Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk
Abstract
1. Introduction
2. Results
2.1. Specimens Included in the Study
2.2. Molecular Screening
2.3. Host-pathogens Relationships
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Study Area and Samples Collection
4.3. DNA Extraction
4.4. Pathogens DNA Detection, PCR Amplification, and Phylogenetic Analysis
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Capizzi, D.; Bertolino, S.; Mortelliti, A. Rating the rat: Global patterns and research priorities in impacts and management of rodent pests. Mamm. Rev. 2014, 44, 148–162. [Google Scholar] [CrossRef] [Scilit]
- Dalecky, A.; Bâ, K.; Piry, S.; Lippens, C.; Diagne, C.A.; Kane, M.; Sow, A.; Diallo, M.; Niang, Y.; Konečný, A.; et al. Range expansion of the invasive house mouse Mus musculus domesticus in Senegal, West Africa: A synthesis of trapping data over three decades, 1983–2014. Mamm. Rev. 2015, 45, 176–190. [Google Scholar] [CrossRef] [Scilit]
- Hassell, J.M.; Begon, M.; Ward, M.J.; Fèvre, E.M. Urbanization and Disease Emergence: Dynamics at the Wildlife-Livestock-Human Interface. Trends Ecol. Evol. 2017, 32, 55–67. [Google Scholar] [CrossRef] [Scilit]
- Taylor, P.J.; Arntzen, L.; Hayter, M.; Iles, M.; Frean, J.; Belmain, S. Understanding and managing sanitary risks due to rodent zoonoses in an African city: Beyond the Boston Model. Integr. Zool. 2008, 3, 38–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobigny, G.; Garba, M.; Tatard, C.; Loiseau, A.; Galan, M.; Kadaouré, I.; Rossi, J.-P.; Picardeau, M.; Bertherat, E. Urban Market Gardening and Rodent-Borne Pathogenic Leptospira in Arid Zones: A Case Study in Niamey, Niger. PLoS Negl. Trop. Dis. 2015, 9, e0004097. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buckle, A.P.; Smith, R. Rodent Pests and Their Control; CABI: Wallingford, UK, 2014. [Google Scholar]
- Meerburg, B.G.; Singleton, G.R.; Kijlstra, A. Rodent-borne diseases and their risks for public health Rodent-borne diseases and their risks for public health. Crit. Rev. Microbiol. 2009, 35, 221–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimi, A.; Keyhani, M.; Hedayati, K. Studies on salmonellosis in the house mouse. Mus Musculus. Lab. Anim. 1979, 13, 33–34. [Google Scholar] [CrossRef] [Scilit]
- Reperant, L.A.; Deplazes, P. Cluster of Capillaria hepatica infections in non-commensal rodents from the canton of Geneva, Switzerland. Parasitol. Res. 2005, 96, 340–342. [Google Scholar] [CrossRef] [Scilit]
- Riehm, J.M.; Tserennorov, D.; Kiefer, D.; Stuermer, I.W.; Tomaso, H.; Zoller, L.; Otgonbaatar, D.; Scholz, H.C. Yersinia pestis in small rodents, Mongolia. Emerg. Infect. Dis. 2011, 17, 1320–1322. [Google Scholar] [CrossRef] [Scilit]
- Obiegala, A.; Pfeffer, M.; Pfister, K.; Karnath, C.; Silaghi, C. Molecular examinations of Babesia microti in rodents and rodent-attached ticks from urban and sylvatic habitats in Germany. Ticks Tick. Borne. Dis. 2015, 6, 445–449. [Google Scholar] [CrossRef] [Scilit]
- Goeijenbier, M.; Wagenaar, J.; Goris, M.; Martina, B.; Henttonen, H.; Vaheri, A.; Reusken, C.; Hartskeerl, R.; Osterhaus, A.; Van Gorp, E. Rodent-borne hemorrhagic fevers: Under-recognized, widely spread and preventable-epidemiology, diagnostics and treatment. Crit. Rev. Microbiol. 2013, 39, 26–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Soolingen, D.; van der Zanden, A.G.; de Haas, P.E.; Noordhoek, G.T.; Kiers, A.; Foudraine, N.A.; Portaels, F.; Kolk, A.H.; Kremer, K.; van Embden, J.D. Diagnosis of Mycobacterium microti infections among humans by using novel genetic markers. J. Clin. Microbiol. 1998, 36, 1840–1845. [Google Scholar] [CrossRef] [Scilit]
