Probiotics Reduce Vaginal Candidiasis in Pregnant Women via Modulating Abundance of Candida and Lactobacillus in Vaginal and Cervicovaginal Regions
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Population
2.2. Vaginal Swabs and Cervicovaginal Lavages
2.3. Abundance of Candida and Lactobacillus Species
2.4. Inflammatory Proteins
2.5. Statistical Analyses
3. Results
3.1. Baseline Characteristics
3.2. Abundance of Candida
3.3. Abundance of Lactobacillus
3.4. Inflammatory Proteins
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Willems, H.M.E.; Ahmed, S.S.; Liu, J.; Xu, Z.; Peters, B.M. Vulvovaginal Candidiasis: A Current Understanding and Burning Questions. J. Fungi 2020, 6, 27. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kalia, N.; Singh, J.; Kaur, M. Immunopathology of Recurrent Vulvovaginal Infections: New Aspects and Research Directions. Front Immunol. 2019, 10, 10. [Google Scholar] [CrossRef] [PubMed]
- Jeanmonod, R.; Jeanmonod, D. Vaginal Candidiasis (Vulvovaginal Candidiasis). In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2020. [Google Scholar]
- Okonkwo, N.; Umeanaeto, P. Prevalence of Vaginal Candidiasis among Pregnant Women in Nnewi Town of Anambra State, Nigeria: A Recent Perspective. In Theory and Applications of Microbiology and Biotechnology; Okonkwo, N., Umeanaeto, P., Eds.; Book Publisher International: West Bengal, India, 2020; Volume 3, pp. 160–168. [Google Scholar]
- Rasti, S.; Asadi, M.A.; Taghriri, A.; Behrashi, M.; Mousavie, G. Vaginal Candidiasis Complications on Pregnant Women. Jundishapur J. Microbiol. 2014, 7, e10078. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sobel, J.D. Vulvovaginal candidosis. Lancet Lond. Engl. 2007, 369, 1961–1971. [Google Scholar] [CrossRef]
- Mathema, B.; Cross, E.; Dun, E.; Park, S.; Bedell, J.; Slade, B.; Williams, M.; Riley, L.; Chaturvedi, V.; Perlin, D.S. Prevalence of Vaginal Colonization by Drug-Resistant Candida Species in College-Age Women with Previous Exposure to Over-the-Counter Azole Antifungals. Clin. Infect. Dis. 2001, 33, e23–e27. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ang, X.-Y.; Chung, F.-Y.-L.; Lee, B.-K.; Azhar, S.N.A.; Sany, S.; Roslan, N.S.; Ahmad, N.; Yusof, S.M.; Abdullah, N.; Rahman, N.N.N.A.; et al. Lactobacilli Reduce Recurrences of Vaginal Candidiasis in Pregnant Women: A Randomized, Double-Blind, Placebo-Controlled Study. J. Appl. Microbiol. 2021. [Google Scholar] [CrossRef]
- Nutrition Division. Probiotics in Food: Health and Nutritional Properties and Guidelines for Evaluation—Report of a Joint FAO/WHO Expert Consultation on Evaluation of Health and Nutritional Properties of Probiotics in Food Including Powder Milk with Live Lactic Acid Bacteria [Internet]; FAO Food and Nutrition Paper; FAO/WHO: Rome, Italy, 2006; 56p. Available online: https://www.fao.org/publications/card/en/c/7c102d95-2fd5-5b22-8faf-f0b2e68dfbb6/ (accessed on 13 December 2021).
