Next Article in Journal
Dynamics and Sensitivity of the Lifecycle of Hepatitis B Virus
Next Article in Special Issue
Paramyxoviruses in Bats in Poland—The First Detection
Previous Article in Journal
Rifaximin Protects Against Inflammation and Fibrosis in MASH: Any Role for Ethanol-Producing Bacteria?
Previous Article in Special Issue
Is African Swine Fever Driven by Flying Hematophagous Insects?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 15
Issue 2
10.3390/pathogens15020171
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of the Application of PCR and MALDI-TOF MS Methods for the Identification of Pasteurella multocida Strains Isolated from Rabbits in Poland

by
Sylwia Budniak
,
Agnieszka Kędrak-Jabłońska
* and
Krzysztof Szulowski
*
Department of Bacteriology and Bacterial Animal Diseases, National Veterinary Research Institute, 24-100 Pulawy, Poland
*
Authors to whom correspondence should be addressed.
Pathogens 2026, 15(2), 171; https://doi.org/10.3390/pathogens15020171
Submission received: 8 January 2026 / Revised: 30 January 2026 / Accepted: 3 February 2026 / Published: 5 February 2026
(This article belongs to the Special Issue Laboratory Diagnostics in Epidemiological Diseases Caused by Animal Pathogens)
Browse Figures
Versions Notes

Abstract

Pasteurella multocida is a pathogen of numerous mammal and bird species. Based on capsular antigens, five capsular types of P. multocida (A, B, D, E, and F) are distinguished. The aim of this study was to evaluate the usefulness of multiplex PCR and MALDI-TOF MS for the identification and capsular typing of P. multocida strains isolated from rabbits. A total of 115 field strains previously classified as P. multocida, isolated in Poland between 1999 and 2020, were analysed. Multiplex PCR was applied for simultaneous species identification and determination of capsular types. Most strains belonged to capsular type A (87.8%), while capsular types D (8.7%) and F (3.5%) were detected less frequently. The examined strains were subsequently identified by MALDI-TOF MS, which correctly assigned all strains to the species P. multocida. The results demonstrate that multiplex PCR is a rapid and reliable alternative to conventional species identification and serological capsular typing of P. multocida. In addition, MALDI-TOF MS proved to be a valuable tool for accurate species-level identification. The application of these methods in routine clinical microbiology laboratories may significantly improve the speed and reliability of P. multocida identification.

1. Introduction

Pasteurella multocida is a Gram-negative, non-motile, non-spore-forming, facultatively anaerobic coccobacillus that infects a wide range of mammal and bird species. The species exhibits substantial variability in antigenic structure, host specificity, and pathogenic potential. The most widely used classification system for P. multocida is based on capsular antigens, distinguishing five capsular types (A, B, D, E, and F) according to Carter’s scheme [1], together with 16 somatic serotypes defined by the Heddleston system [2]. The combination of capsular and somatic antigens determines the serotype and is associated with host range and disease manifestation.
Numerous studies have demonstrated that P. multocida strains possessing somatic antigens 3 and 12 are particularly pathogenic for rabbits [3,4,5,6]. Pasteurellosis in rabbits is most frequently associated with strains belonging to capsular types A and D, and less commonly type F [6,7,8]. Among these, capsular type A is the most prevalent and has been isolated from cattle, poultry, pigs, and rabbits [9,10,11]. The capsule of P. multocida is composed of carbohydrate polymers [12,13]; in capsular type A strains, it consists of hyaluronic acid. This component contributes to bacterial adhesion [14] and may inhibit antibody production [1,15], thereby facilitating immune evasion. Hyaluronic acid is also thought to interfere with opsonisation and phagocytosis, enhancing bacterial survival within the host. The importance of the capsule in resistance to phagocytosis has been experimentally demonstrated by Harmon et al. [16].
Capsular type D is composed of polymers structurally related to hyaluronic acid and is susceptible to degradation by enzymes such as hyaluronidase, heparinase, and chondroitinase [17,18]. The genes responsible for capsule synthesis and transport are located within a single genomic region, as described by Townsend et al. [19]. P. multocida strains of capsular type F were first isolated in 1987 from turkeys in the United States [20] and have since been mainly associated with infections in birds [21]. However, its pathogenicity for rabbits was first documented in 2008, and strains belonging to this capsular type have subsequently been detected in rabbit farms worldwide [9]. Experimental infections with type F strains have demonstrated severe pathological changes, including fibrinopurulent or haemorrhagic pneumonia, often accompanied by high mortality rates. Several authors have suggested that capsular type F strains may be transmitted to rabbits from birds or pigs, leading to significant economic losses in rabbit breeding [9,10,22].
The virulence of P. multocida is influenced by multiple factors, among which the presence of a capsule is considered important [23,24]. Capsulated strains have generally been shown to be more virulent than their non-capsulated counterparts [2,25,26]. Nevertheless, some studies have reported that capsulated strains may exhibit low virulence, while non-capsulated forms can remain pathogenic [27,28]. This indicates that capsule expression alone is not sufficient to determine virulence. Other factors, including outer membrane proteins, lipopolysaccharides, sialidases, hyaluronidase, fimbriae, adhesins, and iron acquisition systems, also play key roles in the pathogenesis of P. multocida infections [29,30,31,32].
Poland is among the leading producers of rabbit meat in Europe, and increasing export opportunities within the European Union have driven the expansion of intensive commercial rabbit farming [33,34]. However, production intensification is associated with an increased risk of infectious diseases, leading to significant economic losses. In rabbits, infections caused by P. multocida remain particularly problematic due to high morbidity, mortality, and the difficulty of effective control. Early and accurate diagnosis of rabbit pasteurellosis is therefore essential to enable timely treatment and to minimise infection-related losses [35].
Traditional serological methods used for the capsular typing of P. multocida, such as the indirect haemagglutination test, have been widely applied for decades; however, they are associated with several limitations. These include limited availability of reference antisera, inter-laboratory variability, and technical difficulties in the analysis of mucoid strains, which may lead to ambiguous or inconsistent results. Molecular approaches based on PCR overcome many of these limitations by enabling rapid, sensitive, and highly specific identification of P. multocida and its capsular types through the detection of conserved genetic determinants involved in capsule biosynthesis and species-specific markers [19,36,37,38]. As a result, PCR-based methods offer improved reproducibility and objectivity and are increasingly used in routine diagnostics and epidemiological studies.
In parallel, proteomic identification using MALDI-TOF MS has emerged as a rapid and cost-effective tool for species-level identification of bacterial pathogens compared with conventional biochemical methods [39,40]. While MALDI-TOF MS does not provide information on capsular type, it allows reliable and fast confirmation of P. multocida at the species level. Consequently, the application of molecular and proteomic methods represents a complementary diagnostic strategy that addresses the limitations of classical serotyping and improves the overall accuracy and efficiency of P. multocida identification.
Data on the distribution of P. multocida capsular types in rabbit populations in Poland remain limited. To date, no comprehensive studies have described the occurrence of capsular types among rabbit-derived P. multocida strains collected over extended time periods at the national level. Therefore, characterising field strains isolated from rabbits in Poland using molecular and proteomic identification approaches represents an important step toward improving epidemiological knowledge of this pathogen in the national context.
The aim of the present study was to evaluate the usefulness of multiplex PCR for the simultaneous species identification and capsular typing of P. multocida strains isolated from rabbits, and to assess the performance of MALDI-TOF MS for reliable species-level identification.