- Kim, C.-M.; Yi, Y.-H.; Yu, D.-H.; Lee, M.-J.; Cho, M.-R.; Desai, A.R.; Shringi, S.; Klein, T.A.; Kim, H.-C.; Song, J.-W.; et al. Tick-Borne Rickettsial Pathogens in Ticks and Small Mammals in Korea. Appl. Environ. Microbiol. 2006, 72, 5766–5776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rabiee, M.H.; Mahmoudi, A.; Siahsarvie, R.; Kryštufek, B.; Mostafavi, E. Rodent-borne diseases and their public health importance in Iran. PLoS Negl. Trop. Dis. 2018, 12, e0006256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duplantier, J.M.; Granjon, L.; Adam, F.B.K. Répartition Actuelle du rat noir (Rattus rattus) au Sénégal: Facteurs Historiques et Ecologiques. In Actes du colloque « Le Rongeur et l’Espace n° 2 »; Le Berre, M., Le Guelte, L., Eds.; Chabaud éditions: Lyon, France, 1991; pp. 339–346. [Google Scholar]
- Granjon, L.; Duplantier, J.M. Les Rongeurs de l’Afrique Sahelo-Soudanienne; Editions de l’IRD: Marseille, France, 2009. [Google Scholar]
- Duplantier, J.M.; Granjon, L.; Bâ, K. Répartition biogéo-graphique des petits rongeurs au Sénégal. J. Afr. Zool. 1997, 111, 17–26. [Google Scholar]
- Mediannikov, O.; Aubadie, M.; Bassene, H.; Diatta, G.; Granjon, L.; Fenollar, F. Three new Bartonella species from rodents in Senegal. Int. J. Infect. Dis. 2014, 21, 335. [Google Scholar] [CrossRef] [Scilit]
- Diagne, C.; Galan, M.; Tamisier, L.; D’Ambrosio, J.; Dalecky, A.; Bâ, K.; Kane, M.; Niang, Y.; Diallo, M.; Sow, A.; et al. Ecological and sanitary impacts of bacterial communities associated to biological invasions in African commensal rodent communities. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Diagne, C.; Ribas, A.; Charbonnel, N.; Dalecky, A.; Tatard, C.; Gauthier, P.; Haukisalmi, V.; Fossati-Gaschignard, O.; Bâ, K.; Kane, M.; et al. Parasites and invasions: Changes in gastrointestinal helminth assemblages in invasive and native rodents in Senegal. Int. J. Parasitol. 2016, 46, 857–869. [Google Scholar] [CrossRef] [Scilit]
- Diagne, C.; Gilot-Fromont, E.; Cornet, S.; Husse, L.; Doucouré, S.; Dalecky, A.; Bâ, K.; Kane, M.; Niang, Y.; Diallo, M. Contemporary variations of immune responsiveness during range expansion of two invasive rodents in Senegal. Oikos 2017, 126, 435–446. [Google Scholar] [CrossRef] [Scilit]
- Thiam, M.; Bâ, K.; Duplantier, J.-M. Impacts of climatic changes on small mammal communities in the Sahel (West Africa) as evidenced by owl pellet analysis. Afr. Zool. 2008, 43, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Boëtsch, G.; Guissé, A.; Duboz, P. La Grande Muraille Verte-CNRS Editions. Available online: http://www.cnrseditions.fr/sociologie-ethnologie-anthropologie/7835-la-grande-muraille-verte.html (accessed on 3 April 2019).
- Dahmana, H.; Amanzougaghene, N.; Davoust, B.; Normand, T.; Carette, O.; Demoncheaux, J.-P.; Mulot, B.; Fabrizy, B.; Scandola, P.; Chik, M.; et al. Great diversity of Piroplasmida in Equidae in Africa and Europe, including potential new species. Vet. Parasitol. Reg. Stud. Rep. 2019, 18, 100332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahmani, M.; Davoust, B.; Tahir, D.; Raoult, D.; Fenollar, F.; Mediannikov, O. Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France. Parasit. Vectors 2017, 10, 302. [Google Scholar] [CrossRef] [Scilit]
- Subramanian, G.; Sekeyova, Z.; Raoult, D.; Mediannikov, O. Multiple tick-associated bacteria in Ixodes ricinus from Slovakia. Ticks Tick. Borne. Dis. 2012, 3, 406–410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sokhna, C.; Mediannikov, O.; Fenollar, F.; Bassene, H.; Diatta, G.; Tall, A.; Trape, J.-F.; Drancourt, M.; Raoult, D. Point-of-care laboratory of pathogen diagnosis in rural Senegal. PLoS Negl. Trop. Dis. 2013, 7, e1999. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jensen, W.A.; Fall, M.Z.; Rooney, J.; Kordick, D.L.; Breitschwerdt, E.B. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J. Clin. Microbiol. 2000, 38, 1717–1722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Musser, K.A.; Passaretti, T.; Mitchell, K.K.; Huth, P.; Smith, G.; Davidson, A.; Dickinson, M.; Kidney, A.; Cole, J.; Dumas, N.; et al. Detection of Streptobacillus moniliformis in whole blood by real-time PCR and review of clinical cases 2004-2015 in New York State. J. Microbiol. Infect. Dis. 2017, 7, 88–92. [Google Scholar]
