Next Article in Journal
The Role of Positive Klebsiella Culture in Revision Hip and Knee Arthroplasty
Next Article in Special Issue
Multidrug Resistance and Adaptive Response to Silver and Gold Nanoparticles in Methicillin-Resistant Staphylococcus aureus from Human and Animal Sources
Previous Article in Journal
Isolation, Identification, and Molecular Characterization of Mycoplasma bovis from Beef Cattle in Kunming, and Development of a SYBR Green qPCR Assay
Previous Article in Special Issue
Natural Protective Mechanisms of Cucumis callosus Leaves in Escherichia Species-Induced Urinary Tract Infection: An Integrated In Silico and In Vivo Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Silent Reservoirs: Antibiotic-Resistant Escherichia coli in Autochtonous Portuguese Laying Hens

1
University Institute of Health Sciences, Cooperativa de Ensino Superior Politécnico e Universitário (IUCS-CESPU), Avenida Central de Gandra 1317, 4585-116 Paredes, Portugal
2
UCIBIO—Applied Molecular Biosciences Unit, University Institute of Health Sciences (1H-TOXRUN, IUCS-CESPU), Avenida Central de Gandra 1317, 4585-116 Paredes, Portugal
3
CIBIO/InBIO—Research Center in Biodiversity and Genetic Resources/Research Network in Biodiversity and Biodiversity and Evolutionary Biology, Associated Laboratory, University of Porto, Campus de Vairão, Rua Padre Armando Quintas 7, 4485-661 Vairão, Portugal
4
BIOPOLIS Program in Genomics, Biodiversity and Land Planning, Campus de Vairão, Rua Padre Armando Quintas 7, 4485-661 Vairão, Portugal
5
Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal
6
ANGRA—Associação Nacional dos Criadores de Galinhas de Raças Autóctones, 4775-060 Barcelos, Portugal
7
FERA—Federação Nacional das Associações de Raças Autóctones, 4800-875 Guimarães, Portugal
8
UCIBIO—Applied Molecular Biosciences Unit, Faculty of Pharmacy, University of Porto, Rua Jorge de Viterbo Ferreira 228, 4050-313 Porto, Portugal
9
Associate Laboratory i4HB, Institute for Health and Bioeconomy, Faculty of Pharmacy, University of Porto, Rua Jorge de Viterbo Ferreira 228, 4050-313 Porto, Portugal
10
CISAS—Center for Research and Development in Agrifood Systems and Sustainability, Polytechnic Institute of Viana do Castelo, NUTRIR (Technological Center of AgriFood Sustainability), Monte de Prado, 4960-320 Melgaço, Portugal
11
LAQV-REQUIMTE—Associated Laboratory for Green Chemistry, University NOVA of Lisbon, 1099-085 Caparica, Portugal
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Pathogens 2026, 15(2), 163; https://doi.org/10.3390/pathogens15020163
Submission received: 13 January 2026 / Revised: 28 January 2026 / Accepted: 30 January 2026 / Published: 2 February 2026
(This article belongs to the Special Issue Current Progress on Bacterial Antimicrobial Resistance)

Abstract

Antimicrobial Resistance (AMR) is a critical public health challenge requiring a coordinated One Health approach. Escherichia coli is a key indicator of AMR and fecal contamination, as well as a zoonotic pathogen transmissible from animals to humans, often through contaminated products like meat and eggs. This study assessed the presence of antibiotic-resistant E. coli and associated resistance genes in 248 cloacal/eggshell samples collected from four autochthonous Portuguese laying hen breeds (Preta Lusitânica, Amarela, Branca, and Pedrês Portuguesa) raised under low antibiotic exposure. A total of 81 E. coli isolates were analyzed for phenotypic antibiotic susceptibility (EUCAST/CLSI) and genotypic resistance, using PCR. Resistance to at least one antibiotic was observed in 98.0% of the isolates. Gentamicin resistance was particularly high (97.1% cloacal; 95.7% eggshell isolates), followed by tetracycline (31.0% cloacal; 41.0% eggshell) and ampicillin (14.0% cloacal; 24.0% eggshell). Multidrug resistance (MDR) was observed in 14.3% of cloacal and 17.4% of eggshell isolates. Notably, no resistance was found against critically important antibiotics. The most prevalent resistance genes were sul2 (45.0% cloacal; 48.0% eggshell) and blaTEM (45.0% cloacal; 36.0% eggshell). Detection of resistant and MDR E. coli in low input systems suggests environmental acquisition, with chickens as reservoirs, highlighting the need for One Health surveillance.

1. Introduction

Antimicrobial Resistance (AMR) has become one of the most critical and complex public health challenges of our time, representing a transboundary threat that undermines decades of progress in both human and veterinary medicine [1,2]. Tackling AMR effectively requires coordinated, multidisciplinary efforts grounded in the One Health approach, which recognizes the intrinsic interconnectedness of human, animal, plant, and environmental health. This integrated framework is formally embodied in the quadripartite collaboration between the Food and Agriculture Organization of the United Nations (FAO), the World Health Organization (WHO), the World Organization for Animal Health (WOAH), and the United Nations Environment Programme (UNEP) [3,4].
This crisis is primarily driven by the intensive and often inappropriate use of antibiotics, which accelerates natural selection and promotes the emergence of resistant bacteria [1,3,5]. It is estimated that, within the next three decades, AMR could cause up to 10 million deaths annually, potentially becoming more lethal than cancer [1,2]. Beyond its profound health implications, AMR also imposes a considerable economic burden, estimated at approximately €11.7 billion annually in Europe [6].
The widespread use of antibiotics in intensive animal farming is widely recognized as a major driver of AMR. It is estimated that between 50% and 80% of antibiotics used globally are administered in this sector [7]. Furthermore, antibiotic consumption in animal agriculture has historically exceeded that in human medicine [8,9]. However, recent European surveillance data show a positive trend, with antibiotic consumption in food-producing animals declining by 44% between 2014 and 2021 and now falling below levels reported for humans across EU/EEA countries [10]. Despite these reductions, food-producing animals can still act as important reservoirs of antibiotic-resistant bacteria. Environmental contamination resulting from the application of organic fertilizers derived from animal manure may introduce antibiotic residues, antibiotic-resistant bacteria, and resistance genes into agricultural soils, water systems, and the food chain [11].
Among the microbial agents of concern, Escherichia coli is a Gram-negative bacterium naturally present in the gastrointestinal tract of animals and humans [12], widely used as an indicator organism to monitor resistance trends. Escherichia coli is a major pathogen in poultry production and a significant cause of foodborne and other types of infections in humans [13,14]. This species is frequently used as an indicator of antimicrobial resistance due to its wide distribution and its ability to harbor multiple resistance genes located on mobile genetic elements, such as plasmids, transposons, and integrons, thereby acting as a reservoir of antimicrobial resistance genes for pathogenic strains [10,15]. In particular, β-lactamases, enzymes capable of hydrolyzing β-lactam antibiotics, are among the most important mechanisms contributing to resistance in E. coli. Moreover, E. coli may acquire resistance through the development of mutations when exposed to antimicrobial selective pressures exerted on their host [15,16]. Several studies [15,17] have evaluated the resistance profiles of E. coli isolates obtained from chickens and chicken meat, reporting resistance to aminoglycosides, β-lactam antibiotics, including penicillin and cephalosporins, and fluoroquinolones in all tested isolates. The excessive and often inappropriate use of antibiotics has favored the emergence of resistant and multidrug-resistant (MDR) strains [18], defined as those resistant to three or more classes of antimicrobials [19]. MDR E. coli strains pose a public health threat because they can be transmitted from animals to humans through the consumption of contaminated animal products (e.g., meat, milk, and eggs), direct contact with animals, or exposure to contaminated environments [20].
Studies describing AMR profiles of bacteria isolated from commercial poultry and intensive production systems are relatively limited in Portugal [21,22,23], and the role of autochthonous Portuguese laying hens as potential reservoirs of antibiotic-resistant E. coli remains largely unexplored. Portugal is home to four autochthonous breeds, namely Branca, Pedrês Portuguesa, Amarela and Preta Lusitânica (Figure 1). The minimal or absent use of antibiotics observed in these breeds is primarily associated with the production systems in which they are raised. These breeds are typically raised in extensive farming systems, including in low-input production or backyard systems, where chickens are allowed free-range access during the day and are housed at night, with feed and water provided indoors to supplement scavenging. Production usually occurs on a small scale, within household poultry keeping that relies on family labour and, whenever possible, locally available feed resources, and are commonly referred to as family poultry systems [24,25,26]. The relevance of these native Portuguese laying hens is multifaceted. The production systems used for their breeding make them a valuable model for studying the natural ecology of AMR in the absence of strong selective pressure. Knowledge generated from these dual-purpose breeds (meat and eggs) is essential for establishing baseline AMR data and supporting the implementation of more sustainable livestock practices [27]. Beyond their biological relevance, with unique physical and genetic characteristics, Portuguese native chicken breeds hold significant historical, cultural, and socio-economic value, being deeply rooted in the traditions of small family farms. However, the intensification of industrial poultry farming throughout the 20th century led to the marginalization of these breeds, resulting in severe population declines and placing several of them at risk of extinction, particularly the Branca and Preta Lusitânica breeds [24].
In line with the One Health approach, this study aimed to assess the occurrence of E. coli in cloacal and eggshell samples from these four autochthonous Portuguese laying hen breeds with minimal antibiotic exposure, followed by the characterization of their phenotypic antimicrobial resistance profiles and the detection of associated resistance genes. Sampling both cloaca and eggshells allows assessment of gut colonization and potential contamination of food products, providing an integrated view of the ecological dynamics of AMR in these native breeds and their potential implications for animal, human, and environmental health.

2. Materials and Methods

2.1. Sample Origin, Collection, and Characterization

A total of 248 swab samples (124 cloacal and 124 eggshells) from the four autochthonous Portuguese laying hen breeds, including Branca (n = 64), Pedrês Portuguesa (n = 64), Amarela (n = 64), and Preta Lusitânica (n = 56), collected from 31 flocks across 12 farms were analyzed in this study.
The characteristics of farms and flocks, as well as the original sample collection procedures, were previously described by Miranda et al. [28]. Briefly, all farms operated under extensive rearing systems characterized by partial outdoor access and small flock sizes (≤50 birds per farm), with a male-to-female ratio of 1:10–15. No antibiotic administration was reported during the three months preceding the sampling period. From each farm, which included separate flocks of one to four breeds, four cloacal and four eggshell samples were randomly collected using sterile swabs [28].

2.2. Isolation and Identification of Escherichia coli

The stored cloacal and eggshell samples were inoculated into Brain Heart Infusion (BHI) broth at a 1:10 (v/v) ratio and incubated at 37 °C for 18 to 24 h. Following pre-enrichment, 20 μL (corresponding to two loops) of each BHI culture was streaked onto MacConkey agar plates using the streak plate technique to allow colony isolation. MacConckey agar is both selective and differential: it contains crystal violet and bile salts to inhibit the growth of Gram-positive bacteria, while lactose and neutral red enable differentiation based on lactose fermentation. Plates were incubated at 37 °C for 24 h.
From each positive MacConkey plate, one to three representative pink colonies, indicativee of lactose fermenters, such as E. coli, were selected for further confirmation on Chromogenic Coliform Agar (CCA). This medium is selective and differential for coliform bacteria, and E. coli typically forms distinctive blue colonies, with or without a pink halo. These plates were incubated at 37 °C for 24 h. Presumptive E. coli isolates were then plated onto BHI agar for further analyses. DNA was extracted using the boiling method, and multiplex PCR [29] was performed for both species confirmation and the detection of antibiotic resistance genes. PCR was carried out using the Xpert Fast Hotstart Mastermix (GRiSP Research Solutions, Porto, Portugal), according to the manufacturer’s instructions. Species identification was confirmed using the uidA and uspA primers [29], while additional primers targeting ESBL genes were used as described below (Table 1).

2.3. Antimicrobial Susceptibility Testing and ESBL Detection

The antimicrobial susceptibility of E. coli isolates was evaluated using the disk diffusion method on Mueller–Hinton II Agar (Alliance Bio Expertise, Guipry Messac, France), following the guidelines of the European Committee on Antimicrobial Susceptibility Testing (EUCAST, 2025) and the Clinical and Laboratory Standards Institute (CLSI, 2020) [30,31]. Escherichia coli ATCC 25922 was used as the quality-control strain in all assays. Bacterial suspensions were prepared in 0.9% NaCl and adjusted to a turbidity equivalent to the 0.5 McFarland standard using a densitometer. These suspensions were inoculated onto Mueller–Hinton II agar plates using sterile swabs and the lawn culture technique, and antibiotic-impregnated disks were subsequently placed on the surface using an automatic dispenser.
Table 1. Nucleotide sequences with annealing temperature (AT) and expected amplicon size, used in this study.
Table 1. Nucleotide sequences with annealing temperature (AT) and expected amplicon size, used in this study.
PrimerNucleotide Sequence (5′ to 3′)Size (bp)AT (°C)Reference
blaOXA-1ACACAATACATATCAACTTCGC
AGTGTGTTTAGAATGGTGATC
81361Steward et al. [32]
blaCTX-MATGTGCAGYACCAGTAARGT
TGGGTRAARTARGTSACCAGA
59350Lim et al. [33]
blaSHVGGTTATGCGTTATATTCGCC
TTAGCGTTGCCAGTGCTC
86760Lim et al. [33]
blaTEMGAGTATTCAACATTTTCGT
ACCAATGCTTAATCAGTGA
85750Maynard et al. [34]
tet(B)CTCAGTATTCCAAGCCTTTG
CTAGCACTTGTCTCCTGTT
41657Guardabassi et al. [35]
sul2CGGCATCGTCAACATAACCT
TGTGCGGATGAAGTCAGCTC
72155Fazel et al. [36]
aac(3′)-IVCTTCAGGATGGCAAGTTGGT TCATCTCGTTCTCCGCTCAT28660Sáenz et al. [37]
aac(6′)-Ib-crCGGCATCGTCAACATAACCT
TGTGCGGATGAAGTCAGCTC
48255Park et al. [38]
The antibiotic panel included representatives of five major antimicrobial classes: β-lactams (ampicillin 10 µg, amoxicillin + clavulanic acid 20 + 10 µg, cefotaxime 30 µg, aztreonam 30 µg, imipenem 5 µg), folate pathway antagonists (trimethoprim + sulfamethoxazole 1.25 + 23.75 µg), quinolones (ciprofloxacin 5 µg), aminoglycosides (gentamicin 10 µg, amikacin 30 µg), and tetracyclines (tetracycline 30 µg).
Cultures were incubated at 37 °C for 18 to 24 h. After incubation, the diameters of the inhibition zones surrounding each antibiotic disk were measured in millimeters to determine the susceptibility profile of each isolate. Screening for extended-spectrum beta-lactamase (ESBL) production was performed using the double-disk synergy test. In this assay, an amoxicillin-clavulanic acid disk was placed at the center of the plate, with cefotaxime and aztreonam disks positioned 25 mm apart. The presence of an enhanced inhibition zone, known as keyhole effect, between the central and surrounding disks was interpreted as indicative of ESBL production.

