Interferon Signaling in Chickens Plays a Crucial Role in Inhibiting Influenza Replication in DF1 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Transfection Procedure
2.2. Virus Strains
2.3. Protein Modelling
2.4. CRISPR Guide Selection and Plasmid Construction
2.5. Genomic DNA Isolation and PCR Analysis of ChIfnar1 Gene
2.6. Flow Cytometry and Cell Sorting
2.7. Quantitative Real Time PCR (qRT-PCR)
2.8. Statistical Analyses
3. Results
3.1. Characterization of the Chicken Ifnar1
3.2. CRISPR Knock out of the ChIfnar1
3.3. Presence and Impact of ChIfnar1 on DF1 Cells
3.4. ChIfnar1 Knock out Impacts the Growth of the Influenza Virus WSN
3.5. Role of chIFNAR1 in Influenza Virus Infection
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Schoggins, J.W.; Wilson, S.J.; Panis, M.; Murphy, M.Y.; Jones, C.T.; Bieniasz, P.; Rice, C.M. A diverse range of gene products are effectors of the type i interferon antiviral response. Nature 2011, 472, 481–485. [Google Scholar] [CrossRef] [PubMed]
- Isaacs, A.; Lindenmann, J. Virus interference. I. The interferon. Proc. R. Soc. Lond. B Biol. Sci. 1957, 147, 258–267. [Google Scholar]
- Santhakumar, D.; Rubbenstroth, D.; Martinez-Sobrido, L.; Munir, M. Avian interferons and their antiviral effectors. Front. Immunol. 2017, 8, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sick, C.; Schultz, U.; Munster, U.; Meier, J.; Kaspers, B.; Staeheli, P. Promoter structures and differential responses to viral and nonviral inducers of chicken type i interferon genes. J. Biol. Chem. 1998, 273, 9749–9754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, H.; Yang, L.; Meng, S.; Xu, L.; Bi, Y.; Jia, X.; Li, J.; Sun, L.; Liu, W. The differential antiviral activities of chicken interferon alpha (chifn-alpha) and chifn-beta are related to distinct interferon-stimulated gene expression. PLoS ONE 2013, 8, e59307. [Google Scholar] [CrossRef] [Green Version]
- Goodman, A.G.; Zeng, H.; Proll, S.C.; Peng, X.; Cilloniz, C.; Carter, V.S.; Korth, M.J.; Tumpey, T.M.; Katze, M.G. The alpha/beta interferon receptor provides protection against influenza virus replication but is dispensable for inflammatory response signaling. J. Virol. 2010, 84, 2027–2037. [Google Scholar] [CrossRef] [Green Version]
- Ng, C.T.; Sullivan, B.M.; Teijaro, J.R.; Lee, A.M.; Welch, M.; Rice, S.; Sheehan, K.C.; Schreiber, R.D.; Oldstone, M.B. Blockade of interferon beta, but not interferon alpha, signaling controls persistent viral infection. Cell Host Microbe 2015, 17, 653–661. [Google Scholar] [CrossRef] [Green Version]
- Carvajal-Yepes, M.; Sporer, K.R.; Carter, J.L.; Colvin, C.J.; Coussens, P.M. Enhanced production of human influenza virus in pbs-12sf cells with a reduced interferon response. Hum. Vaccines Immunother. 2015, 11, 2296–2304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stanifer, M.L.; Pervolaraki, K.; Boulant, S. Differential regulation of type i and type iii interferon signaling. Int. J. Mol. Sci. 2019, 20, 1445. [Google Scholar] [CrossRef] [Green Version]
- Wu, W.; Metcalf, J.P. The role of type i ifns in influenza: Antiviral superheroes or immunopathogenic villains? J. Innate Immun. 2020, 12, 437–447. [Google Scholar] [CrossRef]
- Daviet, S.; Van Borm, S.; Habyarimana, A.; Ahanda, M.L.; Morin, V.; Oudin, A.; Van Den Berg, T.; Zoorob, R. Induction of mx and pkr failed to protect chickens from h5n1 infection. Viral Immunol. 2009, 22, 467–472. [Google Scholar] [CrossRef] [PubMed]
- Goossens, K.E.; Ward, A.C.; Lowenthal, J.W.; Bean, A.G. Chicken interferons, their receptors and interferon-stimulated genes. Dev. Comp. Immunol. 2013, 41, 370–376. [Google Scholar] [CrossRef] [PubMed]
- Haller, O.; Kochs, G. Human mxa protein: An interferon-induced dynamin-like gtpase with broad antiviral activity. J. Interferon. Cytokine Res. 2011, 31, 79–87. [Google Scholar] [CrossRef]