- Hodžić, A.; Alić, A.; Prašović, S.; Otranto, D.; Baneth, G.; Duscher, G.G. Hepatozoon silvestris sp. nov.: Morphological and molecular characterization of a new species of Hepatozoon (Adeleorina: Hepatozoidae) from the European wild cat (Felis silvestris silvestris). Parasitology 2017, 144, 650–661. [Google Scholar] [CrossRef] [Scilit]
- Bittar, F.; Keita, M.B.; Lagier, J.C.; Peeters, M.; Delaporte, E.; Raoult, D. Gorilla gorilla gorilla gut: A potential reservoir of pathogenic bacteria as revealed using culturomics and molecular tools. Sci. Rep. 2014, 4, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Obeid, M.; Franetich, J.-F.; Lorthiois, A.; Gego, A.; Grüner, A.C.; Tefit, M.; Boucheix, C.; Snounou, G.; Mazier, D. Skin-draining lymph node priming is sufficient to induce sterile immunity against pre-erythrocytic malaria. EMBO Mol. Med. 2013, 5, 250–263. [Google Scholar] [CrossRef] [Scilit]
- Medkour, H.; Varloud, M.; Davoust, B.; Mediannikov, O. New Molecular Approach for the Detection of Kinetoplastida Parasites of Medical and Veterinary Interest. Microorganisms 2020, 8, 356. [Google Scholar] [CrossRef] [Scilit]
- Tomé, B.; Maia, J.P.M.C.; Harris, D.J. Molecular Assessment of Apicomplexan Parasites in the Snake Psammophis from North Africa: Do Multiple Parasite Lineages Reflect the Final Vertebrate Host Diet? J. Parasitol. 2013, 99, 883–887. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piasecki, T.; Chrzastek, K.; Kasprzykowska, U. Mycoplasma pulmonis of Rodents as a Possible Human Pathogen. Vector Borne Zoonotic Dis. 2017, 17, 475–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatard, C.; Garba, M.; Gauthier, P.; Hima, K.; Artige, E.; Dossou, D.K.H.J.; Gagaré, S.; Genson, G.; Truc, P.; Dobigny, G. Rodent-borne Trypanosoma from cities and villages of Niger and Nigeria: A special role for the invasive genus Rattus? Acta Trop. 2017, 171, 151–158. [Google Scholar] [CrossRef] [Scilit]
- Cosson, J.F.; Galan, M.; Bard, E.; Razzauti, M.; Bernard, M.; Morand, S.; Brouat, C.; Dalecky, A.; Bâ, K.; Charbonnel, N.; et al. Detection of Orientia sp. DNA in rodents from Asia, West Africa and Europe. Parasit. Vectors 2015, 8, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serge, M.; Frédéric, B.; Hsuan-Wien, C.; Julien, C.; Jean-François, C.; Maxime, G.; Gábor, Á.C.; Alex, G.D.; Alice, L.; Johan, M.; et al. Global parasite and Rattus rodent invasions: The consequences for rodent-borne diseases. Integr. Zool. 2015, 10, 409–423. [Google Scholar]
- Kraljik, J.; Paziewska-Harris, A.; Miklisová, D.; Blaňarová, L.; Mošanský, L.; Bona, M.; Stanko, M. Genetic diversity of Bartonella genotypes found in the striped field mouse (Apodemus agrarius) in Central Europe. Parasitology 2016, 143, 1437–1442. [Google Scholar] [CrossRef] [Scilit]
- Abreu-yanes, E.; Martin-alonso, A.; Martin-carrillo, N.; Livia, K.G.; Marrero-gagliardi, A.; Valladares, B.; Feliu, C.; Foronda, P. Bartonella in Rodents and Ectoparasites in the Canary Islands. Spain: New Insights into Host–Vector–Pathogen Relationships. Microb. Ecol. 2018, 75, 264–273. [Google Scholar] [CrossRef] [Scilit]
- Martin-Alonso, A.; Houemenou, G.; Abreu-Yanes, E.; Valladares, B.; Feliu, C.; Foronda, P. Bartonella spp. in Small Mammals, Benin. Vector Borne Zoonotic Dis. 2016, 16, 229–237. [Google Scholar] [CrossRef] [Scilit]
- Cutler, S.J.; Ruzic-Sabljic, E.; Potkonjak, A. Emerging borreliae–Expanding beyond Lyme borreliosis. Mol. Cell. Probes 2017, 31, 22–27. [Google Scholar] [CrossRef] [Scilit]