- Hor, Y.-Y.; Lew, L.-C.; Lau, A.S.-Y.; Ong, J.-S.; Chuah, L.-O.; Lee, Y.-Y.; Choi, S.; Rashid, F.; Wahid, N.; Sun, Z.; et al. Probiotic Lactobacillus casei Zhang (LCZ) alleviates respiratory, gastrointestinal & RBC abnormality via immuno-modulatory, anti-inflammatory & anti-oxidative actions. J. Funct. Foods. 2018, 44, 235–245. [Google Scholar]
- Liong, M.T.; Shah, N.P. Acid and Bile Tolerance and Cholesterol Removal Ability of Lactobacilli Strains. J. Dairy Sci. 2005, 88, 55–66. [Google Scholar] [CrossRef][Green Version]
- Liu, Y.-W.; Liong, M.-T.; Tsai, Y.-C. New perspectives of Lactobacillus plantarum as a probiotic: The gut-heart-brain axis. J. Microbiol. 2018, 56, 601–613. [Google Scholar] [CrossRef]
- Chang, I.J.; Lin, J.S.; Chu, M.T.; Li, H.F. A Novel Strain of lactobacillus and Its Use in Inhibition of Vaginitis. TWI412371B, 21 October 2013. [Google Scholar]
- Zhang, Y.; Li, X.; Zhu, M.; Lin, J. Lactobacillus for Inhibiting Pathogenic Bacteria of Vaginitis and Application Thereof. CN103409334, 20 July 2018. [Google Scholar]
- Ishida, K.; Yamaguchi, M.U.; Nakamura, T.U.; Dias Filho, B.P.; Yamada-Ogatta, S.F.; Nakamura, C.V. Desempenho dos métodos de identificação de leveduras de água engarrafada: Alta prevalência de Candida parapsilosis. Semin. Ciênc. Biol. E Saúde 2013, 34, 205. [Google Scholar] [CrossRef][Green Version]
- Byun, R.; Nadkarni, M.A.; Chhour, K.-L.; Martin, F.E.; Jacques, N.A.; Hunter, N. Quantitative Analysis of Diverse Lactobacillus Species Present in Advanced Dental Caries. J. Clin. Microbiol. 2004, 42, 3128–3136. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Berza, N.; Zodzika, J.; Kroica, J.; Reinis, A.; Skadins, I.; Zalizko, P.; Melngaile, O.; Pundure, R.; Lukojanova, I.; Vasina, O. Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in small population of pregnant Latvian women. Int. J. Collab. Res. Intern. Med. Public Health 2013, 5, 10. [Google Scholar]
- Olson, B.J.S.C.; Markwell, J. Assays for Determination of Protein Concentration. Curr. Protoc. Protein Sci. 2007, 48, 3.4.1–3.4.29. [Google Scholar] [CrossRef] [PubMed]
- Aguin, T.J.; Sobel, J.D. Vulvovaginal candidiasis in pregnancy. Curr. Infect. Dis. Rep. 2015, 17, 462. [Google Scholar] [CrossRef]
- Meizoso, T.; Rivera, T.; Fernández-Aceñero, M.J.; Mestre, M.J.; Garrido, M.; Garaulet, C. Intrauterine candidiasis: Report of four cases. Arch Gynecol. Obstet. 2008, 278, 173–176. [Google Scholar] [CrossRef]
- Costa, C.; Ribeiro, J.; Miranda, I.M.; Silva-Dias, A.; Cavalheiro, M.; Costa-de-Oliveira, S.; Rodrigues, A.G.; Teixeira, M.C. Clotrimazole Drug Resistance in Candida glabrata Clinical Isolates Correlates with Increased Expression of the Drug:H+ Antiporters CgAqr1, CgTpo1_1, CgTpo3, and CgQdr2. Front. Microbiol. 2016, 7, 526. [Google Scholar] [CrossRef]
- Biswas, S.K.; Chaffin, W.L. Anaerobic Growth of Candida albicans Does Not Support Biofilm Formation Under Similar Conditions Used for Aerobic Biofilm. Curr. Microbiol. 2005, 51, 100–104. [Google Scholar] [CrossRef]
