Natural Variation and the Role of Zn2Cys6 Transcription Factors SdrA, WarA and WarB in Sorbic Acid Resistance of Aspergillus niger
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Growth Conditions
2.2. Sorbic Acid Sensitivity Screening by Liquid Assay
2.3. Weak-Acid Sensitivity Screening by Spot Assays
2.4. CRISPR/Cas9 Genome Editing in A. niger
3. Results
3.1. Natural Variation of Sorbic Acid Resistance among 100 A. niger Sensu Stricto Strains
3.2. Genome Sequencing and SNP Analysis of the Most Sorbic-Acid-Sensitive Strain CBS147320
3.3. Screening for Transcription Factors That Are Related to Weak-Acid Stress Resistance
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Snyder, A.B.; Churey, J.J.; Worobo, R.W. Association of fungal genera from spoiled processed foods with physicochemical food properties and processing conditions. Food Microbiol. 2019, 83, 211–218. [Google Scholar] [CrossRef]
- Rico-Munoz, E.; Samson, R.A.; Houbraken, J. Mould spoilage of foods and beverages: Using the right methodology. Food Microbiol. 2019, 81, 51–62. [Google Scholar] [CrossRef] [PubMed]
- Stratford, M.; Steels, H.; Nebe-von-Caron, G.; Novodvorska, M.; Hayer, K.; Archer, D.B. Extreme resistance to weak-acid preservatives in the spoilage yeast Zygosaccharomyces bailii. Int. J. Food Microbiol. 2013, 166, 126–134. [Google Scholar] [CrossRef]
- Agriopoulou, S.; Stamatelopoulou, E.; Varzakas, T. Advances in occurrence, importance, and mycotoxin control strategies: Prevention and detoxification in foods. Foods. 2020, 9, 137. [Google Scholar] [CrossRef] [PubMed]
- Gould, G.W. New Methods of Food Preservation, 1st ed.; Springer: Boston, MA, USA, 1995. [Google Scholar]
- Plumridge, A.; Hesse, S.J.A.; Watson, A.J.; Lowe, K.C.; Stratford, M.; Archer, D.B. The weak acid preservative sorbic acid inhibits conidial germination and mycelial growth of Aspergillus niger through intracellular acidification. Appl. Environ. Microbiol. 2004, 70, 3506–3511. [Google Scholar] [CrossRef]
- Chichester, D.F.; Tanner, F.W., Jr. Handbook of Food Additives; CRC Press: Cleveland, OH, USA, 1972; pp. 142–147. [Google Scholar]
- Piper, J.D.; Piper, P.W. Benzoate and sorbate salts: A systematic review of the potential hazards of these invaluable preservatives and the expanding spectrum of clinical uses for sodium benzoate. Compr. Rev. Food Sci. Food Saf. 2017, 16, 868–880. [Google Scholar] [CrossRef] [PubMed]
- Dijksterhuis, J.; Meijer, M.; van Doorn, T.; Houbraken, J.; Bruinenberg, P. The preservative propionic acid differentially affects survival of conidia and germ tubes of feed spoilage fungi. Int. J. Food Microbiol. 2019, 306, 108258. [Google Scholar] [CrossRef]
- Dagnas, S.; Gauvry, E.; Onno, B.; Membré, J.M. Quantifying effect of lactic, acetic, and propionic acids on growth of molds isolated from spoiled bakery products. J. Food Prot. 2015, 78, 1689–1698. [Google Scholar] [CrossRef]
- Nielsen, M.K.; Arneborg, N. The effect of citric acid and pH on growth and metabolism of anaerobic Saccharomyces cerevisiae and Zygosaccharomyces bailii cultures. Food Microbiol. 2007, 24, 101–105. [Google Scholar] [CrossRef]
- Jorge, K. SOFT DRINKS|Chemical Composition. In Encyclopedia of Food Sciences and Nutrition, 2nd ed.; Caballero, B., Ed.; Academic Press: Cambridge, MA, USA, 2003; pp. 5346–5352. [Google Scholar]
- Efsa, A.P. Scientific opinion on the re-evaluation of sorbic acid (E 200), potassium sorbate (E 202) and calcium sorbate (E 203) as food additives. EFSA J. 2015, 13, 4144. [Google Scholar]