- Diatta, G.; Duplantier, J.-M.; Granjon, L.; Bâ, K.; Chauvancy, G.; Ndiaye, M.; Trape, J.-F. Borrelia infection in small mammals in West Africa and its relationship with tick occurrence inside burrows. Acta Trop. 2015, 152, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Goutier, S.; Ferquel, E.; Pinel, C.; Bosseray, A.; Hoen, B.; Couetdic, G.; Bourahoui, A.; Lapostolle, C.; Pelloux, H.; Garnier, M.; et al. Borrelia crocidurae Meningo-encephalitis, West Africa. Emerg. Infect. Dis. 2013, 19, 301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Souidi, Y.; Boudebouch, N.; Ezikouri, S.; Belghyti, D.; Trape, J.-F.; Sarih, M. Borrelia crocidurae in Ornithodoros ticks from northwestern Morocco: A range extension in relation to climatic change? J. Vector Ecol. 2014, 39, 316–320. [Google Scholar] [CrossRef] [PubMed]
- Trape, J.-F.; Diatta, G.; Arnathau, C.; Bitam, I.; Sarih, M.; Belghyti, D.; Bouattour, A.; Elguero, E.; Vial, L.; Mané, Y.; et al. The epidemiology and geographic distribution of relapsing fever borreliosis in West and North Africa, with a review of the Ornithodoros erraticus complex (Acari: Ixodida). PLoS ONE 2013, 8, e78473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mediannikov, O.; Socolovschi, C.; Bassene, H.; Diatta, G.; Ratmanov, P.; Fenollar, F.; Sokhna, C.; Raoult, D. Borrelia crocidurae infection in acutely febrile patients, Senegal. Emerg. Infect. Dis. 2014, 20, 1335–1338. [Google Scholar] [CrossRef] [Scilit]
- Vial, L.; Diatta, G.; Tall, A.; Hadj Ba, E.; Bouganali, H.; Durand, P.; Sokhna, C.; Rogier, C.; Renaud, F.; Trape, J.F. Incidence of tick-borne relapsing fever in west Africa: Longitudinal study. Lancet 2006, 368, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Dobigny, G. Inventaire et Biogéographie des Rongeurs du Niger: Nuisance aux Cultures, Implications Dans Certains Problemes de Santé Publique et Vetérinaire, Rapport de Coopération (CSN Niger 1999-2000). <hal-00394489>2000. 2000. Available online: https://www.documentation.ird.fr/hor/fdi:010049962 (accessed on 6 March 2020).
- Godeluck, B.; Duplantier, J.-M.; Ba, K.; Trape, J.-F. A Longitudinal survey of Borrelia crocidurae prevalence in rodents and insectivores in Senegal. Am. J. Trop. Med. Hyg. 1994, 50, 165–168. [Google Scholar] [CrossRef] [Scilit]
- Trape, J.F.; Godeluck, B.; Diatta, G.; Rogier, C.; Legros, F.; Albergel, J.; Pepin, Y.; Duplantier, J.M. The spread of tick-borne borreliosis in West Africa and its relationship to sub-Saharan drought. Am. J. Trop. Med. Hyg. 1996, 54, 289–293. [Google Scholar] [CrossRef] [Scilit]
- Trape, J.F.; Duplantier, J.M.; Bouganali, H.; Godeluck, B.; Legros, F.; Cornet, J.P.; Camicas, J.L. Tick-borne borreliosis in West Africa. Lancet 1991, 337, 473–475. [Google Scholar] [CrossRef] [Scilit]
- Fotso Fotso, A.; Mediannikov, O.; Padmanabhan, R.; Robert, C.; Fournier, P.-E.; Raoult, D.; Drancourt, M. Genome Sequence of Borrelia crocidurae Strain 03-02, a Clinical Isolate from Senegal. Genome Announc. 2014, 2. [Google Scholar] [CrossRef] [Scilit]
- Benevenute, J.L.; Dumler, J.S.; Ogrzewalska, M.; Roque, A.L.R.; Mello, V.V.C.; de Sousa, K.C.M.; Gonçalves, L.R.; D’Andrea, P.S.; de Sampaio Lemos, E.R.; Machado, R.Z.; et al. Assessment of a quantitative 5′ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil. Ticks Tick. Borne. Dis. 2017, 8, 646–656. [Google Scholar] [CrossRef] [Scilit]
- Djiba, M.L.; Mediannikov, O.; Mbengue, M.; Thiongane, Y.; Molez, J.-F.; Seck, M.T.; Fenollar, F.; Raoult, D.; Ndiaye, M. Survey of Anaplasmataceae bacteria in sheep from Senegal. Trop. Anim. Health Prod. 2013, 45, 1557–1561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murray RG, E.; Stackebrandt, E. Taxonomic Note: Implementation of the Provisional Status Candidatus for Incompletely Described Procaryotes. Int. J. Syst. Evol. Microbiol. 