- Janus, M.M.; Crielaard, W.; Volgenant, C.M.C.; van der Veen, M.H.; Brandt, B.W.; Krom, B.P. Candida albicans alters the bacterial microbiome of early in vitro oral biofilms. J. Oral. Microbiol. 2017, 9, 1270613. [Google Scholar] [CrossRef][Green Version]
- Superti, F.; De Seta, F. Warding Off Recurrent Yeast and Bacterial Vaginal Infections: Lactoferrin and Lactobacilli. Microorganisms 2020, 8, 130. [Google Scholar] [CrossRef][Green Version]
- Chee, W.J.Y.; Chew, S.Y.; Than, L.T.L. Vaginal microbiota and the potential of Lactobacillus derivatives in maintaining vaginal health. Microb. Cell Fact. 2020, 19, 203. [Google Scholar] [CrossRef]
- Ardizzoni, A.; Wheeler, R.T.; Pericolini, E. It Takes Two to Tango: How a Dysregulation of the Innate Immunity, Coupled With Candida Virulence, Triggers VVC Onset. Front. Microbiol. 2021, 12, 1449. [Google Scholar] [CrossRef] [PubMed]
- Tham, C.S.-C.; Peh, K.-K.; Bhat, R.; Liong, M.-T. Probiotic properties of bifidobacteria and lactobacilli isolated from local dairy products. Ann. Microbiol. 2012, 62, 1079–1087. [Google Scholar] [CrossRef]
- Fung, W.-Y.; Liong, M.-T. Evaluation of proteolytic and ACE-inhibitory activity of Lactobacillus acidophilus in soy whey growth medium via response surface methodology. LWT 2010, 43, 563–567. [Google Scholar] [CrossRef]
Microorganism | Sequence (5′-3′) | Reference | |
---|---|---|---|
C. albicans | C. albicans-F | ATTGCTTGCGGCGGTAACGTCC | [15] |
Candida spp-R | TCTTTTCCTCCGCTTATTGATATGC | ||
C. glabrata | C. glabrata-F | TAGGTTTTACCAACTCGGTGTT | |
Candida spp-R | TCTTTTCCTCCGCTTATTGATATGC | ||
L. crispatus | L. crispatus-F | AGCGAGCGGAACTAACAGATTTAC | [16] |
L. crispatus-R | AGCTGATCATGCGATCTGCTT | ||
L. jensenii | L. jensenii-F | AAGTCGAGCGAGCTTGCCTATAGA | [17] |
L. jensenii-R | CTTCTTTCATGCGAAAGTAGC |
Week 0 | Week 4 | Week 8 | |||||||
---|---|---|---|---|---|---|---|---|---|
Baseline Characteristics | Placebo | Probiotic | p Value | Placebo | Probiotic | p Value | Placebo | Probiotic | p Value |
Sample size (n) | 39 | 38 | 37 | 38 | 25 | 31 | |||
Trimester period | 23.56 ± 0.96 | 23.76 ± 0.88 | 0.996 | 27.38 ± 0.99 | 27.71 ± 0.89 | 0.890 | 31.40 ± 1.06 | 30.71 ± 0.92 | 0.614 |
Age | 28.38 ± 0.82 | 28.89 ± 0.72 | 0.553 | 28.41 ± 0.82 | 28.87 ± 0.71 | 0.580 | 28.20 ± 1.04 | 29.16 ± 0.74 | 0.257 |
Body weight (kg) | 62.10 ± 1.81 | 66.55 ± 2.65 | 0.239 | 62.38 ± 1.90 | 66.79 ± 2.61 | 0.259 | 62.08 ± 2.47 | 65.45 ± 3.07 | 0.531 |
Height (cm) | 155.32 ± 1.12 | 156.59 ± 0.96 | 0.635 | 155.09 ± 1.16 | 156.30 ± 0.96 | 0.663 | 154.06 ± 1.46 | 155.98 ± 1.10 | 0.557 |
BMI | 25.89 ± 0.88 | 26.99 ± 0.93 | 0.227 | 26.08 ± 0.91 | 27.17 ± 0.90 | 0.233 | 26.26 ± 1.16 | 26.75 ± 1.09 | 0.510 |
Sample Type | Abundance (Log CFU/mL qPCR) | Placebo | Probiotic | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Weeks | p Value | Weeks | p Value | ||||||||||
WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | ||
Low vaginal swab (LVS) | Candida albicans | 4.451 ± 0.108 | 4.331 ± 0.104 | 4.343 ± 0.137 | 0.556 | 0.357 | 0.779 | 4.480 ± 0.148 | 4.351 ± 0.167 | 4.332 ± 0.153 | 0.341 | 0.458 | 0.787 |
Candida glabrata | 2.045 ± 0.093 | 1.987 ± 0.096 | 2.041 ± 0.115 | 0.384 | 0.770 | 0.327 | 1.918 ± 0.055 | 1.932 ± 0.069 | 1.666 ± 0.072 | 0.485 | 0.009 * | 0.006 * | |
High vaginal swab (HVS) | Candida albicans | 4.076 ± 0.129 | 3.615 ± 0.167 | 3.688 ± 0.222 | 0.004 * | 0.148 | 0.451 | 4.691 ± 0.162 | 4.112± 0.179 | 3.973 ± 0.184 | 0.011 * | 0.005 * | 0.691 |
Candida glabrata | 1.688 ± 0.113 | 1.419 ± 0.146 | 1.416 ± 0.189 | 0.082 | 0.070 | 0.818 | 1.689 ± 0.094 | 1.340± 0.108 | 1.499 ± 0.123 | 0.010 * | 0.046 * | 0.462 | |
Cervico vaginal lavage (CVL) | Candida albicans | 4.615 ± 0.083 | 3.678 ± 0.116 | 4.207 ± 0.100 | <0.001 * | 0.001 * | <0.001 * | 4.375 ± 0.110 | 4.361 ± 0.106 | 3.816 ± 0.180 | 0.446 | 0.010 * | 0.003 * |
Candida glabrata | 2.009 ± 0.096 | 1.472 ± 0.125 | 1.821 ± 0.158 | 0.001 * | 0.309 | 0.035 * | 1.823 ± 0.733 | 1.916 ± 0.086 | 1.559 ± 0.110 | 0.328 | 0.008 * | 0.005 * |
Sample Type | Abundance (Log CFU/mL qPCR) | Placebo | Probiotic | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Weeks | p Value | Weeks | p Value | ||||||||||
WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | ||
Low vaginal swab (LVS) | Lactobacillus jensenii | 4.038 ± 0.180 | 4.196 ± 0.208 | 3.998 ± 0.229 | 0.644 | 0.624 | 0.976 | 3.566 ± 0.166 | 3.987 ± 0.187 | 4.297 ± 0.203 | 0.826 | 0.059 | 0.158 |
Lactobacillus crispatus | 4.384 ± 0.207 | 3.715 ± 0.334 | 4.228 ± 0.308 | 0.023 * | 0.319 | 0.110 | 3.673 ± 0.300 | 4.161 ± 0.315 | 4.343 ± 0.298 | 0.111 | 0.012 * | 0.407 | |
High vaginal swab (HVS) | Lactobacillus jensenii | 4.127 ± 0.174 | 4.492 ± 0.225 | 4.273 ± 0.198 | 0.382 | 0.553 | 0.943 | 3.893 ± 0.126 | 3.963 ± 0.178 | 3.973 ± 0.184 | 0.826 | 0.059 | 0.158 |
Lactobacillus crispatus | 4.603 ± 0.219 | 4.749 ± 0.191 | 4.785 ± 0.276 | 0.433 | 0.372 | 0.809 | 5.117 ± 0.215 | 4.834 ± 0.224 | 4.811 ± 0.214 | 0.310 | 0.467 | 0.504 | |
Cervico vaginal lavage (CVL) | Lactobacillus jensenii | 4.180 ± 0.210 | 3.774 ± 0.214 | 3.209 ± 0.292 | 0.026 * | 0.001 * | 0.020 * | 3.205 ± 0.181 | 4.108 ± 0.133 | 3.305 ± 0.257 | <0.001 * | 0.572 | <0.001 * |
Lactobacillus crispatus | 3.450 ± 0.355 | 3.978 ± 0.295 | 4.140 ± 0.353 | 0.173 | 0.124 | 0.668 | 4.174 ± 0.304 | 4.130 ± 0.281 | 4.451 ± 0.277 | 0.937 | 0.095 | 0.098 |
Sample Type | Inflammatory Proteins | Placebo | Probiotic | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Weeks | p Value | Weeks | p Value | ||||||||||
WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | WO | W4 | W8 | W0 vs. W4 | W0 vs. W8 | W4 vs. W8 | ||