- Haller, O.; Kochs, G. Mx genes: Host determinants controlling influenza virus infection and trans-species transmission. Hum. Genet. 2020, 139, 695–705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ko, J.H.; Takada, A.; Mitsuhashi, T.; Agui, T.; Watanabe, T. Native antiviral specificity of chicken mx protein depends on amino acid variation at position 631. Anim. Genet. 2004, 35, 119–122. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Fu, D.; Zhang, Y.; Xu, Q.; Ni, L.; Chang, G.; Zheng, M.; Gao, B.; Sun, H.; Chen, G. Partial antiviral activities of the asn631 chicken mx against newcastle disease virus and vesicular stomatitis virus. Mol. Biol. Rep. 2012, 39, 8415–8424. [Google Scholar] [CrossRef]
- Sasaki, K.; Yoneda, A.; Ninomiya, A.; Kawahara, M.; Watanabe, T. Both antiviral activity and intracellular localization of chicken mx protein depend on a polymorphism at amino acid position 631. Biochem. Biophys. Res. Commun. 2013, 430, 161–166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ewald, S.J.; Kapczynski, D.R.; Livant, E.J.; Suarez, D.L.; Ralph, J.; McLeod, S.; Miller, C. Association of mx1 asn631 variant alleles with reductions in morbidity, early mortality, viral shedding, and cytokine responses in chickens infected with a highly pathogenic avian influenza virus. Immunogenetics 2011, 63, 363–375. [Google Scholar] [CrossRef] [PubMed]
- Schusser, B.; Reuter, A.; von der Malsburg, A.; Penski, N.; Weigend, S.; Kaspers, B.; Staeheli, P.; Hartle, S. Mx is dispensable for interferon-mediated resistance of chicken cells against influenza a virus. J. Virol. 2011, 85, 8307–8315. [Google Scholar] [CrossRef] [Green Version]
- Sironi, L.; Williams, J.L.; Moreno-Martin, A.M.; Ramelli, P.; Stella, A.; Jianlin, H.; Weigend, S.; Lombardi, G.; Cordioli, P.; Mariani, P. Susceptibility of different chicken lines to h7n1 highly pathogenic avian influenza virus and the role of mx gene polymorphism coding amino acid position 631. Virology 2008, 380, 152–156. [Google Scholar] [CrossRef] [Green Version]
- Karpala, A.J.; Lowenthal, J.W.; Bean, A.G.D. Identifying innate immune pathways of the chicken may lead to new antiviral therapies. Vet. Immunol. Immunopathol. 2012, 148, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Himly, M.; Foster, D.N.; Bottoli, I.; Iacovoni, J.S.; Vogt, P.K. The df-1 chicken fibroblast cell line: Transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology 1998, 248, 295–304. [Google Scholar] [CrossRef] [Green Version]
- Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints12. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Kelley, L.A.; Mezulis, S.; Yates, C.M.; Wass, M.N.; Sternberg, M.J. The phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845–858. [Google Scholar] [CrossRef] [Green Version]
- Karpala, A.J.; Lowenthal, J.W.; Bean, A.G. Activation of the tlr3 pathway regulates ifnbeta production in chickens. Dev. Comp. Immunol. 2008, 32, 435–444. [Google Scholar] [CrossRef]
- Stewart, C.R.; Bagnaud-Baule, A.; Karpala, A.J.; Lowther, S.; Mohr, P.G.; Wise, T.G.; Lowenthal, J.W.; Bean, A.G. Toll-like receptor 7 ligands inhibit influenza a infection in chickens. J. Interferon Cytokine Res. 2012, 32, 46–51. [Google Scholar] [CrossRef] [PubMed]
- Kochs, G.; Haller, O. Chapter 226—Mx Proteins: High Molecular Weight Gtpases with Antiviral Activity; Academic Press: San Diego, CA, USA, 2010. [Google Scholar]
- Goritzka, M.; Durant, L.R.; Pereira, C.; Salek-Ardakani, S.; Openshaw, P.J.; Johansson, C. Alpha/beta interferon receptor signaling amplifies early proinflammatory cytokine production in the lung during respiratory syncytial virus infection. J. Virol. 2014, 88, 6128–6136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pantin-Jackwood, M.J.; Swayne, D.E. Pathogenesis and pathobiology of avian influenza virus infection in birds. Rev. Sci. Tech. 2009, 28, 113–136. [Google Scholar] [CrossRef] [PubMed]
- Uzé, G.; Schreiber, G.; Piehler, J.; Pellegrini, S. The receptor of the type i interferon family. In Interferon: The 50th Anniversary; Pitha, P.M., Ed.; Springer: Berlin/Heidelberg, Germany, 2007; pp. 71–95. [Google Scholar]
- Piehler, J.; Thomas, C.; Garcia, K.C.; Schreiber, G. Structural and dynamic determinants of type i interferon receptor assembly and their functional interpretation. Immunol. Rev. 2012, 250, 317–334. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.H.; Wu, C.F.; Rajasekaran, N.; Shin, Y.K. Loss of tumor suppressor gene function in human cancer: An overview. Cell. Physiol. Biochem. 2018, 51, 2647–2693. [Google Scholar] [CrossRef] [PubMed]
- Mordstein, M.; Kochs, G.; Dumoutier, L.; Renauld, J.C.; Paludan, S.R.; Klucher, K.; Staeheli, P. Interferon-lambda contributes to innate immunity of mice against influenza a virus but not against hepatotropic viruses. PLoS Pathog. 2008, 4, e1000151. [Google Scholar] [CrossRef] [Green Version]
- Moulin, H.R.; Liniger, M.; Python, S.; Guzylack-Piriou, L.; Ocana-Macchi, M.; Ruggli, N.; Summerfield, A. High interferon type i responses in the lung, plasma and spleen during highly pathogenic h5n1 infection of chicken. Vet. Res. 2011, 42, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Penski, N.; Hartle, S.; Rubbenstroth, D.; Krohmann, C.; Ruggli, N.; Schusser, B.; Pfann, M.; Reuter, A.; Gohrbandt, S.; Hundt, J.; et al. Highly pathogenic avian influenza viruses do not inhibit interferon synthesis in infected chickens but can override the interferon-induced antiviral state. J. Virol. 2011, 85, 7730–7741. [Google Scholar]
- Xia, C.; Wolf, J.J.; Vijayan, M.; Studstill, C.J.; Ma, W.; Hahm, B. Casein kinase 1alpha mediates the degradation of receptors for type i and type ii interferons caused by hemagglutinin of influenza a virus. J. Virol. 2018, 92, e00006-18. [Google Scholar] [CrossRef] [Green Version]
- Garcia-Sastre, A. Ten strategies of interferon evasion by viruses. Cell Host Microbe 2017, 22, 176–184. [Google Scholar] [CrossRef]
- Pauli, E.K.; Schmolke, M.; Wolff, T.; Viemann, D.; Roth, J.; Bode, J.G.; Ludwig, S. Influenza a virus inhibits type i ifn signaling via nf-kappab-dependent induction of socs-3 expression. PLoS Pathog. 2008, 4, e1000196. [Google Scholar] [CrossRef]
- Roll, S.; Hartle, S.; Lutteke, T.; Kaspers, B.; Hartle, S. Tissue and time specific expression pattern of interferon regulated genes in the chicken. BMC Genom. 2017, 18, 264. [Google Scholar] [CrossRef] [Green Version]
- Liniger, M.; Moulin, H.R.; Sakoda, Y.; Ruggli, N.; Summerfield, A. Highly pathogenic avian influenza virus h5n1 controls type i ifn induction in chicken macrophage hd-11 cells: A polygenic trait that involves ns1 and the polymerase complex. Virol. J. 2012, 9, 7. [Google Scholar] [CrossRef] [Green Version]
Target Gene | Primer/Probe | Sequence (5′–3′) | Accession No. |
---|---|---|---|
GAPDH | F | CCCCAATGTCTCTGTTGTTGAC | AF047874 |
R | CAGCCTTCACTACCCTCTTGAT | ||
Probe | CTTGGCTGGTTTCTCC | ||
IFNα | F | GGACATGGCTCCCACACTAC | X92476 |
R | TCCAGGATGGTGTCGTTGAAG | ||
Probe | CAGCGCGTCTTGCTC | ||
PKR | F | GCAGAAGTAAGAGTGAGGCAAATGA | HQO14737 |
R | GCCACCTTTACCAATAGGCTCTAT | ||
Probe | CTGTGGATGAAAGGTTTC | ||
Mx | F | GTCCAAGAGGCTGAATAACAGAGAA | CR 389077 |
R | GGTCGGATCTTTCTGTCATATTGGT | ||
Probe | CTGCTGCCTCATCCTT | ||
IFNAR1 | F | CGGCCACCCAAACCTTAGAA | Gene ID: 395665 |
R | CCATCTCGCAGCAGTTGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Layton, D.S.; Mara, K.; Dai, M.; Malaver-Ortega, L.F.; Gough, T.J.; Bruce, K.; Jenkins, K.A.; Bean, A.G.D. Interferon Signaling in Chickens Plays a Crucial Role in Inhibiting Influenza Replication in DF1 Cells. Microorganisms 2022, 10, 133. https://doi.org/10.3390/microorganisms10010133
Layton DS, Mara K, Dai M, Malaver-Ortega LF, Gough TJ, Bruce K, Jenkins KA, Bean AGD. Interferon Signaling in Chickens Plays a Crucial Role in Inhibiting Influenza Replication in DF1 Cells. Microorganisms. 2022; 10(1):133. https://doi.org/10.3390/microorganisms10010133
Chicago/Turabian StyleLayton, Daniel S., Kostlend Mara, Meiling Dai, Luis Fernando Malaver-Ortega, Tamara J. Gough, Kerri Bruce, Kristie A. Jenkins, and Andrew G. D. Bean. 2022. "Interferon Signaling in Chickens Plays a Crucial Role in Inhibiting Influenza Replication in DF1 Cells" Microorganisms 10, no. 1: 133. https://doi.org/10.3390/microorganisms10010133
APA StyleLayton, D. S., Mara, K., Dai, M., Malaver-Ortega, L. F., Gough, T. J., Bruce, K., Jenkins, K. A., & Bean, A. G. D. (2022). Interferon Signaling in Chickens Plays a Crucial Role in Inhibiting Influenza Replication in DF1 Cells. Microorganisms, 10(1), 133. https://doi.org/10.3390/microorganisms10010133