1995, 45, 186–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jahfari, S.; Claudia Coipan, E.; Fonville, M.; Docters van Leeuwen, A.; Hengeveld, P.; Heylen, D.; Heyman, P.; van Maanen, C.; Butler, C.M.; Földvári, G.; et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasites Vectors 2014, 7, 365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritt, B.S.; Sloan, L.M.; Hoang Johnson, D.K.; Munderloh, U.G.; Paskewitz, S.M.; McElroy, K.M.; McFadden, J.D.; Binnicker, M.J.; Neitzel, D.F.; Liu, G.; et al. Emergence of a New Pathogenic Ehrlichia Species, Wisconsin and Minnesota, 2009. N. Engl. J. Med. 2011, 365, 422–429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsumoto, K.; Takeuchi, T.; Yokoyama, N.; Katagiri, Y.; Ooshiro, M.; Zakimi, S.; Kawamori, F.; Ohashi, N.; Inokuma, H. Detection of the New Ehrlichia Species Closely Related to Ehrlichia ewingii from Haemaphysalis longicornis in Yonaguni Island, Okinawa, Japan. J. Vet. Med Sci. 2011, 73, 1485–1488. [Google Scholar] [CrossRef] [Scilit]
- Vinasco, J.; Li, O.; Alvarado, A.; Diaz, D.; Hoyos, L.; Tabachi, L.; Sirigireddy, K.; Ferguson, C.; Moro, M.H. Molecular Evidence of a New Strain of Ehrlichia canis from South America. J. Clin. Microbiol. 2007, 45, 2716–2719. [Google Scholar] [CrossRef] [Scilit]
- de Demoner, L.C.; Magro, N.M.; da Silva, M.R.L.; de Paula Antunes, J.M.A.; Calabuig, C.I.P.; O’Dwyer, L.H. Hepatozoon spp. infections in wild rodents in an area of endemic canine hepatozoonosis in southeastern Brazil. Ticks Tick. Borne. Dis. 2016, 7, 859–864. [Google Scholar] [CrossRef] [Scilit]
- Johnson, E.M.; Allen, K.E.; Panciera, R.J.; Ewing, S.A.; Little, S.E.; Reichard, M.V. Field survey of rodents for Hepatozoon infections in an endemic focus of American canine hepatozoonosis. Vet. Parasitol. 2007, 150, 27–32. [Google Scholar] [CrossRef] [Scilit]
- Sloboda, M.; Kamler, M.; Bulantová, J.; Votýpka, J.; Modrý, D. Rodents as intermediate hosts of Hepatozoon ayorgbor (Apicomplexa: Adeleina: Hepatozoidae) from the African ball python, Python regius? Fol. Paras. 2008, 55, 13–16. [Google Scholar] [CrossRef] [Scilit]
- Murata, T.; Inoue, M.; Tateyama, S.; Taura, Y. Vertical transmission of Hepatozoon canis in dogs; Japan. J. Vet. Med. Sci. 1993, 55, 867–868. [Google Scholar] [CrossRef] [Scilit]
- Kamani, J.; Harrus, S.; Nachum-Biala, Y.; Gutiérrez, R.; Mumcuoglu, K.Y.; Baneth, G. Prevalence of Hepatozoon and Sarcocystis spp. in rodents and their ectoparasites in Nigeria. Acta Trop. 2018, 187, 124–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Navea-Pérez, H.M.; Díaz-Sáez, V.; Corpas-López, V.; Merino-Espinosa, G.; Morillas-Márquez, F.; Martín-Sánchez, J. Leishmania infantum in wild rodents: Reservoirs or just irrelevant incidental hosts? Parasitol. Res. 2015, 114, 2363–2370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pumhom, P.; Morand, S.; Tran, A.; Jittapalapong, S.; Desquesnes, M. Trypanosoma from rodents as potential source of infection in human-shaped landscapes of South-East Asia. Vet. Parasitol. 2015, 208, 174–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Sousa, K.C.M.; Fernandes, M.P.; Herrera, H.M.; Freschi, C.R.; Machado, R.Z.; André, M.R. Diversity of piroplasmids among wild and domestic mammals and ectoparasites in Pantanal wetland, Brazil. Ticks Tick. Borne. Dis. 2017, 9, 245–253. [Google Scholar] [CrossRef] [Scilit]
- Saito-Ito, A.; Yano, Y.; Dantrakool, A.; Hashimoto, T.; Takada, N. Survey of Rodents and Ticks in Human Babesiosis Emergence Area in Japan: First Detection of Babesia microti-Like Parasites in Ixodes ovatus. J. Clin. Microbiol. 2004, 42, 2268–2270. [Google Scholar] [CrossRef] [Scilit]
- Dantrakool, A.; Somboon, P.; Hashimoto, T.; Saito-Ito, A. Identification of a New Type of Babesia Species in Wild Rats (Bandicota indica) in Chiang Mai Province, Thailand. J. Clin. Microbiol. 2004, 42, 850–854. [Google Scholar] [CrossRef] [Scilit]
- Beck, R.; Vojta, L.; Ćurković, S.; Mrljak, V.; Margaletić, J.; Habrun, B. Molecular Survey of Babesia microti in Wild Rodents in Central Croatia. Vector-Borne Zoonotic Dis. 2011, 11, 81–83. [Google Scholar] [CrossRef] [Scilit]