Low vaginal swab (LVS) | IFN-gamma (pg/ug protein) | 2.057 ± 0.216 | 2.113 ± 0.159 | 1.021 ± 0.091 | 0.394 | <0.000 * | <0.000 * | 2.730 ± 0.169 | 2.132 ± 0.127 | 2.026 ± 0.205 | 0.011 * | 0.004 * | 0.321 |
TNF-alpha (ng/ug protein) | 0.706 ± 0.070 | 1.234 ± 0.228 | 1.428 ± 0.177 | 0.007 * | <0.000 * | <0.000 * | 0.746 ± 0.115 | 2.440 ± 0.476 | 1.249 ± 0.052 | <0.000 * | <0.000 * | 0.217 | |
IL-4 (pg/ug protein) | 0.932 ± 0.053 | 0.913 ± 0.049 | 0.390 ± 0.022 | 0.779 | <0.000 * | <0.000 * | 0.622 ± 0.328 | 1.171 ± 0.058 | 0.402 ± 0.020 | <0.000 * | <0.000 * | <0.000 * | |
IL-10 (pg/ug protein) | 0.612 ± 0.080 | 0.581 ± 0.099 | 0.227 ± 0.024 | 0.934 | <0.000 * | <0.000 * | 0.403 ± 0.025 | 1.642 ± 0.361 | 0.203 ± 0.019 | <0.000 * | <0.000 * | <0.000 * | |
High vaginal swab (HVS) | IFN-gamma (pg/ug protein) | 3.137 ± 0.209 | 3.747 ± 0.237 | 1.261 ± 0.075 | 0.071 | <0.000 * | <0.000 * | 3.839 ± 0.233 | 3.732 ± 0.164 | 1.230 ± 0.068 | 0.988 | <0.000 * | <0.000 * |
TNF-alpha (ng/ug protein) | 0.779 ± 0.066 | 1.572 ± 0.115 | 2.836 ± 1.152 | <0.000 * | <0.000 * | 0.181 | 0.577 ± 0.039 | 2.003 ± 0.125 | 1.678 ± 0.118 | <0.000 * | <0.000 * | 0.018 * | |
IL-4 (pg/ug protein) | 1.357 ± 0.095 | 0.420 ± 0.049 | 0.483 ± 0.044 | <0.000 * | <0.000 * | 0.026 * | 1.180 ± 0.068 | 0.629 ± 0.032 | 0.488 ± 0.053 | <0.000 * | <0.000 * | 0.001 * | |
IL-10 (pg/ug protein) | 0.867 ± 0.051 | 0.905 ± 0.149 | 1.600 ± 0.143 | 0.028 * | <0.000 * | <0.000 * | 0.588 ± 0.043 | 0.836 ± 0.061 | 0.964 ± 0.104 | 0.001 * | <0.000 * | 0.745 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ang, X.Y.; Mageswaran, U.M.; Chung, Y.L.F.; Lee, B.K.; Azhar, S.N.A.; Roslan, N.S.; Saufian, I.F.B.; Mustaffa, N.S.; Kalam, E.M.; Ibrahim, A.F.; Abdul Wahid, N.; Deris, Z.Z.; Oon, C.-E.; Adnan, W.F.W.; Sany, S.; Liong, M.-T. Probiotics Reduce Vaginal Candidiasis in Pregnant Women via Modulating Abundance of Candida and Lactobacillus in Vaginal and Cervicovaginal Regions. Microorganisms 2022, 10, 285. https://doi.org/10.3390/microorganisms10020285
Ang XY, Mageswaran UM, Chung YLF, Lee BK, Azhar SNA, Roslan NS, Saufian IFB, Mustaffa NS, Kalam EM, Ibrahim AF, Abdul Wahid N, Deris ZZ, Oon C-E, Adnan WFW, Sany S, Liong M-T. Probiotics Reduce Vaginal Candidiasis in Pregnant Women via Modulating Abundance of Candida and Lactobacillus in Vaginal and Cervicovaginal Regions. Microorganisms. 2022; 10(2):285. https://doi.org/10.3390/microorganisms10020285
Chicago/Turabian StyleAng, Xin Yee, Uma Mageswary Mageswaran, Yi Li Fiona Chung, Boon Kiat Lee, Siti Nur Afiqah Azhar, Nurhanis Syazni Roslan, Ili Farhana Binti Saufian, Nor Sheila Mustaffa, Ermadina Mohamad Kalam, Aini Farhah Ibrahim, Normala Abdul Wahid, Zakuan Zainy Deris, Chern-Ein Oon, Wan Fadhlina Wan Adnan, Salina Sany, and Min-Tze Liong. 2022. "Probiotics Reduce Vaginal Candidiasis in Pregnant Women via Modulating Abundance of Candida and Lactobacillus in Vaginal and Cervicovaginal Regions" Microorganisms 10, no. 2: 285. https://doi.org/10.3390/microorganisms10020285