Next Article in Journal
Autonomic Dysfunction in Patients with Acute Infection with Coxiella burnetii
Next Article in Special Issue
Molecular Detection of Bartonella henselae in Healthy Cats from Portugal (2015–2025): One Health Context and Implications for Transfusion Medicine
Previous Article in Journal
Successful Brachyspira hyodysenteriae Eradication Through a Combined Approach of a Zinc Chelate Treatment and Adapted Management Measures
Previous Article in Special Issue
Healing with Risks: How Zoonotic Potential Influences the Use of Wild Mammals in Traditional Medicine
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Babesia and Bartonella Species DNA in Blood and Enrichment Blood Cultures from People with Chronic Fatigue and Concurrent Neurological Symptoms

Intracellular Pathogens Research Laboratory, Comparative Medicine Institute, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27607, USA
*
Author to whom correspondence should be addressed.
Pathogens 2026, 15(1), 2; https://doi.org/10.3390/pathogens15010002
Submission received: 12 November 2025 / Revised: 11 December 2025 / Accepted: 17 December 2025 / Published: 19 December 2025
(This article belongs to the Special Issue Zoonotic Vector-Borne Infectious Diseases: The One Health Perspective)

Abstract

Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a medical condition characterized by extreme fatigue lasting at least 6 months. Based upon case reports, patients infected with Babesia or Bartonella spp. have reported a history of chronic fatigue and concurrent neurological symptoms. In this study, 50 study participants reporting fatigue lasting from six months to 19 years and one or more neurological symptoms were selected. PCR assays were used to amplify Babesia and Bartonella spp. DNA from blood and enrichment blood cultures. Using targeted qPCR amplification and DNA sequencing, infection with Babesia spp., Bartonella spp. or both genera was confirmed in 10, 11, and 2 individuals, respectively. Of 50 participants, 12 (24%, 95% CI: 12–36%) were infected with a Babesia species, while Bartonella species infection was documented in 13/50 individuals (26%, 95% CI: 13.8–38.2%). This study provides documentation supporting a potential role for Babesia and Bartonella infection in patients with presentations consistent with ME/CFS. Prospective case–control studies, using highly sensitive direct pathogen detection techniques, are needed to determine whether or the extent to which infection with members of these two genera contributes to or causes ME/CFS.

1. Introduction

In recent years, bloodborne Babesia and Bartonella species infections or coinfections have been identified in patients with chronic, and often nonspecific illnesses [1,2,3]. Historically, the predominant clinical emphases for both genera have focused primarily on acute illness presentations, such as hemolytic anemia and/or thrombocytopenia for Babesia species and acute febrile illness (i.e., Oroya fever, Trench fever, Cat Scratch Fever) for Bartonella species. Documentation of pathogen DNA in the blood or tissues of patients with chronic illness, who lack the typical findings associated with acute illness, continues to challenge and change the collective medical understanding of disease dynamics, pathogenesis, and epidemiology for babesiosis, bartonellosis and co-infections with both genera. In addition to the diagnostic sensitivity limitations associated with Babesia and Bartonella spp. molecular testing, the lack of therapeutic guidelines for chronically infected patients can create diagnostic and treatment dilemmas for physicians.
Importantly, the use of more sensitive molecular diagnostic testing modalities has confirmed infection with both genera in transplant recipients and healthy blood donors [4,5,6,7], further illustrating the potential for both genera to induce a longstanding intravascular infection, as well as the need for expanded blood donor screening. In the context of blood transfusion considerations, there are no current Bartonella screening recommendations for asymptomatic human blood donors and Babesia screening occurs on a limited regional basis [4,6].
Ongoing developmental and technical improvements have resulted in more sensitive molecular diagnostic techniques, as confirmatory methods to assess “active” infection with Babesia and Bartonella species. Documentation of pathogen DNA in patient specimens (blood, cerebrospinal fluid, joint fluid, and pathological effusions) is providing increased clarity to the healthcare community as to the contribution of these organisms to chronic, nonspecific symptoms among individual patients. Using a combination of microbiological culture and molecular DNA amplification approaches, infection with Babesia, Bartonella and coinfections with both genera have been confirmed in people suffering chronic and often nonspecific symptoms that include debilitating fatigue and neurological symptoms [1,2,3,8,9]. Due to their ability to induce chronic subclinical infections, accompanied by low and potentially intermittent parasitemia or bacteremia, molecular confirmation of infection with these protozoa and bacteria remains diagnostically challenging. In addition, as compared to single infections, co-infections with Babesia and Bartonella spp. influence antimicrobial drug selection and treatment planning for patients.
Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a medical condition characterized by extreme fatigue lasting at least 6 months. According to the World Health Organization, ME/CFS impacts approximately 17 million people worldwide [10]. The syndrome often includes post-exertional malaise with worsening symptoms after minimal exercise, as well as a wide range of other symptoms, most often including cognitive impairment and orthostatic intolerance. Currently, there is no international consensus for diagnostic criteria for ME/CFS. In the context of infectious causation, research to date has focused primarily on viruses; however, no consistent evidence has supported a viral etiology [11]. The purpose of this study was to determine the frequency of Babesia and Bartonella spp. DNA detection in a cohort of research participants with a history of fatigue lasting at least six months.