- Neal, A.L.; Weinstock, J.O.; Lampen, J.O. Mechanisms of fatty acid toxicity for yeast. J. Bacteriol. 1965, 90, 126–131. [Google Scholar] [CrossRef]
- Stratford, M.; Rose, A.H. Transport of sulphur dioxide by Saccharomyces cerevisiae. Microbiology 1986, 132, 1–6. [Google Scholar] [CrossRef]
- Macris, B.J. Mechanism of benzoic acid uptake by Saccharomyces cerevisiae. Appl. Microbiol. 1975, 30, 503–506. [Google Scholar] [CrossRef]
- Pearce, A.K.; Booth, I.R.; Brown, A.J.P. Genetic manipulation of 6-phosphofructo-1-kinase and fructose 2,6-bisphosphate levels affects the extent to which benzoic acid inhibits the growth of Saccharomyces cerevisiae. Microbiology 2001, 147, 403–410. [Google Scholar] [CrossRef][Green Version]
- Krebs, H.A.; Wiggins, D.; Stubbs, M.; Sols, A.; Bedoya, F. Studies on the mechanism of the antifungal action of benzoate. Biochem. J. 1983, 214, 657–663. [Google Scholar] [CrossRef]
- Lambert, R.J.; Stratford, M. Weak-acid preservatives: Modelling microbial inhibition and response. J. Appl. Microbiol. 1999, 86, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Stratford, M.; Vallières, C.; Geoghegan, I.; Archer, D.; Avery, S. The preservative sorbic acid targets respiration, explaining the resistance of fermentative spoilage yeast species. mSphere 2020, 5, e00273-20. [Google Scholar] [CrossRef]
- Stratford, M.; Plumridge, A.; Nebe-von-Caron, G.; Archer, D.B. Inhibition of spoilage mould conidia by acetic acid and sorbic acid involves different modes of action, requiring modification of the classical weak-acid theory. Int. J. Food Microbiol. 2009, 136, 37–43. [Google Scholar] [CrossRef] [PubMed]
- Novodvorska, M.; Stratford, M.; Blythe, M.J.; Wilson, R.; Beniston, R.G.; Archer, D.B. Metabolic activity in dormant conidia of Aspergillus niger and developmental changes during conidial outgrowth. Fungal. Genet. Biol. 2016, 94, 23–31. [Google Scholar] [CrossRef]
- Alcano, M.d.J.; Jahn, R.C.; Scherer, C.D.; Wigmann, É.F.; Moraes, V.M.; Garcia, M.V.; Mallmann, C.A.; Copettia, M.V. Susceptibility of Aspergillus spp. to acetic and sorbic acids based on pH and effect of sub-inhibitory doses of sorbic acid on ochratoxin A production. Food Res. Int. 2016, 81, 25–30. [Google Scholar] [CrossRef]
- Marín, S.; Guynot, M.E.; Sanchis, V.; Arbonés, J.; Ramos, A.J. Aspergillus flavus, Aspergillus niger, and Penicillium corylophilum spoilage prevention of bakery products by means of weak-acid preservatives. J. Food Sci. 2002, 67, 2271–2277. [Google Scholar] [CrossRef]
- Levinskaite, L. Susceptibility of food-contaminating Penicillium genus fungi to some preservatives and disinfectants. Ann. Agric. Environ. Med. 2012, 19, 85–89. [Google Scholar]
- Garcia, M.V.; Garcia-Cela, E.; Magan, N.; Copetti, M.V.; Medina, A. Comparative growth inhibition of bread spoilage fungi by different preservative concentrations using a rapid turbidimetric assay system. Front Microbiol. 2021, 12, 1364. [Google Scholar] [CrossRef]
- Piper, P.; Mahé, Y.; Thompson, S.; Pandjaitan, R.; Holyoak, C.; Egner, R.; Mühlbauer, M.; Coote, P.; Kuchler, K. The Pdr12 ABC transporter is required for the development of weak organic acid resistance in yeast. EMBO J. 1998, 17, 4257–4265. [Google Scholar] [CrossRef]
- Mira, N.P.; Palma, M.; Guerreiro, J.F.; Sá-Correia, I. Genome-wide identification of Saccharomyces cerevisiae genes required for tolerance to acetic acid. Microb. Cell Fact. 2010, 9, 79. [Google Scholar] [CrossRef] [PubMed]
- Ullah, A.; Chandrasekaran, G.; Brul, S.; Smits, G.J. Yeast adaptation to weak acids prevents futile energy expenditure. Front. Microbiol. 2013, 4, 142. [Google Scholar] [CrossRef] [PubMed]