- Bajer, A.; Alsarraf, M.; Bednarska, M.; Mohallal, E.M.; Mierzejewska, E.J.; Behnke-Borowczyk, J.; Zalat, S.; Gilbert, F.; Welc-Falęciak, R. Babesia behnkei sp. nov., a novel Babesia species infecting isolated populations of Wagner’s gerbil, Dipodillus dasyurus, from the Sinai Mountains, Egypt. Parasit. Vectors 2014, 7, 572. [Google Scholar] [CrossRef] [Scilit]
- Krasnov, B.R.; Bordes, F.; Khokhlova, I.S.; Morand, S. Gender-biased parasitism in small mammals: Patterns, mechanisms, consequences. Mammalia 2012, 76, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Harrison, A.; Scantlebury, M.; Montgomery, W.I. Body mass and sex-biased parasitism in wood mice Apodemus sylvaticus. Oikos 2010, 119, 1099–1104. [Google Scholar] [CrossRef] [Scilit]
- Kiffner, C.; Stanko, M.; Morand, S.; Khokhlova, I.S.; Shenbrot, G.I.; Laudisoit, A.; Leirs, H.; Hawlena, H.; Krasnov, B.R. Sex-biased parasitism is not universal: Evidence from rodent-flea associations from three biomes. Oecologia 2013, 173, 1009–1022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khokhlova, I.S.; Spinu, M.; Krasnov, B.R.; Degen, A.A. Immune response to fleas in a wild desert rodent: Effect of parasite species, parasite burden, sex of host and host parasitological experience. J. Exp. Biol. 2004, 207, 2725–2733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grzybek, M.; Bajer, A.; Behnke-Borowczyk, J.; Al-Sarraf, M.; Behnke, J.M. Female host sex-biased parasitism with the rodent stomach nematode Mastophorus muris in wild bank voles (Myodes z_oglareolus). Parasitol. Res. 2015, 114, 523–533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Råberg, L.; Sim, D.; Read, A.F. Disentangling genetic variation for resistance and tolerance to infectious diseases in animals. Science 2007, 318, 812–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Råberg, L.; Graham, A.L.; Read, A.F. Decomposing health: Tolerance and resistance to parasites in animals. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 37–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klein, S.L.; Flanagan, K.L. Sex differences in immune responses. Nat. Rev. Immunol. 2016, 16, 626–638. [Google Scholar] [CrossRef] [Scilit]
- Colautti, R.I.; Ricciardi, A.; Grigorovich, I.A.; MacIsaac, H.J. Is invasion success explained by the enemy release hypothesis? Ecol. Lett. 2004, 7, 721–733. [Google Scholar] [CrossRef] [Scilit]
- Keane, R.M.; Crawley, M.J. Exotic plant invasions and the enemy release hypothesis. Trends Ecol. Evol. 2002, 17, 164–170. [Google Scholar] [CrossRef] [Scilit]
- Heger, T.; Jeschke, J.M. Enemy release hypothesis. In Invasion Biology: Hypotheses and Evidence; CABI: Wallingford, UK, 2018; pp. 92–102. [Google Scholar]
- Prior, K.M.; Powell, T.H.Q.; Joseph, A.L.; Hellmann, J.J. Insights from community ecology into the role of enemy release in causing invasion success: The importance of native enemy effects. Biol. Invasions 2015, 17, 1283–1297. [Google Scholar] [CrossRef] [Scilit]
- Schultheis, E.H.; Berardi, A.E.; Lau, J.A. No release for the wicked: Enemy release is dynamic and not associated with invasiveness. Ecology 2015, 96, 2446–2457. [Google Scholar] [CrossRef] [Scilit]
- MacLeod, C.J.; Paterson, A.M.; Tompkins, D.M.; Duncan, R.P. Parasites lost-do invaders miss the boat or drown on arrival? Ecol. Lett. 2010, 13, 516–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryser-Degiorgis, M.P. Wildlife health investigations: Needs, challenges and recommendations. BMC Vet. Res. 2013, 9, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sikes, R.S.; Gannon, W.L. Guidelines of the American Society of Mammalogists for the Use of Wild Mammals in Research. Available online: https://www.mammalsociety.org/articles/guidelines-american-society-mammalogists-use-wild-mammals-research-0 (accessed on 23 January 2020).