2.4. Detection of Antibiotic Resistance Genes

Detection of antibiotic resistance genes was performed in E. coli isolates selected based on their phenotypic antibiotic resistance profiles and breed/farm’s distribution.
Genomic DNA was extracted from E. coli isolates using the boiling method. The detection of antimicrobial resistance genes was performed by PCR using the Xpert Fast Hotstart Mastermix (GRiSP Research Solutions, Porto, Portugal) according to the manufacturer’s instructions. Amplification was conducted in an thermocycler (MJ Mini, Bio-Rad, Hercules, CA, USA) under the following conditions: an initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing temperature ranging from 50 °C to 60 °C (depending on the specific primer pair used) for 15 s, and extension at 72 °C for 2 s. A final extension step was performed at 72 °C for 5 min. The target genes included blaOXA-1, blaCTX-M, blaSHV, and blaTEM (associated with β-lactam resistance), tet(B) (tetracyclines), sul2 (sulfamethoxazole), aac(3′)-IV (aminoglycosides), and aac(6′)-Ib-cr (fluoroquinolones). Primer sequences and annealing temperatures were based on previously published studies [32,33,34,35,36,37,38] are presented in Table 1.
PCR products were analyzed by electrophoresis on a 1.2% agarose gel containing 3 µL of GelRed® fluorescent dye (Biotium, Fremont, CA, USA). A molecular weight marker (NzyDNA Ladder V, Nzytech, Lisbon, Portugal) was used to estimate the size of the amplified fragments. Electrophoresis results were visualized using a ChemiDoc transilluminator (Bio-Rad, Hercules, CA, USA). Positive controls, kindly provided by the CCP, Culture Collection of Porto, were included in all PCR assays.

3. Results

3.1. Breed Distribution of Escherichia coli Isolates

A total of 81 E. coli isolates were successfully obtained from 53 out of 248 (21.4%) samples, including 28/124 (22.6%) cloacal samples and 25/124 (20.2%) eggshell samples collected from laying hens of the four autochthonous Portuguese breeds. Most samples (78.6%, 195/248) showed no growth compatible with E. coli. Among cloacal samples, 35 E. coli isolates were identified: Preta Lusitânica (n = 7), Amarela (n = 11), Pedrês Portuguesa (n = 5), and Branca (n = 12). From eggshell samples, 46 E. coli isolates were obtained: Preta Lusitânica (n = 15), Amarela (n = 9), Pedrês Portuguesa (n = 10), and Branca (n = 12).

3.2. Phenotypic Antimicrobial Resistance

All obtained E. coli isolates, originating from different breeds and farms, were subjected to antimicrobial susceptibility testing. Among the 35 cloacal isolates, most (97.1%, 34/35) were resistant to gentamicin. All isolates (100.0%, 28/28) from the Amarela, Pedrês Portuguesa, and Branca breeds exhibited resistance, while 85.7% (6/7) of isolates from Preta Lusitânica hens were resistant. Resistance to tetracycline was observed in 31.4% (11/35) of isolates, distributed as follows: Amarela, 8.3% (1/12); Pedrês Portuguesa, 60.0% (3/5); and Branca, 63.6% (7/11). Resistance to ampicillin was detected in 14.3% (5/35) of isolates: Preta Lusitânica, 14.3% (1/7); Amarela, 16.7% (2/12); and Branca, 18.2% (2/11). Isolates from Amarela, Pedrês Portuguesa, and Branca breeds also showed resistance to trimethoprim/sulfamethoxazole (11.4%, 4/35).
Resistance to amoxicillin/clavulanic acid (5.7%, 2/35) and amikacin (8.6%, 3/35) was only observed in isolates from the Amarela and Branca breeds. It is important to note that no resistance was observed to cefotaxime, imipenem, aztreonam, or ciprofloxacin (Figure 2). Overall, the results indicate that phenotypic resistance varied among breeds, with gentamicin resistance being the most prevalent across all cloacal isolates.
Among the 46 eggshell isolates, 95.7% (44/46) were resistant to gentamicin. All isolates from Preta Lusitânica and Branca breeds exhibited resistance, whereas resistance in Pedrês Portuguesa and Amarela isolates was 90.0% (9/10) and 88.9% (8/9), respectively.
Tetracycline resistance was detected in 41.3% (19/46) of isolates across all four breeds. Resistance to amikacin (4.3%, 2/46) was observed only in isolates from Preta Lusitânica, and resistance to amoxicillin/clavulanic acid (4.3%, 2/46) was detected in Amarela isolates. Trimethoprim/sulfamethoxazole resistance (2.2%, 1/46) occurred exclusively in an isolate from the Branca breed Ampicillin resistance was observed in 23.9% (11/46) of isolates: Preta Lusitânica, 13.3% (2/15); Amarela, 55.6% (5/9); and Pedrês Portuguesa, 40.0% (4/10). No resistance was detected to cefotaxime, imipenem, aztreonam, or ciprofloxacin (Figure 3). Overall, these results indicate that gentamicin resistance was highly prevalent across eggshell isolates, while resistance to other antimicrobials varied among breeds.
Resistance to at least one antibiotic and an MDR phenotype were observed in 98.0% (79/81) and 16.0% (13/81), respectevely, among all recovered E. coli isolates, whereas only two isolates exhibited pan-susceptibility.
Among cloacal E. coli isolates, only one isolate (2.9%, 1/35) from the Preta Lusitânica breed was susceptible to all antibiotics tested. In contrast, all isolates from the remaining breeds exhibited resistance to at least one antibiotic. The MDR phenotype was observed in 14.3% (5/35) of isolates: Branca, 27.3% (3/11) and Amarela, 16.7% (2/12) (Figure 4a). Among eggshell E. coli isolates, only one isolate (2.2%, 1/46) obtained from the Amarela breed was susceptible to all antibiotics, while isolates from the other breeds showed resistance to at least one antibiotic. The MDR phenotype was observed in 17.4% (8/46) of eggshell isolates: Amarela, 55.6% (5/9); Preta Lusitânica, 13.3% (2/15); and Pedrês Portuguesa 10.0% (1/10) (Figure 4b).
No phenotypic resistance to third-generation cephalosporins, such as cefotaxime, was observed in any isolates. Consistently, no ESBL-producing E. coli were detected by the double-disk synergy test. Overall, these results indicate that MDR E. coli isolates were relatively uncommon among both cloacal and eggshell samples, with breed-specific differences in resistance patterns.