2. Patients and Methods

Study Population

Participants were selected from a cohort of 173 individuals who were previously tested for Bartonella spp. infection as a component of an Institutional Review Board (IRB) approved study entitled: Detection of Bartonella Species in the Blood of People with Extensive Animal Contact (North Carolina State University Institutional Review Board, IRB# 1960). Due to chronic illnesses of varying severity and duration, all participants or their physician had contacted the corresponding author requesting study entry. Individuals were included if they met two criteria: (1) based upon study questionnaire responses, they had experienced fatigue or chronic fatigue for a duration of at least six months and (2) they had reported (questionnaire checklist) one or more neurological symptoms, specifically including the following: difficulty remembering, disorientation, irritability, rage, aggression, difficulty sleeping, seizures, tremors, headache, mental confusion, hallucinations, and anxiety/panic attacks. Although the duration of illness varied among individuals, as did prior diagnostic evaluations and previous treatments, these factors were not criteria for study inclusion or exclusion. Questionnaires previously completed by study participants between February 2020 and March 2024 underwent a blinded sequential review to select individuals who satisfied entry criteria. The standardized questionnaire included age, gender, animal and arthropod exposure, outdoor activity, travel, clinical symptoms, duration of illness, co-morbid conditions and evaluation by specialist physicians.
Participants provided three blood specimens (triple blood draw) collected within a 7-day period, which were then cultured for 21 days, with sampling for DNA extraction at 7, 14, and 21 days. Stored blood and enrichment blood culture DNA from individuals satisfying the inclusion criteria were tested for DNA evidence of Babesia spp. infection. Molecular testing was performed using DNA extracted from blood and enrichment blood cultures. Of the 173 study participants tested between February 2020 and March 2024, 50 individuals met the inclusion criteria. The researcher (E. Kingston) reviewing the questionnaires for case selection based upon entry criteria and the individuals (R. Maggi and E. Kingston) performing the molecular testing were blinded to prior Bartonella or Babesia test results.
The enrichment blood culture and molecular testing methods for Bartonella spp. detection have been described previously. The methods used in this study for Babesia and Bartonella spp. DNA amplification and DNA sequencing were recently published [3,12] with minor modifications in primer/probe design as listed in Table 1. Briefly, DNA extracted from blood and enrichment blood cultures (sampled at 7, 14, and 21 days) were screened for Babesia species amplification using quantitative real-time PCR (qPCR) targeting the 18SrRNA-5.8SrRNA intergenic spacer (ITS) region (Figure 1).
Real-time qPCR amplification of the Babesia ITS1 region was performed in a 25 μL reaction composed (per reaction) of 7.5 μL of molecular-grade water (QIAGEN, Germantown, MD, USA), 12.5 μL of 2X SsoAdvanced SYBR green master mix (Bio Rad, Hercules, CA, USA), 0.2 μL of 100 μM each oligonucleotide primers, and 5 μL of extracted DNA (used as template). Molecular-grade water and DNA extracted from naïve human blood samples were used as PCR negative controls. Pre-characterized DNA amplified from blood samples extracted from clinical cases of dogs infected with Babesia gibsoni was used as a positive control template. This species was selected not just for assessing PCR performance, but also to assess potential contamination/carry-over of Babesia DNA among patient samples during DNA amplification. Amplification was performed in a Bio-Rad CFX 96-well Opus PCR system machine (Hercules, CA, USA) under the following conditions: 95 °C for 3 min, followed by 40 cycles of denaturing at 94 °C for 15 s, annealing at 68 °C for 15 s, and extension at 72 °C for 15 s. An additional gradient cycle from 65 °C to 95 °C was performed for melting curve analysis. Quantification cycle (Cq) values and melting temperature analysis were performed by reading fluorescent signals using the SYBR/FAM, HEX, Texas-Red/TAMRA, and Cy5 fluorescent dye channels. To avoid PCR amplicon contamination during sample processing, a one-way workflow was utilized, which included DNA extraction, PCR amplification and uninoculated culture controls. Negative controls remained negative throughout the study.
Inter-run variability was minimized by including amplification of a region of the HMBS reference housekeeping gene (as a sample DNA quality control), DNA extracted from a clinical case of B. gibsoni infection in a dog (as Babesia positive control DNA), naïve DNA from a human clinical case (as a negative control), and molecular-grade water (for reagent negative control) [8]. Cq values of HMBS gene amplification varied from mid 20-s to the high 30s when blood DNA and blood culture DNA were tested (resulting from a 1:10 dilution of blood to the enrichment blood culture media).
Amplified DNA products were purified and sequenced by Sanger’s method. Sequences were analyzed using Clustal W multi-sequence alignment (AlignX, Vector NTI Advanced 10.3.0 from Invitrogen) and compared to sequences previously deposited in the GenBank database using AlignX software (Vector NTI Suite 6.0, InforMax, Inc., Rockville, MD, USA). Samples with a qPCR Cq value lower than 40 were submitted for sequencing to confirm specific target amplification. Melt-curve assessment criteria included verification of a single, clean amplicon by visualizing a single, sharp peak in the derivative melt curve, and by confirming that the peak melting temperature was in the expected range for the product, i.e., 89.5–90.5 °C for B. odocoilei; 86.5 °C for B. divergens; 88.5 °C for B. microti; and 89 °C for B. duncani. As previously reported, Sanger sequencing (where primer sequences were excluded in the analysis) was performed, with continuous read length (between 476 bp and 567 bp depending on species detected) as well as chromatogram quality analysis to assess sequence quality and species identity [8]. 95% confidence intervals (95% CI) were calculated on the proportion of participants infected with Babesia spp., