Development and Validation of a New TaqMan Real-Time PCR for the Detection of Ornithobacterium rhinotracheale
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primers and Probes Design and Modification
2.2. Real-Time PCR Setup
2.3. Ornithobacterium rhinotracheale Isolates and Clinical Samples
2.4. Other Bacteria and Viruses
2.5. Nucleic Acid Extraction
2.6. Evaluation of qPCR Assays’ Performance
2.6.1. In Silico Validation and Evaluation of the Primers and Probes
2.6.2. Melting Curve Analysis for Confirmation of Any Non-Specific Amplification
2.6.3. Analytical Validation and Evaluation of the qPCR Assays
3. Results
3.1. Primers and Probe Design
3.2. In Silico Validation and Evaluation of the Primers and Probes of the Three Assays
3.3. Melting Curve Analysis for Confirmation of Any Non-Specific Amplification
3.4. Analytical Validation and Evaluation of the qPCR Assays
3.4.1. Analytical Specificity (Inclusivity and Exclusivity)
3.4.2. Evaluation of the Assays’ Diagnostic Specificity against Clinical Samples
3.4.3. Limit of Detection (LOD), CT Cut-Off Value and the Limit of Quantification (LOQ)
3.4.4. Coefficient of Determination (R2)
3.4.5. Efficiency (E)
3.4.6. Linear Dynamic Range
3.4.7. Repeatability
3.4.8. Reproducibility
3.5. Comparison among CT Values Obtained from Testing Positive Clinical Samples Using the Three qPCR Assays
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Glisson, J.R. Bacterial respiratory disease of poultry. Poult. Sci. 1998, 77, 1139–1142. [Google Scholar] [CrossRef] [PubMed]
- Van Empel, P.; Hafez, H. Ornithobacterium rhinotracheale: A review. Avian Pathol. 1999, 28, 217–227. [Google Scholar] [CrossRef]
- Churria, C.D.G.; Machuca, M.A.; Petruccelli, M.A. Ornithobacterium rhinotracheale infection in poultry: An updated review. Int. J. Mol. Zool. 2012, 2, 23–38. [Google Scholar]
- Clark, S. Current health and industry issues facing the turkey industry. In Proceedings of the Annual meeting of the United States Animal Health Association 2018, Kansas City, MO, USA, 14–28 October 2018; Transmissible Diseases of Poultry and Other Avian Species Committee. Available online: https://www.usaha.org/ (accessed on 7 April 2021).
- Barbosa, E.V.; Cardoso, C.V.; Silva, R.D.C.F.; Cerqueira, A.D.M.F.; Liberal, M.H.T.; Castro, H.C. Ornithobacterium rhinotracheale: An Update Review about An Emerging Poultry Pathogen. Vet. Sci. 2020, 7, 3. [Google Scholar] [CrossRef]
- Empel, V. Ornithobacterium Rhinotracheale; University of Utrecht: Utrecht, The Netherlands, 1998; Available online: https://core.ac.uk/download/pdf/39699683.pdf (accessed on 10 August 2021).