3.3. Antibiotic Resistance Genes

Molecular screening for antibiotic resistance genes was performed in selected E. coli isolates and compared with their phenotypic profiles. Although no ESBL phenotype was detected using the double-disk synergy testing, screening for ESBL-related genes (blaTEM, blaCTX-M, blaSHV) was conducted. Representative isolates from different breeds and farms were analyzed, including 20/35 cloacal isolates for the dectection of resistance genes. Screening for blaTEM, blaCTX-M, blaOXA-1, and blaSHV genes was performed in 44/46 cloacal isolates, and screening of tet(B), sul2, aac(6′)-Ib-cr, and aac(3′)-IV genes was conducted in 21/46 eggshell isolates.
Among cloacal E. coli isolates, not all targeted resistance genes were detected. No isolates harbored the blaOXA-1, blaSHV, tet(B), or aac(6′)-Ib-cr genes. Overall, 13/20 (65.0%) cloacal isolates carried one to three of the analyzed resistance genes. The most frequently detected genes were blaTEM (45.0%, 9/20) and sul2 (45.0%, 9/20). The blaCTX-M gene was identified in two isolates (10.0%), obtained from Preta Lusitânica and Pedrês Portuguesa breeds. The aac(3′)-IV gene was detected in two isolates (10.0%) from Preta Lusitânica and Branca breeds (Figure 5). These findings indicate that despite the absence of ESBL phenotypes, cloacal E. coli isoaltes may act as a reservoir of hidden or low-level β-lactam resistance.
Overall, the genotypic results were consistent with the phenotypic resistance patterns. Several cloacal E. coli isolates exhibiting phenotypic antibiotic resistance also carried one or more corresponding antibiotic resistance genes (Table 2).
As observed for cloacal isolates, none of the isolates carried the blaOXA-1 or blaSHV genes. The most frequently detected genes were blaTEM (36.4%, 16/44) and sul2 (47.6%, 10/21). The blaCTX-M gene was found in 11.4% (5/44) of isolates obtained from the Preta Lusitânica and Branca breeds (Figure 6a). The Pedrês Portuguesa breed was the only one with isolates carrying the tet(B) (20.0%, 1/5) and aac(6′)-Ib-cr (20.0%, 1/5) genes. The aac(3′)-IV gene was detected in one isolate from the Branca breed (20.0%, 1/5) (Figure 6b). Overall, 16/21 (76.2%) eggshell isolates harbored one to three of the analyzed resistance genes.
Genotypic profiles were generally consistent with phenotypic resistance, and several antibiotic-resistant E. coli strains from eggshell samples harbored one or more antibiotic resistance genes (Table 3).

4. Discussion

This study is pioneering in evaluating the AMR profile of E. coli isolates obtained from autochthonous Portuguese laying hens. It fills a critical knowledge gap, as no previous studies have specifically targeted these native breeds. These autochthonous chickens (Branca, Pedrês Portuguesa Amarela, and Preta Lusitânica) are typically raised in extensive or semi-extensive production systems characterized by low inputs and minimal or no antibiotic administration. Nevertheless, the detection of antibiotic-resistant and MDR E. coli in all breeds studied emphasizes that AMR is not limited to intensive production systems and can persist even in ecological niches with low direct antibiotic selective pressure.
Poultry production is widely recognized as an important reservoir of resistant-bacteria, including E. coli, which poses a growing threat to global public health. These bacteria may be transmitted to humans through the food chain, particularly via contaminated eggs, or through direct contact with animals, contaminated fomites, and the surrounding environment [1,20]. In Portugal, studies investigating AMR in native poultry raised under extensive systems remain scarce, with most research focusing predominantly on broilers from intensive production systems, which limits direct comparisons [39]. Despite this, one Portuguese study conducted in breeding and commercial laying hens reared under intensive production reported that 81.0% of E. coli isolates obtained from fecal samples were resistant to at least one antimicrobial [40], a finding that corroborates the results of the present study.
In the present work, resistance to at least one antibiotic was observed in 98.0% of the isolates, including both cloacal and eggshell samples. The prevalence of MDR phenotypes was 17.4% among eggshell isolates from the Preta Lusitânica, Branca, and Pedrês Portuguesa breeds, and 14.3% among cloacal isolates from the Amarela and Branca breeds. These MDR values are lower than those reported in some international studies, such as the 34.9% MDR observed in E. coli isolated from cloacal swabs and internal organs of backyard chickens in small scale poultry farms [41], and the 66.9% reported for Enterobacteriaceae isolated from liver samples of commercial broilers and backyard chickens [42]. This difference may reflect the minimal antibiotic exposure characteristic of Portuguese extensive production systems.
Worldwide, tetracyclines, fluoroquinolones, sulfonamides/trimethoprim, macrolides, aminoglycosides (e.g., neomycin and gentamicin), polymyxins (colistin), and β-lactams (amoxicillin/penicillin) are among the most frequently used antimicrobial classes in chickens. This pattern is consistent with studies reporting resistance of E. coli to aminoglycosides, β-lactams (including penicillin and cephalosporins), and fluoroquinolones in poultry isolates [15,17]. Gentamicin is reported as one of the most widely used antimicrobials in broiler production, where it is often administered prophylactically to day-old chicks to prevent bacterial infections [43]. Gentamicin belongs to the aminoglycoside class and is classified by the WHO as a critically important antimicrobial, defined as a drug essential for the treatment of serious human infections with limited or no effective alternatives. In the present study, resistance levels to gentamicin were substantially higher than those previously reported in Portuguese poultry (17.0%) [44], as well as, in international studies, such as 23.4% [42], or 39.5% for gentamicin and 29.1% for tetracycline [41]. In addition, resistance to gentamicin is common among enteric bacteria associated with poultry. Avian pathogenic E. coli isolates obtained from avian colibacillosis cases in North Georgia between 1996 and 2000, showed that 69% of isolates were resistant to gentamicin [45]. In Nigeria, a recent study reported that isolates from local chickens in smallholder poultry systems showed higher resistance to aminoglycosides (22.6%) compared with tropically adapted chickens [46]. A German study conducted in commercial broiler flocks between 2013 and 2018 reported aminoglycosides (25.6%) and lincosamides (25.6%) as the most frequently used antimicrobial classes, followed by polypeptides (21.4%) and β-lactams (16.2%). During this period, the use of aminoglycosides and lincosamides tended to increase, whereas fluoroquinolones, macrolides and polypeptides have decreased [47]. Importantly, Price et al. [43] demonstrated that poultry workers were 32 times more likely to carry gentamicin-resistant E. coli than individuals in the general community, highlighting the occupational exposure associated with the broiler production environment. Although aminoglycosides are poorly absorbed in the gastrointestinal tract and gentamicin is not administered orally, limiting community-level selection pressure, this markedly increased carriage among poultry workers supports the hypothesis that direct contact with poultry environments plays a key role in the dissemination of gentamicin-resistant E. coli [43].
Despite minimal antibiotic use in these low-input production systems, the persistent presence of resistant E. coli, particularly to gentamicin, suggests that resistance acquisition of E. coli in Portuguese native breeds may originate from environmental sources or external contamination. Environmental factors such as soil, water, feed, and human contact may act both as sources of contamination for animals and eggshells and as recipients of resistant bacteria shed by the colonized hens [20]. Scavenging behavior, an adaptive trait of local chickens shaped by multiple genetic factors, contributes to their survivability and resilience compared with exotic and improved breeds. However, this characteristic may increase exposure to environments contaminated with antibiotics through direct sources, such as feed and water, or indirect sources, including human sewage and wastewater [46,48].
In autochthonous chickens, antibiotic resistance is likely driven by antibiotic selection pressure from direct or environmental sources, together with a dense and diverse gut microbiome that acts as a reservoir of antibiotic resistance genes, and efficient horizontal gene transfer mediated by mobile genetic elements. These processes are further modulated by the production system ecotype and scavenging behavior, which increase contact with contaminated environments and resistance determinants. Overall, these findings highlight the complex ecological interactions underlying antimicrobial resistance dissemination. Consequently, native laying hens may serve as reservoirs of resistant E. coli and resistance genes, with potential implications for the human food chain through contaminated eggs.
A particularly encouraging finding was the absence of resistance to imipenem, cefotaxime, aztreonam, and ciprofloxacin in all isolates. The full susceptibility to imipenem and aztreonam, antibiotics generally restricted to human medicine, is especially noteworthy.
Differences were observed between sample types. Eggshell isolates showed a slightly higher prevalence of resistance to ampicillin (23.9%) and tetracycline (41.3%), compared with cloacal isolates (14.3% and 31.4%, respectively). This discrepancy suggests that environmental contamination of eggs during or after laying may contribute to the observed resistance patterns. Molecular screening for ESBL-related genes (blaTEM, blaCTX-M, blaSHV) was conducted despite the absence of an ESBL phenotype detected by the Double-Disk Synergy Test. The presence of these genes without phenotypic expression suggests silent gene carriage or the production of narrow-spectrum β-lactamases, a phenomenon also reported in another Portuguese study [40]. Some β-lactamase genes may be expressed at low levels, be non-functional, or fail to produce a detectable phenotype under the tested conditions. Moreover, certain genes, such as blaTEM, encode narrow-spectrum β-lactamases that do not confer an ESBL phenotype but may still contribute to antibiotic resistance. Thus, molecular screening provides complementary information and improves the detection of hidden resistance potential.
Molecular analysis identified sul2 and blaTEM as the most frequently detected genes in isolates from both cloacal and eggshell samples. Although detected at low frequency, the blaCTX-M gene followed a similar trend. Notably, genes such as tet(B) and aac(6′)-Ib-cr were detected exclusively in eggshell isolates from the Pedrês Portuguesa breed, suggesting a contamination source specifically associated with the eggshell environment.
This study provides novel insights into antimicrobial resistance in autochthonous chicken breeds, which are under-studied and poorly characterized in the literature. Some limitations should still be acknowledged. First, the relatively small number of isolates and farms included may limit the generalizability of the findings to broader poultry populations. Second, a selected set of antimicrobial resistance genes was screened, and other resistance determinants may exist that were not investigated, limiting the completeness of the molecular characterization. Third, sampling was conducted at a single time point, which may not capture temporal or seasonal variations in antimicrobial resistance. Fourth, only lactose-fermenting colonies were included, so atypical E. coli isolates with delayed or absent lactose fermentation may have been missed, potentially affecting the detection of some resistance phenotypes. Approximately 10% of E. coli strains may exhibit delayed or absent lactose fermentation, which could affect colony color interpretation on selective media [49,50]. Despite these limitations, the study fills an important gap in knowledge, providing baseline data on antimicrobial resistance in autochthonous breeds and supporting future research in other breeds and production systems.