- Kren, A.; Mamnun, Y.M.; Bauer, B.E.; Schüller, C.; Wolfger, H.; Hatzixanthis, K.; Mollapour, M.; Gregori, C.; Piper, P.; Kuchler, K. War1p, a novel transcription factor controlling weak acid stress response in yeast. Mol. Cell Biol. 2003, 23, 1775–1785. [Google Scholar] [CrossRef]
- Plumridge, A.; Melin, P.; Stratford, M.; Novodvorska, M.; Shunburne, L.; Dyer, P.S.; Roubos, J.A.; Menke, H.; Stark, J.; Stam, H.; et al. The decarboxylation of the weak-acid preservative, sorbic acid, is encoded by linked genes in Aspergillus spp. Fungal Genet Biol. 2010, 47, 683–692. [Google Scholar] [CrossRef] [PubMed]
- Lubbers, R.J.M.; Dilokpimol, A.; Navarro, J.; Peng, M.; Wang, M.; Lipzen, A.; Ng, V.; Grigoriev, I.V.; Visser, J.; Hildén, K.S.; et al. Cinnamic acid and sorbic acid conversion are mediated by the same transcriptional regulator in Aspergillus niger. Front Bioeng Biotechnol. 2019, 7, 249. [Google Scholar] [CrossRef]
- Geoghegan, I.A.; Stratford, M.; Bromley, M.; Archer, D.B.; Avery, S.V. Weak acid resistance A (WarA), a novel transcription factor required for regulation of weak-acid resistance and spore-spore heterogeneity in Aspergillus niger. mSphere 2020, 5, e00685-19. [Google Scholar] [CrossRef] [PubMed]
- Meyer, V.; Arentshorst, M.; El-Ghezal, A.; Drews, A.C.; Kooistra, R.; van den Hondel, C.A.M.J.J.; Ram, A.F.J. Highly efficient gene targeting in the Aspergillus niger kusA mutant. J. Biotechnol. 2007, 128, 770–775. [Google Scholar] [CrossRef] [PubMed]
- Po, H.N.; Senozan, N.M. The Henderson-Hasselbalch equation: Its history and limitations. J. Chem. Educ. 2001, 78, 1499–1503. [Google Scholar] [CrossRef]
- Arentshorst, M.; Ram, A.F.J.; Meyer, V. Using non-homologous end-joining-deficient strains for functional gene analyses in filamentous fungi. Methods Mol. Biol. 2012, 835, 133–150. [Google Scholar]
- Van Leeuwe, T.M.; Arentshorst, M.; Ernst, T.; Alazi, E.; Punt, P.J.; Ram, A.F.J. Efficient marker free CRISPR/Cas9 genome editing for functional analysis of gene families in filamentous fungi. Fungal. Biol. Biotechnol. 2019, 6, 13. [Google Scholar] [CrossRef]
- Nødvig, C.S.; Nielsen, J.B.; Kogle, M.E.; Mortensen, U.H. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 2015, 10, e0133085. [Google Scholar] [CrossRef]
- Labun, K.; Montague, T.G.; Krause, M.; Torres Cleuren, Y.N.; Tjeldnes, H.; Valen, E. CHOPCHOP v3: Expanding the CRISPR web toolbox beyond genome editing. Nucleic. Acids. Res. 2019, 47, 171–174. [Google Scholar] [CrossRef] [PubMed]
- Hagiwara, D.; Suzuki, S.; Kamei, K.; Gonoi, T.; Kawamoto, S. The role of AtfA and HOG MAPK pathway in stress tolerance in conidia of Aspergillus fumigatus. Fungal. Genet. Biol. 2014, 73, 138–149. [Google Scholar] [CrossRef]
- Ruijter, G.J.G.; Visser, J. Carbon repression in Aspergilli. FEMS Microbiol. Lett. 1997, 151, 103–114. [Google Scholar] [CrossRef]
- Pongpom, M.; Liu, H.; Xu, W.; Snarr, B.D.; Sheppard, D.C.; Mitchell, A.P.; Filler, S.G. Divergent targets of Aspergillus fumigatus AcuK and AcuM transcription factors during growth in vitro versus invasive disease. Infect Immun. 2015, 83, 923–933. [Google Scholar] [CrossRef]
- Hortschansky, P.; Eisendle, M.; Al-Abdallah, Q.; Schmidt, A.D.; Bergmann, S.; Thön, M.; Kniemeyer, O.; Abt, B.; Seeber, B.; Werner, E.R.; et al. Interaction of HapX with the CCAAT-binding complex—A novel mechanism of gene regulation by iron. EMBO J. 2007, 26, 3157–3168. [Google Scholar] [CrossRef]