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Targets | Targeted Gene | Name | Primers (5’-3’) and Probes (Used for qPCR Screening or Sequencing) | Annealing Temperature | Specificity | References |
|---|---|---|---|---|---|---|
| Piroplasmida | 5.8S | 5.8S-F5 5.8S-R 5.8S-S | AYYKTYAGCGRTGGATGTC TCGCAGRAGTCTKCAAGTC FAM-TTYGCTGCGTCCTTCATCGTTGT-MGB | 60 °C | Broad-range qPCR | [25] |
| 18S (969-bp) | piro18S-F1 piro18S-F4 piro18S-F3 piro18S-R3 | GCGAATGGCTCATTAIAACA CACATCTAAGGAAGGCAGCA GTAGGGTATTGGCCTACCG* AGGACTACGACGGTATCTGA* | 58 °C | Broad-range conventional PCR | [25] | |
| Anaplasma | 23S 23S (520-bp) | TtAna_F TtAna_R TtAna_P | TGACAGCGTACCTTTTGCAT GTAACAGGTTCGGTCCTCCA 6FAM-GGATTAGACCCGAAACCAAG | 55 °C | Broad-range qPCR | [26] |
| Ana23S-212F Ana23S-753R | ATAAGCTGCGGGGAATTGTC TGCAAAAGGTACGCTGTCAC | 58 °C | Broad-range conventional PCR | [26] | ||
| Borrelia | 23S | TTB23s FTTB23s RTTB23s P | CGATACCAGGGAAGTGAAC ACAACCCYMTAAATGCAACG 6FAM-TTTGATTTCTTTTCCTCAGGG-TAMRA | 60 °C | Broad-range qPCR | [27] |
| glpQ | Bcroci_glpQ_F Bcroci_glpQ_R Bcroci_glpQ_P | CCTTGGATACCCCAAATCATC GGCAATGCATCAATTCTAAAC 6FAM- ATGGACAAATGACAGGTCTTAC -MGB | 60 °C | Species-specific qPCR | [27] | |
| Fla (640-bp) | Fla120F Fla800R | TGATGATGCTGCTGGWATGG TTGGAAAGCACCIARATTTGC | 58 °C | Broad-range conventional PCR | This study | |
| Bartonella | ITS ITS (733-bp) | Barto_ITS3_F Barto_ITS3_R Barto_ITS3_P | GATGCCGGGGAAGGTTTTC GCCTGGGAGGACTTGAACCT 6FAM-GCGCGCGCTTGATAAGCGTG | 60 °C | Broad-range qPCR | [28] |
| Urbarto1 Urbarto2 | CTTCGTTTCTCTTTCTTCA CTTCTCTTCACAATTTCAAT | 50 °C | Broad-range conventional PCR | [29] | ||
| Streptobacillus monilliformis | gyrB | Smoni-gyrB-F Smoni-gyrB-R Smoni-gyrB-P | AGTTTAAAATTCCCTGAACCACAATT ACTTCCAAACACTCCTGAAACTATACTTG 6FAM-TCACAAACTAAGGCAAAACTTGGTTCATCTGAG | 60 °C | Species-specific qPCR | [30] |
| Occidentia | sca | OMscaA-F OMscaA-R OMscaA-P | AAGGCCAAAAGCATTAGCAA TTCATTTGTATGAATTCCTTGCAT TGAAGTTGAAGATGTCCCTAATAGT | 55 °C | Species-specific qPCR | This study |
| Coxiella Burnetii | IS1111A | CB_IS1111_0706F CB_IS1111_0706R CB_IS1111_0706P | CAAGAAACGTATCGCTGTGGC CACAGAGCCACCGTATGAATC 6FAM-CCGAGTTCGAAACAATGAGGGCTG | 60 °C | Species-specific qPCR | [28] |
| IS30A | CB_IS30A_3F CB_IS30A_3R CB_IS30A_3P | CGCTGACCTACAGAAATATGTCC GGGGTAAGTAAATAATACCTTCTGG 6FAM- CATGAAGCGATTTATCAATACGTGTATGC | 60 °C | Species-specific qPCR | [28] | |
| Rickettsia | gltA (CS) | RKND03_F RKND03_R RKND03 P | GTGAATGAAAGATTACACTATTTAT GTATCTTAGCAATCATTCTAATAGC 6FAM-CTATTATGCTTGCGGCTGTCGGTTC | 60 °C | Broad-range qPCR | [28] |
| Hepatozoon | 18S (620-bp) | H14Hepa18SFw H14Hepa18SRv | GAAATAACAATACAAGGCAGTTAAAATGCT GTGCTGAAGGAGTCGTTTATAAAGA | 58 °C | Broad-range conventional PCR | [31] |
| Mycoplasma | Mycop_ITS_F Mycop_ITS_R Mycop_ITS_P | GGGAGCTGGTAATACCCAAAGT CCATCCCCACGTTCTCGTAG 6FAM-GCCTAAGGTAGGACTGGTGACTGGGG | 60 °C | Broad-range qPCR | [32] | |
| Plasmodium | ssrRNA (231-bp) | rPLU1 rPLU2 rPLU3 rPLU4 | TCAAAGATTAAGCCATGCAAGTGA ATCTAAGAATTTCACCTCTGACATCTG TTTTTATAAGGATAACTACGGAAAAGCTGT TACCCGTCATAGCCA-TGTTAGGCCAATACC | 62 °C | Broad-range nested PCR | [33] |
| Pan-Filarioidea | 28S | qFil-28S-F qFil-28S-R qFil-28S-P | TTGTTTGAGATTGCAGCCCA GTTTCCATCTCAGCGGTTTC 6FAM-ACTTTCCCTCACGGTACTTG | 60 °C | Broad-range qPCR | Laidoudi et al., in press |