2. Materials and Methods

2.1. Bacterial Strains

A total of 115 field strains previously classified as P. multocida, isolated in Poland between 1999 and 2020, were included in the study. Eighty-seven strains were obtained from nasal swabs collected from rabbits, including 73 animals showing clinical signs of respiratory disease and 14 asymptomatic carriers. An additional 28 strains were isolated from dead rabbits. Reference strains of P. multocida representing different capsular types were used as controls: capsular type A (P8, P1059; Dr. Namioka, National Institute of Animal Health, Tokyo, Japan), capsular type D (Kobe 6, P27; Dr. Namioka, National Institute of Animal Health, Tokyo, Japan), and capsular type F (P4218, P3695; Dr. Rimler, National Animal Disease Center, Ames, IA, USA). To assess assay specificity, strains of other bacterial species were included: Staphylococcus aureus ATCC 6538, Listeria monocytogenes ATCC 7644, Escherichia coli ATCC 25922, Salmonella Typhimurium ATCC 14028, and Klebsiella pneumoniae ATCC 13883.

2.2. Identification of Species and Determination of Capsular Antigens of P. multocida Strains Using PCR

2.2.1. Isolation of DNA

Each strain was cultured on 5% horse blood agar and incubated at 37 °C for 24 h. A bacterial suspension corresponding to a 1.0 McFarland standard was prepared in sterile saline. Aliquots of 1 mL were heated at 100 °C for 15 min and centrifuged at 13,000× g for 10 min. The supernatant was discarded, and the pellet was used directly for molecular analyses or stored at −20 °C until further examination.

2.2.2. Multiplex PCR

Primer sequences used for species identification and capsular typing were selected based on published data [19] and synthesised by Genomed (Poland). Primer characteristics are presented in Table 1.
PCR conditions were optimised using DNA extracted from the reference strain P. multocida P1059. Different primer concentrations of 0.1 µM, 0.15 µM, 0.2 µM, 0.3 µM, 0.4 µM, 0.5 µM, and 1.0 µM and MgCl2 concentrations of 1.5 µM, 2.0 µM, 2.5 µM, and 3.0 µM were evaluated to determine optimal reaction parameters.
Multiplex PCR was performed in a total reaction volume of 25 µL containing 5 µL of DNA template, 200 µM of each dNTP (Thermo Scientific, Carlsbad, CA, USA), 1 × PCR buffer, and 1 U of DNA polymerase (Biotools, Madrid, Spain). Amplification was carried out in a 3Thermoblock thermocycler (Biometra, Jena, Germany) using the following cycling conditions: initial denaturation at 95 °C for 5 min; 30 cycles of denaturation at 95 °C for 60 s, annealing at 55 °C for 60 s, and extension at 72 °C for 60 s; followed by a final extension step at 72 °C for 7 min. All tests were performed in replicates to ensure reproducibility of amplification results.
PCR products were separated by electrophoresis on a 2% agarose gel in TBE buffer at a constant voltage of 95 V using a Wide Mini-GT Sub® Cell system (Bio-Rad, Hercules, CA, USA). A 100 bp DNA Ladder Plus (Thermo Scientific, USA) was used as the molecular size marker. Gels were stained with ethidium bromide and visualised using a Vilber Lourmat imaging system version 11.9 (Eberhardzell, Germany).
DNA concentrations were measured spectrophotometrically using a DS-11 spectrophotometer (DeNovix, Wilmington, DE, USA). PCR sensitivity was assessed using 10-fold serial dilutions of DNA extracted from reference strains representing capsular types A (P1059), D (P27), and F (P4218), with an initial concentration of approximately 10 ng/µL.