- Alves de Castro, P.; Valero, C.; Chiaratto, J.; Colabardini, A.C.; Pardeshi, L.; Pereira Silva, L.; Almeida, F.; Campos Rocha, M.; Nascimento Silva, R.; Malavazi, I.; et al. Novel biological functions of the NsdC transcription factor in Aspergillus fumigatus. MBio 2021, 12, e03102-20. [Google Scholar] [CrossRef] [PubMed]
- Schrettl, M.; Beckmann, N.; Varga, J.; Heinekamp, T.; Jacobsen, I.D.; Jöchl, C.; Moussa, T.A.; Wang, S.; Gsaller, F.; Blatzer, M.; et al. HapX-mediated adaption to iron starvation is crucial for virulence of Aspergillus fumigatus. PLoS Pathog. 2010, 6, e1001124. [Google Scholar] [CrossRef] [PubMed]
- Mollapour, M.; Fong, D.; Balakrishnan, K.; Harris, N.; Thompson, S.; Schüller, C.; Kuchler, K.; Piper, P.W. Screening the yeast deletant mutant collection for hypersensitivity and hyper-resistance to sorbate, a weak organic acid food preservative. Yeast 2004, 21, 927–946. [Google Scholar] [CrossRef] [PubMed]
- Schäpe, P.; Kwon, M.J.; Baumann, B.; Gutschmann, B.; Jung, S.; Lenz, S.; Nitsche, B.; Paege, N.; Schütze, T.; Cairns, T.C.; et al. Updating genome annotation for the microbial cell factory Aspergillus niger using gene co-expression networks. Nucleic. Acids. Res. 2019, 47, 559–569. [Google Scholar] [CrossRef]
- Calabrese, D.; Bille, J.; Sanglard, D. A novel multidrug efflux transporter gene of the major facilitator superfamily from Candida albicans (FLU1) conferring resistance to fluconazole. Microbiology 2000, 146, 2743–2754. [Google Scholar] [CrossRef]
- Li, R.; Kumar, R.; Tati, S.; Puri, S.; Edgerton, M. Candida albicans Flu1-mediated efflux of salivary histatin 5 reduces its cytosolic concentration and fungicidal activity. Antimicrob. Agents Chemother. 2013, 57, 1832–1839. [Google Scholar] [CrossRef] [PubMed]
- Kuloyo, O.; Fourie, R.; Cason, E.; Albertyn, J.; Pohl, C.H. Transcriptome analyses of Candida albicans biofilms, exposed to arachidonic acid and fluconazole, indicates potential drug targets. G3 Genes Genomes Genet. 2020, 10, 3099–3108. [Google Scholar] [CrossRef]





| CBS Number Strain | DTO Number Strain | Genotype | Parental Strain | Isolated from | Species | Obtained from |
|---|---|---|---|---|---|---|
| CBS 113.50 | DTO 008-C3 | wild type | - | Leather | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 554.65 | DTO 012-I2 | wild type | - | Tannic–gallic acid fermentation, Conneticut, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 110.30 | DTO 028-H9 | wild type | - | Göttingen, Germany | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 112.32 | DTO 028-I3 | wild type | - | Japan | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 124.48 | DTO 029-B1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 131.52 | DTO 029-C3 | wild type | - | Leather | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 263.65 | DTO 029-D1 | wild type | - | Copenhagen, Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 103.66 | DTO 029-D4 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 623.78 | DTO 029-E3 | wild type | - | France | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 117.52 | DTO 058-H9 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 118.52 | DTO 058-I1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 139.52 | DTO 058-I5 | wild type | - | Kuro-koji, Japan | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 115988 | DTO 059-C7 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 123906 | DTO 063-G1 | wild type | - | Ryuku, Japan | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 630.78 | DTO 067-H7 | wild type | - | Army equipment, South Pacific Islands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 118.36 | DTO 067-I4 | wild type | - | Chemical, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 