5. Conclusions

This study represents the first assessment of AMR in E. coli isolates from autochthonous Portuguese laying hen breeds, addressing a critical knowledge gap, as previous investigations have predominantly focused on intensive production systems. The detection of resistant E. coli strains, even under low-input rearing conditions, indicates that AMR can persist in traditional systems, although the absence of resistance to critically important antimicrobials and the low prevalence of MDR are encouraging. These findings highlight the value of native breeds as models for understanding baseline AMR dynamics under reduced selective pressure and emphasize the importance of continued surveillance.
Beyond their microbiological relevance, Portuguese autochthonous chicken breeds represent an important genetic, cultural, and socio-economic heritage, deeply embedded in traditional farming systems and rural livelihoods. Many of these breeds are currently at risk of extinction due to population decline and genetic erosion, making their conservation a priority not only for biodiversity preservation but also for the sustainability of traditional agricultural systems. The present results demonstrate that conservation efforts should be aligned with AMR monitoring, as these populations provide unique insights into resistance ecology in low-intensity agroecosystems.
Overall, the study reinforces the importance of integrated strategies grounded in the One Health approach, recognizing the interconnectedness of human, animal, and environmental health. Understanding AMR dynamics in autochthonous poultry contributes to the development of informed mitigation strategies that support sustainable livestock production, protect public health, and promote the preservation of culturally significant and endangered poultry breeds.

Author Contributions

Conceptualization, N.V.B., S.Q. and C.M.; methodology–sample collection, V.R. and R.D.; methodology–laboratory analysis, R.J. and C.M.; data curation, S.Q. and C.M.; writing—original draft preparation, R.J., S.Q. and C.M.; review and editing manuscript, N.V.B., A.R.F., S.Q. and C.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the CESPU-Cooperativa de Ensino Superior Politécnico e Universitário, under the SALMYTH_GI2-CESPU_2022 project. We acknowledge FCT/MCTES for the national funds (UIDB/50006/2020 DOI 10.54499/UIDB/50006/2020, UIDP/50006/2020, UIDB/05937/2020, UIDP/05937/2020, UID/50027, UIDP/04378/2020, UIDB/04378/2020 and LA/P/0140/2020).

Institutional Review Board Statement

The study was approved by the Organization Responsible for the Animal Welfare of the University Institute of Health Sciences (ORBEA-IUCS), reference ORBEA/IUCS/CESPU/001/2022, approved on 25 November 2022. All procedures and methods were carried out in accordance with the guidelines approved by the Portuguese Veterinary Authority of the Ministry for Agriculture, Sea, Environment and Spatial Planning (Decree Law No. 113/2013 of 7 August 2013), which comply with the current European Communities Council Directive of September 2010 (2010/63/UE).

Informed Consent Statement

Informed consent was obtained from all farmers involved in the study.

Data Availability Statement

Data are contained within the article. The data will be made available upon request to the authors.