- Hafez, H.M. Diagnosis of Ornithobacterium rhinotracheale. Int. J. Poult. Sci. 2002, 1, 114–118. [Google Scholar]
- Van Veen, J.N.L.; Mekkes, D.; Vrijenhoek, M.; van Empel, P. Diagnosis and incidence of Ornithobacterium rhinotracheale infections in commercial broiler chickens at slaughter. Vet. Rec. 2005, 156, 315–317. [Google Scholar] [CrossRef] [PubMed]
- Ha, H.J.; Christensen, N.; Humphrey, S.; Haydon, T.; Bernardi, G.; Rawdon, T. The first detection of Ornithobacterium rhinotracheale in New Zealand. Avian Dis. 2016, 60, 856–859. [Google Scholar] [CrossRef]
- Abdelwhab, E.; Lüschow, D.; Hafez, H. Development of real-time polymerase chain reaction assay for detection of Ornithobacterium rhinotracheale in poultry. Avian Dis. 2013, 57, 663–666. [Google Scholar] [CrossRef] [PubMed]
- Canal, C.W.; Leao, J.A.; Rocha, S.L.S.; Macagnan, M.; Lima-Rosa, C.A.V.; Oliveira, S.D.; Back, A. Isolation and characterization of Ornithobacterium rhinotracheale from chickens in Brazil. Res. Vet. Sci. 2005, 78, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Chansiripornchai, N.; Wanasawaeng, W.; Sasipreeyajan, J. Seroprevalence and identification of Ornithobacterium rhinotracheale from broiler and broiler breeder flocks in Thailand. Avian Dis. 2007, 51, 777–780. [Google Scholar] [CrossRef]
- Koga, Y.; Zavaleta, A.I. Intraspecies genetic variability of Ornithobacterium rhinotracheale in commercial birds in Peru. Avian Dis. 2005, 49, 108–111. [Google Scholar] [CrossRef]
- Tsai, H.-J.; Huang, C.-W. Phenotypic and molecular characterization of isolates of Ornithobacterium rhinotracheale from chickens and pigeons in Taiwan. Avian Dis. 2006, 50, 502–507. [Google Scholar] [CrossRef] [PubMed]
- Arif, M.; Aguilar-Moreno, G.S.; Wayadande, A.; Fletcher, J.; Ochoa-Corona, F.M. Primer modification improves rapid and sensitive in vitro and field-deployable assays for detection of high plains virus variants. Appl. Environ. Microbiol. 2014, 80, 320–327. [Google Scholar] [CrossRef]
- Li, D.; Zhang, J.; Li, J. Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2. Theranostics 2020, 10, 7150. [Google Scholar] [CrossRef] [PubMed]
- Stenzel, T.; Pestka, D.; Tykałowski, B.; Śmiałek, M.; Koncicki, A.; Bancerz-Kisiel, A. Detection of Bordetella avium by TaqMan real-time PCR in tracheal swabs from wildlife birds. Pol. J. Veter-Sci. 2017, 20, 31–36. [Google Scholar] [CrossRef] [PubMed]
- Lunge, V.; Miller, B.; Livak, K.; Batt, C. Factors affecting the performance of 5′ nuclease PCR assays for Listeria monocytogenes detection. J. Microbiol. Methods 2002, 51, 361–368. [Google Scholar] [CrossRef]
- Crockett, A.O.; Wittwer, C.T. Fluorescein-Labeled Oligonucleotides for Real-Time PCR: Using the Inherent Quenching of Deoxyguanosine Nucleotides. Anal. Biochem. 2001, 290, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Johnston, A.D.; Lu, J.; Ru, K.; Korbie, D.; Trau, M. PrimerROC: Accurate condition-independent dimer prediction using ROC analysis. Sci. Rep. 2019, 9, 209. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Smith, E.A.; Miller, E.A.; Weber, B.P.; Aguayo, J.M.; Figueroa, C.F.; Huisinga, J.; Nezworski, J.; Kromm, M.; Wileman, B.; Johnson, T.J. Genomic landscape of Ornithobacterium rhinotracheale in commercial turkey production in the United States. Appl. Environ. Microbiol. 2020, 86, e02874-19. [Google Scholar] [CrossRef] [PubMed]
- Ball, C.; Felice, V.; Ding, Y.; Forrester, A.; Catelli, E.; Ganapathy, K. Influences of swab types and storage temperatures on isolation and molecular detection of Mycoplasma gallisepticum and Mycoplasma synoviae. Avian Pathol. 2020, 49, 106–110. [Google Scholar] [CrossRef]
- Singh, P.; Yavari, C.A.; Newman, J.A.; Bradbury, J.M. Identification of Mycoplasma Iowae by Colony Immunoblotting Utilizing Monoclonal Antibodies. J. Veter-Diagn. Investig. 1997, 9, 357–362. [Google Scholar] [CrossRef] [PubMed]
- Register, K.B.; Kunkleb, R.A. Strain-Specific Virulence of Bordetella hinzii in Poultry. Avian Dis. 2009, 53, 50–54. [Google Scholar] [CrossRef] [PubMed]
- Mbuthia, P.G.; Njagi, L.W.; Nyaga, P.N.; Bebora, L.C.; Minga, U.; Kamundia, J.; Olsen, J.E. Pasteurella multocida in scavenging family chickens and ducks: Carrier status, age susceptibility and transmission between species. Avian Pathol. 2008, 37, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Sarba, E.J.; Kelbesa, K.A.; Bayu, M.D.; Gebremedhin, E.Z.; Borena, B.M.; Teshale, A. Identification and antimicrobial susceptibility profile of Escherichia coli isolated from backyard chicken in and around ambo, Central Ethiopia. BMC Veter-Res. 2019, 15, 85. [Google Scholar] [CrossRef] [PubMed]
- Nassik, S.; Tallouzt, S.; Karbach, N.; Touzani, C.; Bidoudan, Y.; Aamarine, N.; Hess, C. First Report of Isolation of Gallibacterium anatis from Layer Chickens in Morocco with Decrease in Laying Performance. Avian Dis. 2019, 63, 727–730. [Google Scholar] [CrossRef] [PubMed]
- Eriksson, H.; Bagge, E.; Båverud, V.; Fellström, C.; Jansson, D.S. Erysipelothrix rhusiopathiae contamination in the poultry house environment during erysipelas outbreaks in organic laying hen flocks. Avian Pathol. 2014, 43, 231–237. [Google Scholar] [CrossRef] [PubMed]
- Krupa, P.; Bystroń, J.; Bania, J.; Podkowik, M.; Empel, J.; Mroczkowska, A. Genotypes and oxacillin resistance of Staphylococcus aureus from chicken and chicken meat in Poland. Poult. Sci. 2014, 93, 3179–3186. [Google Scholar] [CrossRef] [PubMed]
- Christensen, H.B.P.; Bisgaard, M. Pasteurella, Avibacterium, Gallibacterium Species. In A Laboratory Manual for the Isolation, Identification, and Characterization of Avian Pathogens; Louise, D.-Z., Williams, S.M., Jackwood, M.W., Lee, M.D., Lupiani, B., Reed, W.M., Spackman, E., Woolcock, P.R., Eds.; American Association of Avian Pathologists: Jackonsville, FL, USA, 2016; pp. 85–98. [Google Scholar]
- Hashish, A.; Sinha, A.; Mekky, A.; Sato, Y.; Macedo, N.R.; El-Gazzar, M. Development and Validation of Two Diagnostic Real-Time PCR (TaqMan) Assays for the Detection of Bordetella avium from Clinical Samples and Comparison to the Currently Available Real-Time TaqMan PCR Assay. Microorganisms 2021, 9, 2232. [Google Scholar] [CrossRef] [PubMed]
- Msoffe, P.L.M.; Chiwanga, G.H.; Cardona, C.J.; Miller, P.J.; Suarez, D.L. Isolation and Characterization of Newcastle Disease Virus from Live Bird Markets in Tanzania. Avian Dis. 2019, 63, 634–640. [Google Scholar] [CrossRef] [PubMed]
- Jones, R. Avian reovirus infections. J. Rev. Sci. Et Tech.-Off. Int. Des Epizoot. 2000, 19, 614–619. [Google Scholar] [CrossRef] [PubMed]
- Gelb, J.; Jackwood, M. Infectious bronchitis. In A Laboratory Manual for the Isolation Identification of Avian Pathogens, 4th ed.; Swayne, D.E., Glisson, J.R., Jackwood, M.W., Pearson, J.E., Reed, W.M., Eds.; American Association of Avian Pathologists: Kennett Square, PA, USA, 1998; pp. 169–174. [Google Scholar]
- Dormitorio, T.V.; Giambrone, J.J.; Macklin, K. Detection and Isolation of Infectious Laryngotracheitis Virus on a Broiler Farm After a Disease Outbreak. Avian Dis. 2013, 57, 803–807. [Google Scholar] [CrossRef] [PubMed]
- Caraguel, C.G.B.; Stryhn, H.; Gagné, N.; Dohoo, I.R.; Hammell, K.L. Selection of a cutoff value for real-time polymerase chain reaction results to fit a diagnostic purpose: Analytical and epidemiologic approaches. J. Vet. Diagn. Invest. 2011, 2–15. [Google Scholar] [CrossRef] [PubMed]
- National Center for Biotechnology Information. The Nucleotide Database. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome.2021[cited (accessed on 31 March 2021).
- Behlke, M.A.; Huang, L.; Bogh, L.; Rose, S.; Devor, E.J. Fluorescence quenching by proximal G-bases. Integr. DNA Technol. 2005, 1–3. Available online: http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.586.3061&rep=rep1&type=pdf (accessed on 11 November 2021).
- Calculating Inter- and Intra-Assay Coefficients of Variability. Available online: https://salimetrics.com/calculating-inter-and-intra-assay-coefficients-of-variability (accessed on 14 October 2021).
- Balakrishnan, B.; Luckey, D.; Marietta, E.; Karau, M.; Patel, R.; Murray, J.; Taneja, V. Development of a real-time PCR method for quantification of Prevotella histicola from the gut. Anaerobe 2017, 48, 37–41. [Google Scholar] [CrossRef]
- Fan, X.; Lin, F.; Zhang, Y.; Zhao, J.; Li, H.; Yao, S. A simple adenosine fluorescent aptasensor based on the quenching ability of guanine. New J. Chem. 2012, 36, 2260–2265. [Google Scholar] [CrossRef]
- Torimura, M.; Kurata, S.; Yamada, K.; Yokomaku, T.; Kamagata, Y.; Kanagawa, T.; Kurane, R. Fluorescence-Quenching Phenomenon by Photoinduced Electron Transfer between a Fluorescent Dye and a Nucleotide Base. Anal. Sci. 2001, 17, 155–160. [Google Scholar] [CrossRef]
- Marshall, O.J. PerlPrimer: Cross-platform, graphical primer design for standard, bisulphite and real-time PCR. Bioinformatics 2004, 20, 2471–2472. [Google Scholar] [CrossRef] [PubMed]
- Owczarzy, R.; Tataurov, A.V.; Wu, Y.; Manthey, J.A.; McQuisten, K.A.; Almabrazi, H.G.; Pedersen, K.F.; Lin, Y.; Garretson, J.; McEntaggart, N.O.; et al. IDT SciTools: A suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res. 2008, 36, W163–W169. [Google Scholar] [CrossRef] [PubMed]
- Qu, W.; Zhou, Y.; Zhang, Y.; Lu, Y.; Wang, X.; Zhao, D.; Yang, Y.; Zhang, C. MFEprimer-2.0: A fast thermodynamics-based program for checking PCR primer specificity. Nucleic Acids Res. 2012, 40, W205–W208. [Google Scholar] [CrossRef] [PubMed]
- Rychlik, W. OLIGO 7 primer analysis software. PCR Primer Des. 2007, 35–59. [Google Scholar]
- Untergasser, A. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Rychlik, W. Selection of Primers for Polymerase Chain Reaction. In PCR Protocols; Humana Press: Totowa, NJ, USA, 1993; Volume 15, pp. 31–40. [Google Scholar]
- Bustin, S.A. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experi-ments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Raymaekers, M.; Smets, R.; Maes, B.; Cartuyvels, R. Checklist for optimization and validation of real-time PCR assays. J. Clin. Lab. Anal. 2009, 23, 145–151. [Google Scholar] [CrossRef]
- Pryor, R.J.; Wittwer, C.T. Real-Time Polymerase Chain Reaction and Melting Curve Analysis. In Clinical Applications of PCR; Lo, Y.M.D., Chiu, R.W.K., Chan, K.C.A., Eds.; Humana Press: Totowa, NJ, USA, 2006; pp. 19–32. [Google Scholar]
- Bustin, S.; Huggett, J. qPCR primer design revisited. Biomol. Detect. Quantif. 2017, 14, 19–28. [Google Scholar] [CrossRef]


| Oligo | Sequence (5′ to 3′) | Length (bp) | Nt Position a | Amplified Segment Length | Reference |
|---|---|---|---|---|---|
| Forward Primer | GAG AAT TAA TTT TCG GAT TAA G | 22 | 385,848–385,869 | 119 bp | Currently available assay [10] |
| Reverse Primer | CAA TCA AAA TCT TAT GGA GT | 20 | 385,751–385,770 | ||
| Probe | FAM GTA ACG CGT/ZEN/ATG CAA CTT GC 3IABkFQ b | 20 | 385,809–385,828 | ||
| Forward Primer | GAGAATTAATTTTCGGATTAAG | 22 | 385,848–385,869 | 119 bp | Modified probe assay (This study) |
| Reverse Primer | CAATCAAAATCTTATGGAGT | 20 | 385,751–385,770 | ||
| Probe | FAM TAA CGC GTA/ZEN/TGC AAC TTG C 3IABkFQ | 19 | 385,809–385,827 | ||
| Forward Primer | CTA CCA ACT AAC TAA TCT GAC GCA | 24 | 385,685–385,708 | 131 bp | Newly developed assay (This study) |
| Reverse Primer | AAC TTG CCC TTA TCA GGA GGA T | 22 | 385,794–385,815 | ||
| Probe | FAM CGG GGA AAC/ZEN/TCG GAT TAA TAC TCC ATA AG 3IABkFQ | 29 | 385,761–385,789 |
| Sample No. | Organism | Information * (Age, Spp., and Year) | Sample Type * | Serotype | Currently Available ORT qPCR [10] | Probe Modified qPCR | Newly Developed qPCR | Growth Conditions According to |
|---|---|---|---|---|---|---|---|---|
| 1 | ORT | 43 days-Chicken-2020 | Isolate | - | + | + | + | [22] |
| 2 | ORT | 28 days-Chicken-2020 | Isolate | - | + | + | + | [22] |
| 3 | ORT | 23 days-Chicken-2019 | Isolate | - | + | + | + | [22] |
| 4 | ORT | 26 days-Chicken-2020 | Isolate | - | + | + | + | [22] |
| 5 | ORT | 39 days-Chicken-2019 | Isolate | - | + | + | + | [22] |
| 6 | ORT | 36 days-Chicken-2019 | Isolate | - | + | + | + | [22] |
| 7 | ORT | - | Isolate | - | + | + | + | [22] |
| 8 | ORT | - -1999 | Isolate | - | + | + | + | [22] |
| 9 | ORT | - -Turkey-2009 | Isolate | N | + | + | + | [22] |
| 10 | ORT | - -Turkey-2008 | Isolate | H | + | + | + | [22] |
| 11 | ORT | - -Turkey-2009 | Isolate | N | + | + | + | [22] |
| 12 | ORT | - -Turkey-2009 | Isolate | N | + | + | + | [22] |
| 13 | ORT | - -Turkey-2008 | Isolate | H | + | + | + | [22] |
| 14 | ORT | - -Turkey-2009 | Isolate | H | + | + | + | [22] |
| 15 | ORT | - -Turkey-2009 | Isolate | H | + | + | + | [22] |
| 16 | ORT | - -Turkey-2008 | Isolate | - | + | + | + | [22] |
| 17 | ORT | - -Turkey-2009 | Isolate | H | + | + | + | [22] |
| 18 | ORT | - -Turkey-2009 | Isolate | - | + | + | + | [22] |
| 19 | ORT | - -Turkey-2008 | Isolate | H | + | + | + | [22] |
| 20 | ORT | - -Turkey-2009 | Isolate | H | + | + | + | [22] |
| 21 | ORT | - -Turkey-2009 | Isolate | H | + | + | + | [22] |
| 22 | ORT | - -Turkey- | Isolate | H | + | + | + | [22] |
| 23 | ORT | - -Turkey- - | Isolate | H | + | + | + | [22] |
| 24 | ORT | - -1996 | Isolate | - | + | + | + | [22] |