126.49 | DTO 068-C1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 072-D2 | wild type | - | Indoor air of archive, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 086-F9 | wild type | - | Filter flow cabinet, Westerdijk institute, Utrecht, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 089-E7 | wild type | - | Air in crawling space, Eindhoven, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-A1 | wild type | - | Wall down in the Lechuguilla Cave, Carlsbad, New Mexico, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-A2 | wild type | - | Soil from dirt road, Isla Santa Cruz, Galapagos islands, Ecuador | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-A3 | wild type | - | Spent coffee (mouldy growth), Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147371 | DTO 096-A5 | wild type | - | Green coffee bean, Coffee Research Station, Netrakonda, India | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147320 | DTO 096-A7 | wild type | - | Grape, Australia | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-A8 | wild type | - | Artic soil, Svalbard, Norway | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147321 | DTO 096-A9 | wild type | - | Artic soil, Svalbard, Norway | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-B1 | wild type | - | Rice starch, imported to Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-B3 | wild type | - | Pepper, imported to Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-B6 | wild type | - | Saffron powder, from Kenya imported to Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-C1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147322 | DTO 096-C6 | wild type | - | Coffee, Brazil | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-C7 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-D1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147323 | DTO 096-D7 | wild type | - | Raisin, Fabula, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147324 | DTO 096-E1 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-E2 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-E3 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 096-E5 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101700 | DTO 096-G3 | wild type | - | Japan | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101706 | DTO 096-G4 | wild type | - | Soy bean | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101707 | DTO 096-G5 | wild type | - | Broiler mixed feed | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101708 | DTO 096-G6 | wild type | - | Uknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 121047 | DTO 096-G8 | wild type | - | Coffee bean, Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 108-I7 | wild type | - | Indoor environment, Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 120.49 | DTO 146-A3 | wild type | - | USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101698 | DTO 146-B8 | wild type | - | Mesocarp finga-coffee bean, Kenya | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 101705 | DTO 146-C1 | wild type | - | Carpet dust from school, Canada | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 146-E8 | wild type | - | Indoor environment, Hungary | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 161-E9 | wild type | - | Bamboo sample, Ho Chi Minh city, Vietnam | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 167-A4 | wild type | - | Margarine, Belgium | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147482 | DTO 175-I5 | wild type | - | Surface water, Portugal | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 188-A9 | wild type | - | Cinnamon, imported to the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 203-H4 | wild type | - | Soil, Kabodan island, Iran | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 225-H3 | wild type | - | Raisins, imported to Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 240-E2 | wild type | - | Breakfast cereal, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 240-H6 | wild type | - | Muesli, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 240-I6 | wild type | - | Dried fig, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 240-I9 | wild type | - | Dried fruit, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 241-B2 | wild type | - | Breakfast cereal, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 241-B7 | wild type | - | Muesli, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 257-G2 | wild type | - | Filling, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 260-C2 | wild type | - | Indoor, school, Turkey | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 267-I2 | wild type | - | House dust, Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 276-G2 | wild type | - | BAL, Iran | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147343 | DTO 291-B7 | wild type | - | Coffee bean, Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 293-E2 | wild type | - | Coffee beans (Arabica), Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147344 | DTO 293-G7 | wild type | - | Coffee beans (Robusta), Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 133816 | DTO 316-E3 | wild type | - | Black pepper, Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147345 | DTO 316-E4 | wild type | - | USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 316-E5 | wild type | - | Raisins, California, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 316-E6 | wild type | - | Raisins, California, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147346 | DTO 321-E6 | wild type | - | CF patient material, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147347 | DTO 326-A7 | wild type | - | Petri dish in soft drink factory, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 337-D3 | wild type | - | Fruit, Belgium | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 355-F9 | wild type | - | Patient material, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 360-C1 | wild type | - | Liquorice solution, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 115.50 | DTO 367-B6 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 281.95 | DTO 367-C9 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 769.97 | DTO 367-D1 | wild type | - | Leather | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 115989 | DTO 367-D6 | wild type | - | Unknown | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 116681 | DTO 367-D7 | wild type | - | Imported kernels of apricots, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 119394 | DTO 367-E2 | wild type | - | USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 121997 | DTO 367-E9 | wild type | - | Coffee bean, Chiangmai, Thailand | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 129379 | DTO 367-G3 | wild type | - | Soil, Cedrus deodar forest, Mussoorie, India | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 132413 | DTO 367-G7 | wild type | - | Soil, 200m from W. mirabilis, Swakop, Namibia | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 133817 | DTO 367-G8 | wild type | - | Black pepper, Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 