| Pan-Kinetoplastida | 28S LSU | P LSU 24a F LSU 24a R LSU 24a | 6FAM-TAGGAAGACCGATAGCGAACAAGTAG AGTATTGAGCCAAAGAAGG TTGTCACGACTTCAGGTTCTAT | 60 °C | Broad-range qPCR | [34] |
| F2 28S R1 28S | ACCAAGGAGTCAAACAGACG GACGCCACATATCCCTAAG | 53 °C | Broad-range conventional PCR |
| Native | Invasive | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pathogen | qPCR Positive Samples | Amplified Genotypes | About the Amplified Genotypes | Total | Arvicanthis niloticus | Mastomys erythroleucus | Taterillus sp. | Mus musculus | Gerbillus nigeriae | |||||
| Indoor (N = 26) | Outdoor (N = 15) | Indoor (N = 44) | Outdoor (N = 0) | Indoor (N = 0) | Outdoor (N = 15) | Indoor (N = 51) | Outdoor (N = 0) | Indoor (N = 0) | Outdoor (N = 20) | |||||
| Piroplasma | 4/171 (2.3%) | Piroplasmida sp. "Arvicantis CB4309" | Potential new species | 1 | 1/26 (3.8%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Bartonella | 16/171 (9.35%) | Genotype 1 | Potential new genotype: 92% of homology with B. pachyuromydis AB602561 | 4 | 0 | 0 | 1 (2.3%) | 0 | 0 | 3/15 (20%) | 0 | 0 | 0 | 0 |
| Genotype 2 | Potential new genotype: 97% of homology with B. mastomydis KY555067 | 1 | 0 | 0 | 0 | 0 | 0 | 1/15 (6.7%) | 0 | 0 | 0 | 0 | ||
| Genotype 3 | Potential new genotype: 85% of homology with B. tribocorum (JF766268) | 5 | 1/26 (3.8%) | 1/15 (6.7%) | 0 | 0 | 0 | 3/15 (20%) | 0 | 0 | 0 | 0 | ||
| Borrelia | 26/171 (15.2%) | Borrelia crocidurae | Identical to B. crocidurae JX292914 | 8 | 3/26 (11.5%) | 1/15 (6.7%) | 2 (4.5%) | 0 | 0 | 1/15 (6.7%) | 0 | 0 | 0 | 1/20 (5%) |
| Anaplasma | 31 (18.12%) | Candidatus “Ehrlichia senegalensis” | Potential new species | 5 | 1/26 (3.8%) | 3/15 (20%) | 1 (2.3%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hepatozoon | 4/171 (2.33%) by conventional PCR tool | Hepatozoon sp. | Closely related to Hepatozoon sp. KC696569 | 1 | 0 | 0 | 1 (2.3%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| Hepatozoon sp. | Closely related to Hepatozoon sp. KC696565 | 1 | 0 | 1/15 (6.7%) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | ||
| Hepatozoon canis | Closely related to H. canis | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 2/51 (3.9%) | 0 | 0 | 0 | ||
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dahmana, H.; Granjon, L.; Diagne, C.; Davoust, B.; Fenollar, F.; Mediannikov, O. Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk. Pathogens 2020, 9, 202. https://doi.org/10.3390/pathogens9030202
Dahmana H, Granjon L, Diagne C, Davoust B, Fenollar F, Mediannikov O. Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk. Pathogens. 2020; 9(3):202. https://doi.org/10.3390/pathogens9030202
Chicago/Turabian StyleDahmana, Handi, Laurent Granjon, Christophe Diagne, Bernard Davoust, Florence Fenollar, and Oleg Mediannikov. 2020. "Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk" Pathogens 9, no. 3: 202. https://doi.org/10.3390/pathogens9030202
APA StyleDahmana, H., Granjon, L., Diagne, C., Davoust, B., Fenollar, F., & Mediannikov, O. (2020). Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk. Pathogens, 9(3), 202. https://doi.org/10.3390/pathogens9030202