| 25 | ORT | Chicken-2019 | Isolate | F | + | + | + | [22] |
| 26 | ORT | Chicken-2019 | Isolate | F | + | + | + | [22] |
| 27 | ORT | Chicken-2019 | Isolate | N | + | + | + | [22] |
| 28 | ORT | Chicken-2019 | Isolate | J | + | + | + | [22] |
| 29 | ORT | Chicken-2014 | Isolate | A | + | + | + | [22] |
| 30 | ORT | Chicken-2014 | Isolate | A | + | + | + | [22] |
| 31 | ORT | Chicken-2014 | Isolate | C | + | + | + | [22] |
| 32 | ORT | Chicken-2014 | Isolate | C | + | + | + | [22] |
| 33 | ORT | Chicken | Isolate | D | + | + | + | [22] |
| 34 | ORT | Chicken | Isolate | L | + | + | + | [22] |
| 35 | ORT | Chicken | Isolate | G | + | + | + | [22] |
| 36 | ORT | Chicken | Isolate | G | + | + | + | [22] |
| 37 | ORT | Chicken | Isolate | J | + | + | + | [22] |
| 38 | ORT | Chicken | Isolate | E | + | + | + | [22] |
| 39 | Mycoplasma gallisepticum | - | Isolate | - | – | – | – | [23] |
| 40 | Mycoplasma iowae | - | Isolate | - | – | – | – | [24] |
| 41 | Mycoplasma synoviae | - | Isolate | - | – | – | – | [23] |
| 42 | Bordetella hinzii | - | Isolate | - | – | – | – | [25] |
| 43 | Pasteurella multocida | - | Isolate | - | – | – | – | [26] |
| 44 | Pasteurella multocida | - | Isolate | - | – | – | – | [26] |
| 45 | Escherichia coli | - | Isolate | - | – | – | – | [27] |
| 46 | Gallibacterium anatis | - | Isolate | - | – | – | – | [28] |
| 47 | Erysipelothrix rhusiopathiae | - | Isolate | - | – | – | – | [29] |
| 48 | Staphylococcus aureus | - | Isolate | - | – | – | – | [30] |
| 49 | Avibacterium paragallinarum | - | Isolate | - | – | – | – | [31] |
| 50 | Bordetella avium | - | Isolate | - | – | – | – | [32] |
| 51 | Avian Avulavirus 1 (Newcastle Disease) | - | Isolate | - | – | – | – | [33] |
| 52 | Avian Reovirus | - | Isolate | - | – | – | – | [34] |
| 53 | Infectious Bronchitis Virus | - | Isolate | - | – | – | – | [35] |
| 54 | Infectious Bronchitis Virus | - | Isolate | - | – | – | – | [35] |
| 55 | Infectious Bronchitis Virus | - | Isolate | - | – | – | – | [35] |
| 56 | Infectious Laryngotracheitis Virus | - | Isolate | - | – | – | – | [36] |
| Sample No. | Information a (Age, host, and year) | Sample Type | Currently Available ORT qPCR (CT value) | Probe Modified qPCR (CT value) | Newly Developed qPCR (CT value) |
|---|---|---|---|---|---|
| 1 | 64 days-Turkey-2019 | Oropharyngeal swab b | 19.47 | 16.95 | 15.02 |
| 2 | 63 days-Turkey-2019 | Lung homogenate b | 27.66 | 24.45 | 19.42 |
| 3 | 63 days-Turkey-2019 | Oropharyngeal swab b | 20.75 | 17.71 | 14.51 |
| 4 | 42 days-Turkey-2019 | Tracheal homogenate b | 22.38 | 19.26 | 15.38 |
| 5 | 14 days-Turkey-2019 | Tracheal swabs b | 27.67 | 21.53 | 19.22 |
| 6 | 14 days-Turkey-2019 | Tracheal swabs b | 23.48 | 19.44 | 16.05 |
| 7 | 48 days-Turkey-2019 | Tracheal homogenate b | 20.77 | 17.29 | 14.26 |