Acknowledgments

The authors acknowledge the CCP—Culture Collection of Porto, at the Faculty of Pharmacy, University of Porto (https://ccp.ff.up.pt/, accessed on 14 February 2023), for providing the control strains. We also acknowledge Hugo Lopes for their valuable technical assistance.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AMRAntimicrobial Resistance
FAOFood and Agriculture Organization of the United Nations
WHOWorld Health Organization
WOAHWorld Organization for Animal Health
UNEPUnited Nations Environment Programme
MDRMultidrug-resistant

References

  1. Almansour, A.M.; Alhadlaq, M.A.; Alzahrani, K.O.; Mukhtar, L.E.; Alharbi, A.L.; Alajel, S.M. The silent threat: Antimicrobial-resistant pathogens in food-producing animals and their impact on public health. Microorganisms 2023, 11, 2127. [Google Scholar] [CrossRef] [Scilit]
  2. Xuan, J.; Feng, W.; Wang, J.; Wang, R.; Zhang, B.; Bo, L. Antimicrobial peptides for combating drug-resistant bacterial infections. Drug Resist. Updates 2023, 68, 100954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. World Health Organization. Quadripartite Call to Action for One Health for a Safer World; World Health Organization: Geneva, Switzerland, 2023.
  4. Al-Eitan, L.; Sendyani, S.; Alnemri, M. Applications of the One Health concept: Current status in the Middle East. J. Biosaf. Biosecur. 2023, 5, 21–31. [Google Scholar] [CrossRef] [Scilit]
  5. Caneschi, A.; Bardhi, A.; Barbarossa, A.; Zaghini, A. The use of antibiotics and antimicrobial resistance in veterinary medicine, a complex phenomenon: A narrative review. Antibiotics 2023, 12, 487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Organization for Economic Co-operation and Development. Fighting Antimicrobial Resistance in EU and EEA Countries; Organization for Economic Co-operation and Development: Paris, France, 2023.
  7. Zhang, T.; Nickerson, R.; Zhang, W.; Peng, X.; Shang, Y.; Zhou, Y.; Luo, Q.; Wen, G.; Cheng, Z. The impacts of animal agriculture on One Health—Bacterial zoonosis, antimicrobial resistance, and beyond. One Health 2024, 18, 100748. [Google Scholar] [CrossRef] [Scilit]
  8. Ardakani, Z.; Aragrande, M.; Canali, M. Global antimicrobial use in livestock farming: An estimate for cattle, chickens, and pigs. Animal 2024, 18, 101060. [Google Scholar] [CrossRef] [Scilit]
  9. Schmerold, I.; van Geijlswijk, I.; Gehring, R. European regulations on the use of antibiotics in veterinary medicine. Eur. J. Pharm. Sci. 2023, 189, 106473. [Google Scholar] [CrossRef] [Scilit]
  10. European Centre for Disease Prevention and Control; European Food Safety Authority; European Medicines Agency. Antimicrobial consumption and resistance in bacteria from humans and food-producing animals. EFSA J. 2024, 22, e8589. [Google Scholar]
  11. Cheng, G.M.; Cheng, H. Overcoming China’s animal waste disposal challenge brought by elevated levels of veterinary antimicrobial residues and antimicrobial resistance. Environ. Int. 2024, 191, 109009. [Google Scholar] [CrossRef] [Scilit]
  12. Conway, T.; Cohen, P.S. Commensal and pathogenic Escherichia coli metabolism in the gut. In Metabolism and Bacterial Pathogenesis; John Wiley and Sons: Hoboken, NJ, USA, 2015; Volume 3, pp. 343–362. [Google Scholar]
  13. Mellata, M. Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog. Dis. 2013, 10, 916–932. [Google Scholar] [CrossRef] [Scilit]
  14. European Food Safety Authority. Antimicrobial Resistance Surveillance Report; European Food Safety Authority: Parma, Italy, 2025. [Google Scholar]
  15. Lambrecht, E.; Van Meervenne, E.; Boon, N.; Van de Wiele, T.; Wattiau, P.; Herman, L.; Heyndrickx, M.; Van Coillie, E. Characterization of cefotaxime- and ciprofloxacin-resistant commensal Escherichia coli originating from Belgian farm animals indicates high antibiotic resistance transfer rates. Microb. Drug Resist. 2018, 24, 707–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Saraiva, M.M.S.; Lim, K.; do Monte, D.F.M.; Givisiez, P.E.N.; Alves, L.B.R.; de Freitas Neto, O.C.; Kariuki, S.; Júnior, A.B.; de Oliveira, C.J.B.; Gebreyes, W.A. Antimicrobial resistance in the globalized food chain: A One Health perspective applied to the poultry industry. Braz. J. Microbiol. 2022, 53, 465–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Abo-Amer, A.E.; Shobrak, M.Y.; Altalhi, A.D. Isolation and antimicrobial resistance of Escherichia coli isolated from farm chickens in Taif, Saudi Arabia. J. Glob. Antimicrob. Resist. 2018, 15, 65–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Kovačević, Z.; Čabarkapa, I.; Šarić, L.; Pajić, M.; Tomanić, D.; Kokić, B.; Božić, D.D. Natural solutions to antimicrobial resistance: The role of essential oils in poultry meat preservation with focus on Gram-negative bacteria. Foods 2024, 13, 3905. [Google Scholar] [CrossRef] [Scilit]
  19. Aslam, B.; Khurshid, M.; Arshad, M.I.; Muzammil, S.; Rasool, M.; Yasmeen, N.; Shah, T.; Chaudhry, T.H.; Rasool, M.H.; Shahid, A.; et al. Antibiotic resistance: One Health One World outlook. Front. Cell. Infect. Microbiol. 2021, 11, 771510. [Google Scholar] [CrossRef] [Scilit]
  20. Ma, F.; Xu, S.; Tang, Z.; Li, Z.; Zhang, L. Use of antimicrobials in food animals and impact of transmission of antimicrobial resistance on humans. Biosaf. Health 2021, 3, 32–38. [Google Scholar] [CrossRef] [Scilit]
  21. Oliveira, J.M.; Cardoso, M.F.; Moreira, F.A.; Müller, A. Phenotypic antimicrobial resistance (AMR) of avian pathogenic Escherichia coli (APEC) from broiler breeder flocks between 2009 and 2018. Avian Pathol. 2022, 51, 388–394. [Google Scholar] [CrossRef] [Scilit]
  22. Costa, M.; Cardoso, M.; Cara d’Anjo, M.; Leite, A. Assessing antimicrobial resistance occurrence in the Portuguese food system: Poultry, pigs and derived food, 2014–2018. Zoonoses Public Health 2022, 69, 312–324. [Google Scholar] [CrossRef] [Scilit]
  23. Ribeiro, J.; Silva, V.; Monteiro, A.; Vieira-Pinto, M.; Igrejas, G.; Reis, F.S.; Barros, L.; Poeta, P. Antibiotic resistance among gastrointestinal bacteria in broilers: A review focused on Enterococcus spp. and Escherichia coli. Animals 2023, 13, 1362. [Google Scholar] [CrossRef] [Scilit]
  24. Direção-Geral de Alimentação e Veterinária. Catálogo Oficial de Raças Autóctones Portuguesas; Direção-Geral de Alimentação e Veterinária: Lisboa, Portugal, 2021. [Google Scholar]