2.3. Identification of P. multocida Strains by Mass Spectrometry-MALDI-TOF MS (Matrix-Assisted Laser Desorption/Ionisation-Time-of-Flight)

Species identification by MALDI-TOF MS was performed using a Bruker platform software 3.0 (Bruker Daltomics GmbH, Bremen, Germany). Bacterial strains were cultured on tryptic soy agar (TSA) and incubated at 37 °C for 24 h. Two sample preparation protocols were applied: a direct transfer method and a formic acid-assisted extraction method using 70% formic acid. Each strain was analysed in triplicate. Protein spectra were acquired and analysed using the MBT Compass software 4.1.70 (Bruker Daltomics GmbH, Bremen, IN, USA). Spectra were automatically compared with reference spectra stored in the database, and a logarithmic score value ranging from 0.0 to 3.0 was assigned to each identification. A score ≥ 1.8 was considered indicative of reliable species-level identification.

2.4. Statistical Analysis [41]

The independence of the results obtained for the analysed strains according to capsular type and source of isolation was assessed using the χ2 test. Statistical analyses were performed at a significance level of α = 0.05 using Microsoft Excel® (Microsoft, Redmond, WA, USA).

3. Results

3.1. Identification of Species and Determination of Capsular Antigens of P. multocida Strains Using PCR

In the initial stage of the study, the multiplex PCR conditions were optimised. The selected concentration of primer (0.15 μM) and MgCl2 (2.0 µM) provided the best balance between amplification efficiency, specificity, and band clarity, while minimising nonspecific products. Both lower and higher concentrations of primers and MgCl2 resulted in a decrease in PCR efficiency.
The sensitivity of the assay was evaluated using 10-fold serial dilutions of DNA extracted from reference strains representing capsular types A (P1059), D (P27), and F (P4218), with an initial concentration of 10 ng/µL. The detection limit for strains belonging to capsular types A and F was estimated at 1 pg/µL, while for the capsular type D strain, the sensitivity was 10 pg/µL.
PCR specificity was assessed using DNA from six reference strains of P. multocida representing capsular types A, D, and F, as well as DNA from other bacterial species. The primer sets demonstrated high specificity, yielding amplification products characteristic of P. multocida species identification and capsular typing exclusively in P. multocida strains. No amplification products were observed for the non-P. multocida species included in the analysis (Table 2).
Multiplex PCR was subsequently applied to DNA obtained from 115 field strains of P. multocida isolated from rabbits. In all analysed strains, a 460 bp fragment specific for P. multocida species identification was detected. Capsular typing revealed that 101 strains (87.8%) produced a 1044 bp amplicon corresponding to capsular type A. A 657 bp fragment indicative of capsular type D was detected in 10 strains (8.7%), while an 851 bp fragment characteristic of capsular type F was observed in 4 strains (3.5%). Representative electrophoretic profiles of multiplex PCR products are shown in Figure 1 and Figure 2. Consistent amplification patterns were obtained across repeated reactions.

3.2. Identification of P. multocida Strains Using MALDI-TOF MS (Matrix-Assisted Laser Desorption/Ionisation-Time-of-Flight)

All 115 field strains of P. multocida were analysed using MALDI-TOF MS with both the direct transfer and formic acid-assisted extraction methods. Using the MBT Compass system, all isolates were correctly identified as P. multocida at the species level.
Logarithmic score values for the direct transfer method ranged from 1.89 to 2.36, and for the formic acid-assisted extraction method using 70% formic acid, from 1.80 to 2.60, depending on the strain. Thus, no marked differences were observed in species-level identification or in the reliability of the results, which supports the use of both methods in routine diagnostics.
No systematic differences in MALDI-TOF MS score values were also observed between strains representing different capsular types using the direct and formic acid-assisted sample preparation methods. In all cases, score values exceeded the threshold for reliable species-level identification.

3.3. Statistical Analysis

The χ2 test revealed a statistically significant association between capsular type and the source of isolation, nasal swabs from rabbits with rhinitis, clinically healthy carriers, and post-mortem samples (χ2 = 27.09, df = 4, p = 1.9 × 10−5; α = 0.05).

4. Discussion

P. multocida is an important pathogen affecting numerous mammal and bird species, and its pathogenic potential is closely associated with capsular type and other virulence determinants. Capsular antigens are key factors in host specificity and disease manifestation, and several capsular types are linked to economically significant diseases, including pasteurellosis in rabbits. The capsule, together with additional virulence factors, plays a crucial role in the pathogenesis of P. multocida infections [42].
Molecular methods have increasingly replaced conventional phenotypic techniques for bacterial identification, as they overcome many limitations related to variability, subjectivity, and time consumption. Nucleic acid-based assays enable rapid and sensitive detection of pathogens directly from clinical material or from minimal bacterial cultures, making them particularly suitable for routine diagnostics. In this study, multiplex PCR proved to be a rapid, sensitive, and specific method for the identification and capsular typing of P. multocida strains isolated from rabbits [43].
The PCR assay used in the present work was based on primers described by Townsend et al. [19], targeting the KMT1 gene for species identification and capsule biosynthesis genes for capsular typing. This approach enables the detection of all recognised subspecies of P. multocida by amplification of a 460 bp fragment. A simple boiling method for DNA extraction was chosen for its simplicity, cost-effectiveness, and suitability for routine diagnostic laboratories, where rapid processing of large numbers of samples is often required, while avoiding the additional cost and processing time associated with commercial DNA extraction kits. Reproducibility was assessed qualitatively through consistent results obtained across repeated multiplex PCR. No discrepancies in species identification or capsular assignment were observed between independent runs.
The sensitivity of the multiplex PCR observed in this study was high. A lower analytical sensitivity was observed for capsular type D (10 pg/µL) compared with capsular types A and F (1 pg/µL). The lower analytical sensitivity observed for capsular type D may be attributed to differences in primer–template interactions, sequence variability within the capsular biosynthesis locus, or reduced amplification efficiency compared with capsular types A and F [19]. Importantly, the observed difference in sensitivity did not affect the correct capsular assignment of the analysed field isolates and remains sufficient for routine diagnostic applications.
Capsular typing by PCR provides a reliable alternative to traditional serological methods, which are limited by the availability of reference antisera, technical complexity, and difficulties associated with mucoid strains. In the present study, the majority of rabbit-derived P. multocida strains belonged to capsular type A, whereas capsular types D and F were detected less frequently. This distribution is consistent with previous reports indicating that capsular type A predominates among P. multocida isolates from rabbits, cattle, poultry, and pigs. The relatively low prevalence of capsular type F observed in this study contrasts with some earlier reports but may reflect geographical differences, temporal variation, or differences in animal management practices [44,45].
The predominance of capsular type A among rabbit-derived P. multocida strains observed in this study is consistent with reports from other European countries and Asia, where this capsular type has been identified as the most frequent in rabbit pasteurellosis. In contrast, capsular types D and F are reported less frequently, although their prevalence appears to vary between regions. Such differences may reflect geographic factors, production systems, herd management practices, and potential interspecies transmission from other livestock species [46,47]. Capsular type A was predominantly associated with nasal isolates from rabbits with clinical signs of rhinitis, whereas capsular types D and F were more frequently recovered from post-mortem samples, suggesting that capsular type may be linked to the clinical presentation.
From a practical perspective, knowledge of capsular type distribution among P. multocida strains is relevant for rabbit health management, as different capsular types have been associated with variation in pathogenic potential. Awareness of the dominant capsular types circulating in rabbit populations may support more informed diagnostic strategies, facilitate outbreak investigations, and contribute to improved disease control measures at the farm level. In this context, the combined use of rapid species identification and capsular typing represents a useful approach for veterinary diagnostic laboratories [8,36].
By providing data on the capsular type distribution of P. multocida strains from rabbits collected over more than two decades, this study contributes to improving the epidemiological understanding of rabbit pasteurellosis in Poland, where such information has previously been limited.
Previous studies have highlighted potential discrepancies between serological and molecular capsular typing for capsular types A and F. These groups produce structurally similar polysaccharide capsules composed of non-immunogenic polymers, which may lead to misclassification when serological methods are applied [31,47]. Multiplex PCR allows for more accurate discrimination between these closely related capsular types by targeting specific genetic determinants involved in capsule biosynthesis. Consequently, molecular capsular typing may improve the reliability of epidemiological investigations and surveillance of P. multocida infections.
In addition to PCR-based identification, MALDI-TOF MS was evaluated as an alternative method for species-level identification of P. multocida. This technique has gained widespread acceptance in diagnostic microbiology due to its speed, accuracy, and cost-effectiveness. In the present study, MALDI-TOF MS correctly identified all examined P. multocida strains, regardless of the sample preparation protocol used. Both the direct transfer method and the formic acid-assisted extraction yielded reliable identification scores, confirming the robustness of this approach for routine diagnostics [48,49].
The effectiveness of MALDI-TOF MS observed in this study is consistent with previous reports demonstrating its high discriminatory power for members of the family Pasteurellaceae [50]. Although factors such as culture conditions, incubation time, and available database may influence identification accuracy, the method remains highly reliable for species-level identification of P. multocida. Importantly, MALDI-TOF MS does not provide information on capsular type; therefore, its use in combination with molecular methods offers a more comprehensive diagnostic strategy [50].
The MALDI-TOF MS analysis performed in this study demonstrated high reproducibility of species-level identification, as consistent results were obtained across repeated measurements and using both direct and formic acid-assisted sample preparation methods. No misidentifications or borderline score values were observed among the analysed isolates, and all spectra yielded scores exceeding the threshold for reliable identification. These findings support the robustness of MALDI-TOF MS for routine identification of P. multocida derived from rabbits.
Nevertheless, certain limitations of the MALDI-TOF MS approach should be acknowledged. The accuracy of identification depends on the quality and completeness of the reference database, and closely related species may be difficult to differentiate if reference spectra are limited. Moreover, MALDI-TOF MS does not provide information on capsular type and therefore cannot replace molecular methods for capsular typing. Consequently, MALDI-TOF MS should be regarded as a complementary tool for rapid species confirmation, rather than a standalone method for comprehensive characterisation of P. multocida strains [51].
Whole-genome sequencing (WGS) is increasingly used for bacterial identification and offers higher resolution than MALDI-TOF MS, while also enabling prediction of capsular type and other relevant genetic traits. However, WGS is not yet routinely available in many veterinary diagnostic laboratories due to cost, infrastructure, and turnaround-time constraints, whereas MALDI-TOF MS and PCR remain widely accessible and fast for day-to-day diagnostics. Thus, the workflow presented here is intended as a pragmatic approach for routine laboratories, while WGS represents an optimal option for detailed outbreak investigations and advanced epidemiological studies [52].
From a clinical and practical diagnostic perspective, turnaround time and cost-effectiveness are critical factors in the selection of diagnostic methods. MALDI-TOF MS enables species-level identification of P. multocida within minutes once a pure culture is obtained, offering a substantial reduction in time compared with conventional biochemical testing. In contrast, multiplex PCR requires a longer processing time but provides additional epidemiologically relevant information through capsular typing. Both methods are relatively cost-effective once implemented and can be readily integrated into routine diagnostic workflows. Importantly, the use of simple DNA extraction procedures and standard laboratory equipment makes PCR-based capsular typing feasible even in laboratories with limited resources, supporting its applicability in a wide range of diagnostic settings [50,53].
Thus, multiplex PCR and MALDI-TOF MS should be regarded as complementary approaches. MALDI-TOF MS enables rapid and cost-effective species-level identification of P. multocida, making it well-suited as a first-line screening tool in routine diagnostics. In contrast, multiplex PCR provides additional discriminatory power by enabling capsular typing, which is essential for epidemiological investigations and disease monitoring [54].
Although MALDI-TOF MS proved to be a reliable and rapid tool for species-level identification of P. multocida, it does not allow discrimination between capsular types and therefore cannot replace molecular methods for capsular typing. In addition, PCR-based capsular typing may be affected by primer–template mismatches or genetic similarity among closely related capsular types, which may influence analytical sensitivity.
A stepwise diagnostic workflow combining initial MALDI-TOF MS identification with subsequent PCR-based capsular typing, therefore, offers an efficient and reliable strategy for the laboratory diagnosis of rabbit pasteurellosis.