| 8 | 48 days-Turkey-2019 | Tracheal swabs b | 30.80 | 28.02 | 21.80 |
| 9 | 392 days-Chicken-2020 | Tracheal swabs b | 22.18 | 19.02 | 15.38 |
| 10 | 4.5 years-Chicken-2019 | Lung homogenate c | – | – | – |
| 11 | 4.5 years-Chicken-2019 | Tracheal homogenate c | − | – | – |
| 12 | 7 days-Turkey-2019 | Tracheal homogenate c | – | – | – |
| 13 | 7 days-Turkey-2019 | Lung homogenate c | – | – | – |
| 14 | 51 days-Turkey-2019 | Lung homogenate c | – | – | – |
| 15 | 67 days-Turkey-2019 | Lung homogenate c | – | – | – |
| 16 | 10 days-Turkey-2019 | Tracheal homogenate c | – | – | – |
| 17 | 10 days-Turkey-2019 | Tracheal homogenate c | – | – | – |
| 18 | 252 days-Chicken-2019 | Lung homogenate c | – | – | – |
| 19 | 266 days-Chicken-2019 | Lung homogenate c | – | – | – |
| 20 | 266 days-Chicken-2019 | Tracheal homogenate c | – | – | – |
| 21 | 595 days-Chicken-2019 | Tracheal homogenate c | – | – | – |
| 22 | 595 days-Chicken-2019 | Lung homogenate c | – | – | – |
| 23 | 2 days-Turkey-2019 | Lung homogenate c | – | – | – |
| 24 | 2 days-Turkey-2019 | Tracheal homogenate c | – | – | – |
| 25 | 21 days-Turkey-2019 | Lung homogenate c | – | – | – |
| 26 | 21 days-Turkey-2019 | Tracheal homogenate c | – | – | – |
| qPCR Assay | Target Gene | Amplicon Size | Limit of Detection | Linear Equation | R2 | Efficiency |
|---|---|---|---|---|---|---|
| Current assay | 16S rRNA | 119 bp | 1 × 106 copies/mL | y = −4.193x + 35.937 | R² = 1 | E = 73.18 % |
| Modified probe assay | 119 bp | 1 × 105 copies/mL | y = −4.1812x + 37.666 | R² = 0.999 | E = 73.45% | |
| Newly developed assay | 131 bp | 1 × 103 copy/mL | y = −3.3534x + 36.013 | R² = 1 | E = 98.70% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hashish, A.; Sinha, A.; Sato, Y.; Macedo, N.R.; El-Gazzar, M. Development and Validation of a New TaqMan Real-Time PCR for the Detection of Ornithobacterium rhinotracheale. Microorganisms 2022, 10, 341. https://doi.org/10.3390/microorganisms10020341
Hashish A, Sinha A, Sato Y, Macedo NR, El-Gazzar M. Development and Validation of a New TaqMan Real-Time PCR for the Detection of Ornithobacterium rhinotracheale. Microorganisms. 2022; 10(2):341. https://doi.org/10.3390/microorganisms10020341
Chicago/Turabian StyleHashish, Amro, Avanti Sinha, Yuko Sato, Nubia R. Macedo, and Mohamed El-Gazzar. 2022. "Development and Validation of a New TaqMan Real-Time PCR for the Detection of Ornithobacterium rhinotracheale" Microorganisms 10, no. 2: 341. https://doi.org/10.3390/microorganisms10020341
APA StyleHashish, A., Sinha, A., Sato, Y., Macedo, N. R., & El-Gazzar, M. (2022). Development and Validation of a New TaqMan Real-Time PCR for the Detection of Ornithobacterium rhinotracheale. Microorganisms, 10(2), 341. https://doi.org/10.3390/microorganisms10020341