  25. Dal Bosco, A.; Mattioli, S.; Cartoni Mancinelli, A.; Cotozzolo, E.; Castellini, C. Extensive rearing systems in poultry production: The right chicken for the right farming system. A review of twenty years of scientific research in Perugia University, Italy. Animals 2021, 11, 1281. [Google Scholar] [CrossRef] [Scilit]
  26. Sonaiya, E.B.; Swan, S.E.J. Small-Scale Poultry Production: Technical Guide; Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [Google Scholar]
  27. Brito, N.V.; Lopes, J.C.; Ribeiro, V.; Dantas, R.; Leite, J.V. Small scale egg production: The challenge of Portuguese autochthonous chicken breeds. Agriculture 2021, 11, 818. [Google Scholar] [CrossRef] [Scilit]
  28. Miranda, C.; Batista, S.; Mateus, T.L.; Pinto, V.M.; Ribeiro, V.; Dantas, R.; Brito, N.V. A preliminary investigation of Salmonella populations in indigenous Portuguese layer hen breeds. Animals 2023, 13, 3389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Godambe, L.P.; Bandekar, J.; Shashidhar, R. Species specific PCR-based detection of Escherichia coli from Indian foods. 3 Biotech 2017, 7, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters; Version 15.0; European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2025. [Google Scholar]
  31. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. In CLSI VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
  32. Steward, C.D.; Rasheed, J.K.; Hubert, S.K.; Biddle, J.W.; Raney, P.M.; Anderson, G.J.; Williams, P.P.; Brittain, K.L.; Oliver, A.; McGowan, J.E., Jr.; et al. Characterization of clinical isolates of Klebsiella pneumoniae from 19 laboratories using the National Committee for Clinical Laboratory Standards extended-spectrum beta-lactamase detection methods. J. Clin. Microbiol. 2001, 39, 2864–2872. [Google Scholar] [CrossRef] [Scilit]
  33. Lim, K.T.; Yasin, R.; Yeo, C.C.; Puthucheary, S.; Thong, K.L. Characterization of multidrug resistant ESBL-producing Escherichia coli isolates from hospitals in Malaysia. J. Biomed. Biotechnol. 2009, 2009, 165637. [Google Scholar] [CrossRef] [Scilit]
  34. Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Lariviere, S.; Harel, J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef] [Scilit]
  35. Guardabassi, L.; Dijkshoorn, L.; Collard, J.M.; Olsen, J.E.; Dalsgaard, A. Distribution and in vitro transfer of tetracycline resistance determinants in clinical and aquatic Acinetobacter strains. J. Med. Microbiol. 2000, 49, 929–936. [Google Scholar] [CrossRef] [Scilit]
  36. Fazel, F.; Jamshidi, A.; Khoramian, B. Phenotypic and genotypic study on antimicrobial resistance patterns of E. coli isolates from bovine mastitis. Microb. Pathog. 2019, 132, 355–361. [Google Scholar] [CrossRef] [Scilit]
  37. Sáenz, Y.; Briñas, L.; Domínguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef] [Scilit]
  38. Park, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of aac(6′)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob. Agents Chemother. 2006, 50, 3953–3955. [Google Scholar] [CrossRef] [Scilit]
  39. Amador, P.; Fernandes, R.; Prudêncio, C.; Duarte, I. Prevalence of antibiotic resistance genes in multidrug-resistant Enterobacteriaceae on Portuguese livestock manure. Antibiotics 2019, 8, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Pais, S.; Costa, M.; Barata, A.R.; Rodrigues, L.; Afonso, I.M.; Almeida, G. Evaluation of antimicrobial resistance of different phylogroups of Escherichia coli isolates from feces of breeding and laying hens. Antibiotics 2022, 12, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Al-Marri, T.; Al-Marri, A.; Al-Zanbaqi, R.; Ajmi, A.A.; Fayez, M. Multidrug resistance, biofilm formation, and virulence genes of Escherichia coli from backyard poultry farms. Vet. World 2021, 14, 2869–2877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Kamboh, A.A.; Shoaib, M.; Abro, S.H.; Khan, M.A.; Malhi, K.K.; Yu, S. Antimicrobial resistance in Enterobacteriaceae isolated from liver of commercial broilers and backyard chickens. J. Appl. Poult. Res. 2018, 27, 627–634. [Google Scholar] [CrossRef] [Scilit]
  43. Price, L.B.; Graham, J.P.; Lackey, L.G.; Roess, A.; Vailes, R.; Silbergeld, E. Elevated risk of carrying gentamicin-resistant Escherichia coli among U.S. poultry workers. Environ. Health Perspect. 2007, 115, 1738–1742. [Google Scholar] [CrossRef] [Scilit]
  44. Mendonça, N.; Figueiredo, R.; Mendes, C.; Card, R.M.; Anjum, M.F.; da Silva, G.J. Microarray evaluation of antimicrobial resistance and virulence of Escherichia coli isolates from Portuguese poultry. Antibiotics 2016, 5, 4. [Google Scholar] [CrossRef] [Scilit]
  45. Zhao, S.; Maurer, J.J.; Hubert, S.; De Villena, J.F.; McDermott, P.F.; Meng, J.; Ayers, S.; English, L.; White, D.G. Antimicrobial susceptibility and molecular characterization of avian pathogenic Escherichia coli isolates. Vet. Microbiol. 2005, 107, 215–224. [Google Scholar] [CrossRef] [Scilit]
  46. Bamidele, O.; Yakubu, A.; Joseph, E.B.; Amole, T.A. Antibiotic resistance of bacterial isolates from smallholder poultry droppings in the Guinea Savanna Zone of Nigeria. Antibiotics 2022, 11, 973. [Google Scholar] [CrossRef] [Scilit]
  47. Kasabova, S.; Hartmann, M.; Freise, F.; Hommerich, K.; Fischer, S.; Wilms-Schulze-Kump, A.; Rohn, K.; Käsbohrer, A.; Kreienbrock, L. Antibiotic usage pattern in broiler chicken flocks in Germany. Front. Vet. Sci. 2021, 8, 673809. [Google Scholar] [CrossRef] [Scilit]
  48. Gheyas, A.A.; Vallejo-Trujillo, A.; Kebede, A.; Lozano-Jaramillo, M.; Dessie, T.; Smith, J.; Hanotte, O. Integrated environmental and genomic analysis reveals the drivers of local adaptation in African indigenous chickens. Mol. Biol. Evol. 2021, 38, 4268–4285. [Google Scholar] [CrossRef] [Scilit]
  49. Markey, B.; Leonard, F.; Archambault, M.; Cullinane, A.; Maguire, D. Clinical Veterinary Microbiology, 2nd ed.; Mosby Ltd.: Edinburgh, UK, 2013. [Google Scholar]
  50. Mazumder, R.; Hussain, A.; Phelan, J.E.; Campino, S.; Haider, S.M.A.; Mahmud, A.; Ahmed, D.; Asadulghani, M.; Clark, T.G.; Mondal, D. Non-lactose fermenting Escherichia coli: Following in the footsteps of lactose fermenting E. coli high-risk clones. Front. Microbiol. 2022, 13, 1027494. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Autochthonous Portuguese laying hen breeds, including male and females: (a) Branca; (b) Pedrês Portuguesa; (c) Amarela; (d) Preta Lusitânica.