133818 | DTO 367-G9 | wild type | - | Raisins, Denmark | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 140837 | DTO 367-H2 | wild type | - | Soil, Rudňany, Slovakia | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-H7 | wild type | - | K-sorbate free margarine, the Netherlands | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-H8 | wild type | - | Beverages factory, India | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-H9 | wild type | - | Ice tea red, Philippines | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147352 | DTO 368-I1 | wild type | - | Air next to bottle blower, Mexico | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-I2 | wild type | - | Decaffinated tea bags, Belgium | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-I3 | wild type | - | Environment in factory, Uzbekistan | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-I4 | wild type | - | Potassium sorbate containing margarine, Ghana | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-I5 | wild type | - | Food factory of Sanquinetto, Italy | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 147353 | DTO 368-I6 | wild type | - | Food factory of Sanquinetto, Italy | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| - | DTO 368-I7 | wild type | - | Used in soy sauce fermentation process, China | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| CBS 554.65 | DTO 368-I8 | wild type | - | Connecticut, USA | Aspergillus niger | Westerdijk Fungal Biodiversity Institute |
| MA985.18 | complementation sdrA G1296A | CBS 147320 | - | Aspergillus niger | This study | |
| MA985.34 | complementation sdrA G1296A | CBS 147320 | - | Aspergillus niger | This study | |
| MA985.52 | complementation sdrA G1296A | CBS 147320 | - | Aspergillus niger | This study | |
| MA985.54 | complementation sdrA G1296A | CBS 147320 | - | Aspergillus niger | This study | |
| MA234.1 | ∆kusA | N402 | - | Aspergillus niger | [34] | |
| SJS148.1 | ΔwarA | MA234.1 | - | Aspergillus niger | This study | |
| SJS157.1 | ΔsdrA | MA234.1 | - | Aspergillus niger | This study | |
| SJS158.1 | ΔwarB | MA234.2 | - | Aspergillus niger | This study | |
| SJS159.1 | ΔsdrA, ΔwarA | SJS148.1 | - | Aspergillus niger | This study | |
| SJS160.2 | ΔwarA, ΔwarB | SJS148.2 | - | Aspergillus niger | This study | |
| SJS161.1 | ΔsdrA, ΔwarB | MA234.1 | - | Aspergillus niger | This study | |
| SJS162.1 | ΔsdrA, ΔwarA, ΔwarB | SJS148.1 | - | Aspergillus niger | This study |
| Primer Name | Sequence | Function |
|---|---|---|
| p1f sjs28 | TCCCGCATCGGCTAAGTCTCCA | sdrA repair DNA 1 for CBS 147320 |
| p2r sjs28 | CTGATTCCGCTTCATTCGCAGCACGCGGTCAATCTCT | sdrA repair DNA 1 for CBS 147320 |
| p3f sjs28 | GAATGAAGCGGAATCAGCGCGAGGCTCGAGCGTGTTA | sdrA repair DNA 2 for CBS 147320 |
| p5r sjs28 | GGTCACGCAGATATGGCTGAG | sdrA repair DNA 2 for CBS 147320 |
| TS1_sdrA_fw | TCCCGCATCGGCTAAGTCTCCA | Creation of 5′ sdrA flank, 367 bp |
| TS1_sdrA_rv | GGAGTGGTACCAATATAAGCCGGCGGTGTGTCGGAACCTCAAAAGC | Creation of 5′ sdrA flank, 367 bp |
| TS2_sdrA_fw | CCGGCTTATATTGGTACCACTCCCCATGACGTTATGCGGCCCCTC | Creation of 3′ sdrA flank, 502 bp |
| TS2_sdrA_rv | AGTGGCACCCGTCATGGCTACT | Creation of 3′ sdrA flank, 502 bp |
| sdrA_sgRNA2_fw | AATGAAACGCAATCAGCGCGGTTTTAGAGCTAGAAAT | Create the sdrA target for the CRISPR/Cas9 plasmid |
| sdrA_sgRNA2_rv | CGCGCTGATTGCGTTTCATTGACGAGCTTACTCGTTT | Create the sdrA target for the CRISPR/Cas9 plasmid |
| diag_sdrA_fw | ACTTAGGGGGTGGGACCAGTGG | Diagnostic PCR sdrA deletion |
| diag_sdrA_rv | GGACTTTGATGCCGAGCATGGC | Diagnostic PCR sdrA deletion |
| 5_warA_fw | GGCGTCCTCCAGGGTCTCATCT | Creation of 5′ warA flank, 368 bp |
| 5_warA_rv | GGAGTGGTACCAATATAAGCCGGTGGCTTGCTGTTATTCTAGAGAGGG | Creation of 5′ warA flank, 368 bp |
| 3_warA_fw | CCGGCTTATATTGGTACCACTCCTGTGTATTTGTCTGGAGTGGATGT | Creation of 3′ warA flank, 1002 bp |
| 3_warA_rv | AGCTCCCGCTCAATCCTCGAGA | Creation of 3′ warA flank, 1002 bp |
| warA_sgRNA_fw | CGATAGACGATGCTTACCTGGTTTTAGAGCTAGAAAT | Create the warA target for the CRISPR/Cas9 plasmid |
| warA_sgRNA_rv | CAGGTAAGCATCGTCTATCGGACGAGCTTACTCGTTT | Create the warA target for the CRISPR/Cas9 plasmid |
| diag_warA_fw | CACAATGCCATGTAGCGCGCAA | Diagnostic PCR warA deletion |
| diag_warA_rv | ACACGATCTGACCGCGATGACG | Diagnostic PCR warA deletion |
| TS1_warB_fw | TCGACCCTCCCGGTTTGGTCAA | Creation of 5′ warB flank, 599 bp |
| TS1_warB_rv | GGAGTGGTACCAATATAAGCCGGTGAAGGAGGTTTGGTTGCGGGT | Creation of 5′ warB flank, 599 bp |
| TS2_warB_fw | CCGGCTTATATTGGTACCACTCCACGATACGACGAAGTTCAGCAT | Creation of 3′ warB flank, 544 bp |
| TS2_warB_rv | AGTTCGGCCACTTCTCGGACCA | Creation of 3′ warB flank, 544 bp |
| warB_sgRNA2_rv | CGGTGTTCTCTTCGAAGCGCGACGAGCTTACTCGTTT | Create the warB target for the CRISPR/Cas9 plasmid |
| warB_sgRNA2_fw | GCGCTTCGAAGAGAACACCGGTTTTAGAGCTAGAAAT | Create the warB target for the CRISPR/Cas9 plasmid |
| diag_warB_fw | TCGCCCTCGTCTTACTCCTCCC | Diagnostic PCR warB deletion |
| diag_warB_rv | CCATGACGTCCTCCATCACCGC | Diagnostic PCR warB deletion |
| Plasmid Name | Target Sequence | Function | Origin |
|---|---|---|---|
| pTLL108.1 | - | Template for the amplification of guide RNA | [37] |
| pTLL109.2 | - | Template for the amplification of guide RNA | [37] |
| pFC332 | - | Backbone containing CRISPR/Cas9 | [38] |
| pMA433.2 | AATGAAACGCAATCAGCGCG | Targeted double-stranded break in sdrA gene | This study |
| pMA434.1 | CGATAGACGATGCTTACCTG | Targeted double-stranded break in sdrA gene | This study |
| pMA435.2 | GCGCTTCGAAGAGAACACCG | Targeted double-stranded break in sdrA gene | This study |
| Sample | MICu in MEB (mM) | MICu in Ice Tea (mM) | ||
|---|---|---|---|---|
| 7 days | 28 days | 7 days | 28 days | |
| Average of 100 strains | 3.7 ± 0.6 | 4.8 ± 0.8 | 2.9 ± 0.4 | 3.8 ± 0.5 |
| CBS 147320 (sorbic-acid-sensitive strain) | 2.5 ± 0.7 | 4.0 ± 1.4 | 2.0 ± 0.0 | 3.0 ± 0.0 |
| CBS 113.50 (sorbic-acid-resistant strain) | 6.5 ± 0.7 | 7.0 ± 0.0 | 4.0 ± 0.0 | 5.5 ± 0.7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seekles, S.J.; van Dam, J.; Arentshorst, M.; Ram, A.F.J. Natural Variation and the Role of Zn2Cys6 Transcription Factors SdrA, WarA and WarB in Sorbic Acid Resistance of Aspergillus niger. Microorganisms 2022, 10, 221. https://doi.org/10.3390/microorganisms10020221
Seekles SJ, van Dam J, Arentshorst M, Ram AFJ. Natural Variation and the Role of Zn2Cys6 Transcription Factors SdrA, WarA and WarB in Sorbic Acid Resistance of Aspergillus niger. Microorganisms. 2022; 10(2):221. https://doi.org/10.3390/microorganisms10020221
Chicago/Turabian StyleSeekles, Sjoerd J., Jisca van Dam, Mark Arentshorst, and Arthur F. J. Ram. 2022. "Natural Variation and the Role of Zn2Cys6 Transcription Factors SdrA, WarA and WarB in Sorbic Acid Resistance of Aspergillus niger" Microorganisms 10, no. 2: 221. https://doi.org/10.3390/microorganisms10020221
APA StyleSeekles, S. J., van Dam, J., Arentshorst, M., & Ram, A. F. J. (2022). Natural Variation and the Role of Zn2Cys6 Transcription Factors SdrA, WarA and WarB in Sorbic Acid Resistance of Aspergillus niger. Microorganisms, 10(2), 221. https://doi.org/10.3390/microorganisms10020221