5. Conclusions

Overall, the results of this study confirm that multiplex PCR is a robust and efficient tool for simultaneous species identification and capsular typing of P. multocida strains isolated from rabbits. MALDI-TOF MS proved to be a valuable tool for accurate species-level identification of P. multocida, providing rapid and reproducible results regardless of the sample preparation protocol applied. Although MALDI-TOF MS does not allow capsular typing, its high accuracy and short turnaround time make it well-suited for routine diagnostic use.
Future research should focus on the application of whole-genome sequencing to resolve ambiguities in capsular typing and to provide deeper insight into the genetic diversity and virulence potential of P. multocida strains isolated from rabbits. Such approaches could support the refinement of molecular diagnostic tools and contribute to improved epidemiological surveillance and disease control strategies.

Author Contributions

Conceptualisation, S.B. and A.K.-J.; Investigation, S.B. and A.K.-J.; Methodology, S.B. and A.K.-J.; Supervision, K.S.; Visualisation, S.B. and A.K.-J.; Writing—original draft, S.B.; Writing—review & editing, A.K.-J. and K.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Carter, G.R. Studies on Pasteurella multocida. I. A hemagglutination test for the identification of serological types. Am. J. Vet. Res. 1955, 16, 481–484. [Google Scholar] [PubMed]
  2. Heddleston, K.L.; Rebers, P.A. Fowl cholera: Cross-immunity induced in turkeys with formalin-killed in vivo propagated Pasteurella multocida. Avian Dis. 1972, 16, 578–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Chengappa, M.M.; Myers, R.C.; Carter, G.R. Capsular and somatic types of Pasteurella multocida from rabbits. Can. J. Comp. Med. 1982, 46, 437–439. [Google Scholar] [PubMed]
  4. Lu, Y.S.; Pakes, S.P.; Stefanu, C. Capsular and somatic serotypes of Pasteurella multocida isolates recovered from healthy and diseased rabbits in Texas. J. Clin. Microbiol. 1983, 18, 292–295. [Google Scholar] [CrossRef] [Scilit]
  5. DiGiacomo, R.F.; Allen, V.; Hinton, M.H. Naturally acquired Pasteurella multocida subsp. P. multocida infection in a closed colony of rabbits: Characteristics of isolates. Lab. Anim. 1991, 25, 236–241. [Google Scholar] [CrossRef] [Scilit]
  6. Dabo, S.M.; Confer, A.W.; Montelongo, M.; Lu, Y.S. Characterization of rabbit Pasteurella multocida isolates by whole-cell, outer-membrane, and PCR typing. Lab. Anim. Sci. 1999, 49, 551–559. [Google Scholar]
  7. DiGiacomo, R.F.; Xu, Y.M.; Allen, V.; Hinton, M.H.; Pearson, G.R. Naturally acquired Pasteurella multocida infection in rabbits: Clinicopathological aspects. Can. J. Vet. Res. 1991, 55, 234–238. [Google Scholar]
  8. Rideaud, P.; Coudert, P.; Mercier, P.; Herrouet, P. Comparative study of the virulence of Pasteurella multocida from rabbits (Oryctolagus cuniculus). In Proceedings of the 5th World Rabbit Congress, Corvallis, OR, USA, 25–30 July 1992; pp. 1389–1400. [Google Scholar]
  9. Jaglic, Z.; Jeklova, E.; Leva, L.; Kummer, V.; Kucerova, Z.; Faldyna, M.; Maskova, J.; Nedbalcova, K.; Alexa, P. Experimental study of pathogenicity of Pasteurella multocida serogroup F in rabbits. Vet. Microbiol. 2008, 126, 168–177. [Google Scholar] [CrossRef] [Scilit]
  10. Massacci, F.R.; Magistrali, C.F.; Cucco, L.; Curcio, L.; Bano, L.; Mangili, P.M. Characterization of Pasteurella multocida involved in rabbit infections. Vet. Microbiol. 2018, 213, 66–72. [Google Scholar] [CrossRef] [Scilit]
  11. Boyce, J.D.; Wilkie, I.; Harper, M.; Paustian, M.L.; Kapur, V.; Adler, B. Genomic-scale analysis of Pasteurella multocida gene expression during growth within liver tissue of chickens with fowl cholera. Microbes Infect. 2004, 6, 290–298. [Google Scholar] [CrossRef] [Scilit]
  12. Carter, G.R. Some characteristics of type A strains of Pasteurella multocida. Br. Vet. J. 1958, 114, 356–357. [Google Scholar] [CrossRef] [Scilit]
  13. Siddique, W.; Mahboob, S.; Rauf, W.; Jabeen, S.; Naseem, Z.; Shafaqat, F. Pasteurella multocida: Composition, genetics and biosynthesis of capsular polysaccharides (CPS) of serotypes A, B, D, E and F. Res. J. Vet. Pract. 2025, 13, 26–38. [Google Scholar] [CrossRef] [Scilit]
  14. Glorioso, J.C.; Jones, G.W.; Rush, H.G.; Pentler, L.J.; Darif, C.A.; Coward, J.E. Adhesion of type A Pasteurella multocida to rabbit pharyngeal cells and its possible role in rabbit respiratory tract infections. Infect. Immun. 1982, 38, 1103–1109. [Google Scholar] [CrossRef] [Scilit]
  15. Namioka, S.; Murata, M. Serological studies on Pasteurella multocida. III. O antigenic analysis of cultures isolated from various animals. Cornell Vet. 1961, 51, 522–528. [Google Scholar] [PubMed]
  16. Harmon, B.; Glisson, J.; Latimer, K.; Steffens, W.L.; Nunnally, J.C. Resistance of Pasteurella multocida A:3,4 to phagocytosis by turkey macrophages and heterophils. Am. J. Vet. Res. 1991, 52, 1507–1517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Rimler, R.B. Presumptive identification of Pasteurella multocida serogroups A, D and F by capsular depolymerisation with mucopolysaccharidases. Vet. Rec. 1994, 134, 191–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Smith, D.G. Adherence and pathogenesis of Pasteurella multocida—A sticky problem. Vet. J. 2000, 159, 215–216. [Google Scholar] [CrossRef] [Scilit]
  19. Townsend, K.M.; Boyce, J.D.; Chung, J.Y.; Frost, A.J.; Adler, B. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. J. Clin. Microbiol. 2001, 39, 924–929. [Google Scholar] [CrossRef] [Scilit]
  20. Wang, J.; Sun, S.; Chen, Y.; Chen, D.; Sang, L.; Xie, X. Pathogenic and genomic characterisation of a rabbit-sourced Pasteurella multocida serogroup F isolate S4. BMC Vet. Res. 2022, 18, 288. [Google Scholar] [CrossRef] [Scilit]
  21. Jonas, M.; Morishita, T.Y.; Angrick, E.J.; Jahja, J. Characterization of nine Pasteurella multocida isolates from avian cholera outbreaks in Indonesia. Avian Dis. 2001, 45, 34–42. [Google Scholar] [CrossRef] [Scilit]
  22. Cheng, Y.; Wang, K.; Lin, L.; Zhao, X.; Pan, Z.; Zhou, Z. Differences in pathogenicity and virulence-associated gene expression among Pasteurella multocida strains with high and low virulence in a lung tissue model. Microb. Pathog. 2020, 140, 103911. [Google Scholar] [CrossRef] [Scilit]
  23. Manning, P.J. Naturally occurring pasteurellosis in laboratory rabbits: Chemical and serological studies of whole cells and lipopolysaccharides of Pasteurella multocida. Infect. Immun. 1984, 44, 502–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Stahel, A.B.J.; Hoop, R.K.; Kuhnert, P.; Korczak, B.M. Phenotypic and genetic characterization of Pasteurella multocida and related isolates from rabbits in Switzerland. J. Vet. Diagn. Investig. 2009, 21, 793–802. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Snipes, K.P.; Hirsh, D.C. Association of complement sensitivity with virulence of Pasteurella multocida isolated from turkeys. Avian Dis. 1986, 30, 500–504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Tsuji, M.; Matsumoto, M. Pathogenesis of fowl cholera: Influence of encapsulation on the fate of Pasteurella multocida after intravenous inoculation into turkeys. Avian Dis. 1989, 33, 238–247. [Google Scholar] [CrossRef] [Scilit]
  27. Brogden, K.A.; Rhoades, K.R.; Heddleston, K.L. A new serotype of Pasteurella multocida associated with fowl cholera. Avian Dis. 1978, 22, 185–190. [Google Scholar] [CrossRef] [Scilit]
  28. Matsumoto, M.; Strain, J.G. Pathogenicity of Pasteurella multocida: Its variable nature demonstrated by in vivo passages. Avian Dis. 1993, 37, 781–785. [Google Scholar] [CrossRef] [Scilit]
  29. Lee, M.D.; Brown, J.; Wooley, R.E.; Glisson, J.R. Relationship of pathogenicity to the growth of Pasteurella multocida serotype 3,4 isolates in normal turkey plasma. Avian Dis. 1988, 32, 509–512. [Google Scholar] [CrossRef] [Scilit]
  30. Zhao, G.; Pijoan, C.; Choi, K.; Maheswaran, S.K.; Trigo, E. Expression of iron-regulated outer membrane proteins by porcine strains of Pasteurella multocida. Can. J. Vet. Res. 1995, 59, 46–50. [Google Scholar]
  31. Cao, X.; Gu, L.; Gao, Z.; Fan, W.; Zhang, Q.; Sheng, J.; Zhang, Y.; Sun, Y. Pathogenicity and genomic characteristics of Pasteurella multocida serotype A isolated from Argali hybrid sheep. Microorganisms 2024, 12, 1072. [Google Scholar] [CrossRef] [Scilit]
  32. Tesfaye, A.B.; Werid, G.M.; Tao, Z.; You, L.; Han, R.; Zhu, J.; Fu, L.; Chu, Y. Advances in Pasteurella multocida vaccine development: From conventional to next-generation strategies. Vaccines 2025, 13, 1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Składanowska-Baryza, J. Rabbit farming—Economic importance and selection of breeds and lines for meat production. Wiad. Zootech. 2017, 55, 13–23. [Google Scholar]
  34. Statistics Poland (GUS). Livestock in Poland in 2024; Department of Agriculture and Food Economy, Statistics Poland: Warsaw, Poland, 2025. [Google Scholar]
  35. D’Amico, F.; Messina, D.; Casalino, G.; Schiavitto, M.; Bove, A.; Romito, D.; D’Onghia, F.P.; Camarda, A.; Circella, E. Characterisation of Pasteurella multocida strains from different lesions in rabbits. Animals 2024, 14, 1569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Harper, M.; John, M.; Edmunds, M.; Wright, A.; Ford, M.; Turni, C. Protective efficacy afforded by live Pasteurella multocida vaccines in chickens is independent of lipopolysaccharide outer core structure. Vaccine 2016, 34, 1696–1703. [Google Scholar] [CrossRef] [Scilit]
  37. Al-Haddawi, M.H.; Jasni, S.; Son, R.; Mutalib, A.R.; Bahaman, A.R.; Zamri-Saad, M.; Sheikh-Omar, A.R. Molecular characterization of Pasteurella multocida isolates from rabbits. J. Gen. Appl. Microbiol. 1999, 45, 269–275. [Google Scholar] [CrossRef] [Scilit]
  38. Atashpaz, S.; Shayegh, J.; Hejazi, M.S. Rapid virulence typing of Pasteurella multocida by multiplex PCR. Res. Vet. Sci. 2009, 87, 355–357. [Google Scholar] [CrossRef] [Scilit]
  39. Seng, P.; Rolain, J.M.; Fournier, P.E.; La Scola, B.; Drancourt, M.; Raoult, D. MALDI-TOF mass spectrometry applications in clinical microbiology. Future Microbiol. 2010, 5, 1733–1754. [Google Scholar] [CrossRef] [Scilit]
  40. Sauer, S.; Lehrach, H.; Reinhardt, R. MALDI mass spectrometry analysis of single nucleotide polymorphisms by photocleavage and charge-tagging. Nucleic Acids Res. 2003, 31, e63. [Google Scholar] [CrossRef] [Scilit]
  41. Łomnicki, A. Introduction to Statistics for Natural Scientists; PWN: Warsaw, Poland, 2003. [Google Scholar]
  42. Markowska-Daniel, I.; Stępniewska, K. Review of methods applied for the detection and characterization of Pasteurella multocida and Bordetella bronchiseptica. Med. Weter. 2009, 65, 166–170. [Google Scholar]
  43. Townsend, K.M.; Frost, A.J.; Lee, C.W.; Papadimitriou, J.M.; Dawkins, H.J.S. Development of PCR assays for species- and type-specific identification of Pasteurella multocida isolates. J. Clin. Microbiol. 1998, 36, 1096–1100. [Google Scholar] [CrossRef] [Scilit]
  44. Chung, J.Y.; Zhang, Y.; Adler, B. The capsular biosynthetic locus of Pasteurella multocida A:1. FEMS Microbiol. Lett. 1998, 166, 289–296. [Google Scholar] [CrossRef]
  45. Christensen, H.; Bisgaard, M. Molecular classification and its impact on diagnostics and understanding the phylogeny and epidemiology of selected members of Pasteurellaceae of veterinary importance. Berl. Munch. Tierarztl. Wochenschr. 2010, 123, 20–30. [Google Scholar] [PubMed]
  46. Zhu, W.; Fan, Z.; Qiu, R.; Chen, L.; Wei, H.; Hu, B.; Chen, M.; Wang, F. Characterization of Pasteurella multocida isolates from rabbits in China. Vet. Microbiol. 2020, 244, 108649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Jaglic, Z.; Kucerova, Z.; Nedbalcova, K.; Hlozek, P.; Bartos, M. Identification of Pasteurella multocida serogroup F isolates in rabbits. J. Vet. Med. B 2004, 51, 467–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Pławińska-Czarnak, J.; Wódz, K.; Strzałkowska, Z.; Żychska, M.; Nowak, T.; Kwieciński, A.; Kwieciński, P.; Bielecki, W.; Rodo, A.; Rzewuska, M.; et al. Comparison of automatic (MALDI-TOF, VITEK 2) and manual methods for the identification of intestinal microbial communities from alpacas. J. Vet. Res. 2023, 67, 361–372. [Google Scholar] [CrossRef] [Scilit]
  49. Pyz-Łukasik, R.; Piróg-Komorowska, A.; Policht, A. Occurrence, Molecular Serogroups, Antimicrobial Susceptibility and Identification by MALDI-TOF MS of Listeria monocytogenes Isolated from RTE Meat Products in Southern Poland. Foods 2024, 13, 2950. [Google Scholar] [CrossRef] [Scilit]
  50. Kuhnert, P.; Bisgaard, M.; Korczak, B.M.; Schwendener, S.; Christensen, H.; Frey, J. Identification of animal Pasteurellaceae by MALDI-TOF mass spectrometry. J. Microbiol. Methods 2012, 89, 1–7. [Google Scholar] [CrossRef] [Scilit]
  51. Zangenah, S.; Güleryüz, G.; Boräng, S.; Ullberg, M.; Bergman, P.; Özenci, V. Identification of clinical Pasteurella isolates by MALDI-TOF MS: Comparison with VITEK 2 and conventional methods. Diagn. Microbiol. Infect. Dis. 2013, 77, 96–98. [Google Scholar] [CrossRef] [Scilit]
  52. Lawton, S.J.; Weis, A.M.; Byrne, B.A.; Fritz, H.; Taff, C.C.; Townsend, A.K.; Weimer, B.C.; Mete, A.; Wheeler, S.; Boyce, W.M. Comparative analysis of Campylobacter isolates from wild birds and chickens using MALDI-TOF MS, biochemical testing, and DNA sequencing. J. Vet. Diagn. Investig. 2018, 30, 354–361. [Google Scholar] [CrossRef] [Scilit]