Figure 1. Autochthonous Portuguese laying hen breeds, including male and females: (a) Branca; (b) Pedrês Portuguesa; (c) Amarela; (d) Preta Lusitânica.
Pathogens 15 00163 g001
Figure 2. Antibiotic resistance of E. coli isolates from cloacal samples, expressed as percentages. Abbreviations: AMP, ampicillin; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; IMP, imipenem; AZT, aztreonam; CIP, ciprofloxacin; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Figure 2. Antibiotic resistance of E. coli isolates from cloacal samples, expressed as percentages. Abbreviations: AMP, ampicillin; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; IMP, imipenem; AZT, aztreonam; CIP, ciprofloxacin; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Pathogens 15 00163 g002
Figure 3. Antibiotic resistance profiles of E. coli isolates from eggshell samples, expressed as percentages. Abbreviations: AMP, ampicillin; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; IMP, imipenem; AZT, aztreonam; CIP, ciprofloxacin; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Figure 3. Antibiotic resistance profiles of E. coli isolates from eggshell samples, expressed as percentages. Abbreviations: AMP, ampicillin; AMC, amoxicillin/clavulanic acid; CTX, cefotaxime; IMP, imipenem; AZT, aztreonam; CIP, ciprofloxacin; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Pathogens 15 00163 g003
Figure 4. Phenotypic antibiotic resistance profiles of E. coli isolates from: (a) cloacal samples; (b) eggshell samples, presented as percentages. Abbreviations: Res ≥ 1, resistance to one or more antibiotics; MDR, multidrug-resistant phenotype.
Figure 4. Phenotypic antibiotic resistance profiles of E. coli isolates from: (a) cloacal samples; (b) eggshell samples, presented as percentages. Abbreviations: Res ≥ 1, resistance to one or more antibiotics; MDR, multidrug-resistant phenotype.
Pathogens 15 00163 g004
Figure 5. Percentage of antibiotic resistance genes detected in E. coli isolates (n = 20) obtained from cloacal samples.
Figure 5. Percentage of antibiotic resistance genes detected in E. coli isolates (n = 20) obtained from cloacal samples.
Pathogens 15 00163 g005
Figure 6. Percentage of antibiotic resistance genes detected in E. coli isolates obtained from eggshell samples: (a) screening of the resistance genes blaTEM, blaCTX-M, blaOXA-1, and blaSHV in 44 isolates; (b) screening of the tet(B), sul2, aac(6′)-Ib-cr, and aac(3′)-IV genes in 21 isolates selected as representative of different breeds and farms.
Figure 6. Percentage of antibiotic resistance genes detected in E. coli isolates obtained from eggshell samples: (a) screening of the resistance genes blaTEM, blaCTX-M, blaOXA-1, and blaSHV in 44 isolates; (b) screening of the tet(B), sul2, aac(6′)-Ib-cr, and aac(3′)-IV genes in 21 isolates selected as representative of different breeds and farms.
Pathogens 15 00163 g006
Table 2. Phenotypic and genotypic characteristics of E. coli isolates obtained from cloacal samples (n = 20).
Table 2. Phenotypic and genotypic characteristics of E. coli isolates obtained from cloacal samples (n = 20).
IsolateBreedAntibiotic Resistance Phenotype *Antibiotic Resistance Genotype
S37.F1Preta LusitânicaGNblaTEM, sul2
S41.F1Preta LusitânicaAMP, GNNegative
S65.F1Preta LusitânicaGNNegative
S69.F1Preta LusitânicaGNsul2, aac(3′)-IV
S72.F1Preta LusitânicaGNblaTEM, blaCTX-M, sul2
S25.F1AmarelaAMP, GN, TE, SXTsul2
S45.F1AmarelaGN, TENegative
S120.F2AmarelaAMC, GNblaTEM, sul2
S122.F1AmarelaAMP, GN, SXTblaTEM
S124.F2AmarelaGN, AKNegative
S9.F1Pedrês PortuguesaGN, TEblaTEM
S104.F1Pedrês PortuguesaGNNegative
S114.F1Pedrês PortuguesaGN, SXTblaTEM
S114.F2Pedrês PortuguesaGN, TEblaTEM, blaCTX-M, sul2
S116.F1Pedrês PortuguesaGN, TEblaTEM, sul2
S53.F3BrancaGN, TE, SXTsul2
S60.F1BrancaGN, AKNegative
S61.F1BrancaGN, TEsul2, aac(3′)-IV
S106.F1BrancaAMP, AMC, GN, TEblaTEM
S112.F1BrancaAMP, GN, TENegative
* AMP ampicillin; AMC, amoxicillin/clavulanic acid; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Table 3. Phenotypic and genotypic characteristics of E. coli isolates obtained from eggshell samples (n = 21).
Table 3. Phenotypic and genotypic characteristics of E. coli isolates obtained from eggshell samples (n = 21).
IsolateBreedAntibiotic Resistance Phenotype *Antibiotic Resistance Genotype
S66.02Preta LusitânicaGN, TENegative
S68.01Preta LusitânicaGNblaTEM, blaCTX-M, sul2
S69.03Preta LusitânicaAK, GNblaTEM, blaCTX-M, sul2
S96.01Preta LusitânicaAMP, GN, TEblaCTX-M
S96.02Preta LusitânicaAMP, AK, GN, TENegative
S117.01Preta LusitânicaGNNegative
S75.01AmarelaAMP, GN, TENegative
S119.01AmarelaGN, TEsul2
S120.02AmarelaAMP, GN, TENegative
S121.01AmarelaAMP, AMC, GN, TENegative
S124.01AmarelaAMP, AMC, GN, TENegative
S79.01Pedrês PortuguesaAMP, GNsul2
S113.01Pedrês PortuguesaGNblaTEM, sul2
S114.01Pedrês PortuguesaAMP, GN, TENegative
S115.01Pedrês PortuguesaGN, TEblaTEM, sul2, aac(6′)-Ib-cr
S116.04Pedrês PortuguesaAMP, TEtet(B)
S105.01BrancaGN, TEblaCTX-M
S107.01BrancaGNblaTEM, sul2
S109.01BrancaGN, TEblaTEM, sul2, aac(3′)-IV
S110.01BrancaGN, TE, STXsul2
S111.01BrancaGN, TEblaTEM, sul2
* AMP, ampicillin; AMC, amoxicillin/clavulanic acid; GN, gentamicin; AK, amikacin; TE, tetracycline; SXT, trimethoprim/sulfamethoxazole.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jesus, R.; Quinteira, S.; Ribeiro, V.; Dantas, R.; Freitas, A.R.; Brito, N.V.; Miranda, C. Silent Reservoirs: Antibiotic-Resistant Escherichia coli in Autochtonous Portuguese Laying Hens. Pathogens 2026, 15, 163. https://doi.org/10.3390/pathogens15020163

AMA Style

Jesus R, Quinteira S, Ribeiro V, Dantas R, Freitas AR, Brito NV, Miranda C. Silent Reservoirs: Antibiotic-Resistant Escherichia coli in Autochtonous Portuguese Laying Hens. Pathogens. 2026; 15(2):163. https://doi.org/10.3390/pathogens15020163

Chicago/Turabian Style

Jesus, Rita, Sandra Quinteira, Virgínia Ribeiro, Rui Dantas, Ana R. Freitas, Nuno V. Brito, and Carla Miranda. 2026. "Silent Reservoirs: Antibiotic-Resistant Escherichia coli in Autochtonous Portuguese Laying Hens" Pathogens 15, no. 2: 163. https://doi.org/10.3390/pathogens15020163

APA Style

Jesus, R., Quinteira, S., Ribeiro, V., Dantas, R., Freitas, A. R., Brito, N. V., & Miranda, C. (2026). Silent Reservoirs: Antibiotic-Resistant Escherichia coli in Autochtonous Portuguese Laying Hens. Pathogens, 15(2), 163. https://doi.org/10.3390/pathogens15020163

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop