrossRef] [Scilit]
- Qu, Y.; Tan, M.; Kutner, M.H. Random effects models in latent class analysis for evaluating accuracy of diagnostic tests. Biometrics 1996, 52, 797–810. [Google Scholar] [CrossRef] [Scilit]
- Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated with Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [CrossRef] [Scilit]
- Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori Infection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar] [CrossRef] [Scilit]
- Tanida, K.; Hahn, A.; Eberhardt, K.A.; Tannich, E.; Landt, O.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens 2021, 10, 656. [Google Scholar] [CrossRef] [Scilit]
- Blohm, M.; Hahn, A.; Hagen, R.M.; Eberhardt, K.A.; Rohde, H.; Leboulle, G.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparison of Two Real-Time PCR Assays Targeting Ribosomal Sequences for the Identification of Cystoisospora belli in Human Stool Samples. Pathogens 2021, 10, 1053. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinreich, F.; Hahn, A.; Hagen, R.M.; Eberhardt, K.A.; Rohde, H.; Leboulle, G.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparison of Three Real-Time PCR Assays Targeting the SSU rRNA Gene, the COWP Gene and the DnaJ-Like Protein Gene for the Diagnosis of Cryptosporidium spp. in Stool Samples. Pathogens 2021, 10, 1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinreich, F.; Hahn, A.; Eberhardt, K.A.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; Loderstädt, U. Comparison of Three Real-Time PCR Assays for the Detection of Cyclospora cayetanensis in Stool Samples Targeting the 18S rRNA Gene and the hsp70 Gene. Pathogens 2021, 11, 165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krumkamp, R.; Sarpong, N.; Schwarz, N.G.; Adlkofer, J.; Loag, W.; Eibach, D.; Hagen, R.M.; Adu-Sarkodie, Y.; Tannich, E.; May, J. Gastrointestinal infections and diarrheal disease in Ghanaian infants and children: An outpatient case-control study. PLoS Negl. Trop. Dis. 2015, 9, e0003568. [Google Scholar]
- Eibach, D.; Krumkamp, R.; Hahn, A.; Sarpong, N.; Adu-Sarkodie, Y.; Leva, A.; Käsmaier, J.; Panning, M.; May, J.; Tannich, E. Application of a multiplex PCR assay for the detection of gastrointestinal pathogens in a rural African setting. BMC Infect. Dis. 2016, 16, 150. [Google Scholar] [CrossRef] [Scilit]
- Kann, S.; Hartmann, M.; Alker, J.; Hansen, J.; Dib, J.C.; Aristizabal, A.; Concha, G.; Schotte, U.; Kreienbrock, L.; Frickmann, H. Seasonal Patterns of Enteric Pathogens in Colombian Indigenous People—A More Pronounced Effect on Bacteria Than on Parasites. Parasites 2022, 11, 214. [Google Scholar] [CrossRef] [Scilit]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [Scilit]
- Niesters, H.G. Quantitation of viral load using real-time amplification techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef] [Scilit]
- Solarczyk, P.; Wojtkowiak-Giera, A.; Holysz, M.; Slodkowicz-Kowalska, A.; Jagodzinski, P.P.; Stojecki, K.; Rocka, A.; Majewska, A.C.; Skrzypczak, L. New primers for fast detection of Giardia duodenalis assemblages A & B using real-time PCR. Acta Protozool. 2018, 57, 43–48. [Google Scholar]
| Assay | Positives (%) | Sensitivity (0.95 CI) | Specificity (0.95 CI) | Kappa (0.95 CI) |
|---|---|---|---|---|
| 18S rRNA gene | 63 (7.22) | 1 (0, 1) | 1 (n.e.) | 0.155 (0.110, 0.205) |
| gdh | 73 (8.37) | 0.175 (0.099, 0.288) | 0.923 (0.903, 0.940) | |
| bg | 20 (2.29) | 0.317 (0.215, 0.441) | 1 (n.e.) | |
| Prevalence (0.95 CI) | 7.22% (5.69%, 9.14%) | |||
| Assay | Positives (%) | Sensitivity (0.95 CI) | Specificity (0.95 CI) | Kappa (0.95 CI) |
|---|---|---|---|---|
| bg of assemblage A without LNA | 8 (15.09) | 1 (0, 1) | 1 (0, 1) | 0.908 (0.737, 1) |
| bg of assemblage A with LNA | 9 (16.98) | 1 (0, 1) | 0.978 (0.858, 0.997) | |
| tri of assemblage A | 9 (16.98) | 1 (0, 1) | 0.978 (0.858, 0.997) | |
| Prevalence (0.95 CI) | 15.07% (7.72%, 27.36)) | |||
| bg of assemblage B without LNA | 28 (52.83) | 1 (0, 1) | 1 (0, 1) | 0.748 (0.622, 0.874) |
| bg of assemblage B with LNA | 31 (58.49) | 0.964 (0.786, 0.995) | 0.840 (0.643, 0.940) | |
| tri of assemblage B | 23 (43.40) | 0.821 (0.636, 0.924) | 1 (n.e.) | |
| Prevalence (0.95 CI) | 52.82% (39.51%, 65.76%) | |||
| Assay | n | Mean (SD) | Median (IQR) |
|---|---|---|---|
| 18S rRNA gene | 63 | 28.74 (4.92) | 29.91 (26.53, 32.53) |
| gdh | 73 | 30.39 (2.20) | 30.45 (28.84, 31.58) |
| bg | 20 | 28.32 (3.45) | 28.24 (26.58, 30.98) |
| Assay | n | Mean (SD) | Median (IQR) |
|---|---|---|---|
| bg of assemblage A without LNA | 8 | 27.38 (3.50) | 27.47 (23.95, 31.02) |
| bg of assemblage A with LNA | 9 | 28.39 (4.13) | 28.34 (26.60, 30.24) |
| tri of assemblage A | 9 | 28.66 (3.93) | 29.68 (24.52, 31.60) |
| bg of assemblage B without LNA | 28 | 29.86 (3.45) | 30.38 (28.14, 31.67) |
| bg of assemblage B with LNA | 31 | 30.81 (3.83) | 30.85 (28.16, 34.49) |
| tri of assemblage B | 23 | 30.24 (3.16) | 30.80 (28.38, 32.30) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weinreich, F.; Hahn, A.; Eberhardt, K.A.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; Loderstädt, U. Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B. Microorganisms 2022, 10, 1310. https://doi.org/10.3390/microorganisms10071310
Weinreich F, Hahn A, Eberhardt KA, Kann S, Feldt T, Sarfo FS, Di Cristanziano V, Frickmann H, Loderstädt U. Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B. Microorganisms. 2022; 10(7):1310. https://doi.org/10.3390/microorganisms10071310
Chicago/Turabian StyleWeinreich, Felix, Andreas Hahn, Kirsten Alexandra Eberhardt, Simone Kann, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Hagen Frickmann, and Ulrike Loderstädt. 2022. "Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B" Microorganisms 10, no. 7: 1310. https://doi.org/10.3390/microorganisms10071310
APA StyleWeinreich, F., Hahn, A., Eberhardt, K. A., Kann, S., Feldt, T., Sarfo, F. S., Di Cristanziano, V., Frickmann, H., & Loderstädt, U. (2022). Comparative Evaluation of Real-Time Screening PCR Assays for Giardia duodenalis and of Assays Discriminating the Assemblages A and B. Microorganisms, 10(7), 1310. https://doi.org/10.3390/microorganisms10071310