  53. Dousse, F.; Thomann, A.; Brodard, I.; Korczak, B.M.; Schlatter, Y.; Kuhnert, P.; Miserez, R.; Frey, J. Routine phenotypic identification of bacterial species of the family Pasteurellaceae isolated from animals. J. Vet. Diagn. Investig. 2008, 20, 716–724. [Google Scholar] [CrossRef] [Scilit]
  54. Tanner, H.; Evans, J.T.; Gossain, S.; Hussain, A. Evaluation of three sample preparation methods for the direct identification of bacteria in positive blood cultures by MALDI-TOF MS. BMC Res. Notes 2017, 10, 48. [Google Scholar] [CrossRef] [Scilit]
Pathogens 15 00171 g001
Figure 1. Electrophoresis of multiplex PCR products according to Townsend et al. [19] obtained from P. multocida strains. (a) Lanes: 1. P1059 (serotype A), 2. P27 (serotype D), 3. P4218 (serotype F), 4–13. field strains P. multocida (serotype A: 4–10, 12, 13; serotype D: 11), 14—negative control, M—molecular weight marker; (b) Lanes: 1–15. field strains P. multocida (serotype A: 1, 4–11, 15; serotype D: 2, 12–14; serotype F: 3), 16—negative control, M—molecular weight marker.
Figure 1. Electrophoresis of multiplex PCR products according to Townsend et al. [19] obtained from P. multocida strains. (a) Lanes: 1. P1059 (serotype A), 2. P27 (serotype D), 3. P4218 (serotype F), 4–13. field strains P. multocida (serotype A: 4–10, 12, 13; serotype D: 11), 14—negative control, M—molecular weight marker; (b) Lanes: 1–15. field strains P. multocida (serotype A: 1, 4–11, 15; serotype D: 2, 12–14; serotype F: 3), 16—negative control, M—molecular weight marker.
Pathogens 15 00171 g001
Pathogens 15 00171 g002
Figure 2. Determination of capsular types of P. multocida strains isolated from rabbits using multiplex PCR according to Townsend et al. [19].
Figure 2. Determination of capsular types of P. multocida strains isolated from rabbits using multiplex PCR according to Townsend et al. [19].
Pathogens 15 00171 g002
Table 1. The characteristics of the primers for multiplex PCR according to Townsend et al. [19].
Table 1. The characteristics of the primers for multiplex PCR according to Townsend et al. [19].
SerogroupGene TargetPrimersSequence (5′–3′)Product Size
AhyaD-hyaCCAPA-FWDTGCCAAAATCGCAGTGAG1044 bp
CAPA-REVTTGCCATCATTGTCAGTG
DdcbFCAPD-FWDTTACAAAAGAAAGACTAGGAGCCC657 bp
CAPD-REVCATCTACCCACTCAACCATATCAG
FfcbDCAPF-FWDAATCGGAGAACGCAGAAATCAG851 bp
CAPF-REVTTCCGCCGTCAATTACTCTG
AllKMT1KMT1T7ATCCGCTATTTACCCAGTGG460 bp
KMT1SP6GCTGTAAACGAACTCGCCAC
Table 2. Determination of the specificity of multiplex PCR according to Townsend et al. [19].
Table 2. Determination of the specificity of multiplex PCR according to Townsend et al. [19].
StrainsSpecies
Identification		Capsular Antigen
Group AGroup DGroup F
P8++−−
P1059++−−
Kobe 6+−+−
P27+−+−
P3695+−−+
P4218+−−+
Staphylococcus aureus ATCC 6538−−−−
Listeria monocytogenes ATCC 7644−−−−
Escherichia coli ATCC 25922−−−−
Salmonella Typhimurium ATCC 14028−−−−
Klebsiella pneumoniae ATCC 13883−−−−
+ positive result (presence of the gene); − negative result (absence of the gene).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Budniak, S.; Kędrak-Jabłońska, A.; Szulowski, K. Evaluation of the Application of PCR and MALDI-TOF MS Methods for the Identification of Pasteurella multocida Strains Isolated from Rabbits in Poland. Pathogens 2026, 15, 171. https://doi.org/10.3390/pathogens15020171

AMA Style

Budniak S, Kędrak-Jabłońska A, Szulowski K. Evaluation of the Application of PCR and MALDI-TOF MS Methods for the Identification of Pasteurella multocida Strains Isolated from Rabbits in Poland. Pathogens. 2026; 15(2):171. https://doi.org/10.3390/pathogens15020171

Chicago/Turabian Style

Budniak, Sylwia, Agnieszka Kędrak-Jabłońska, and Krzysztof Szulowski. 2026. "Evaluation of the Application of PCR and MALDI-TOF MS Methods for the Identification of Pasteurella multocida Strains Isolated from Rabbits in Poland" Pathogens 15, no. 2: 171. https://doi.org/10.3390/pathogens15020171

APA Style

Budniak, S., Kędrak-Jabłońska, A., & Szulowski, K. (2026). Evaluation of the Application of PCR and MALDI-TOF MS Methods for the Identification of Pasteurella multocida Strains Isolated from Rabbits in Poland. Pathogens, 15(2), 171. https://doi.org/10.3390/pathogens15020171

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop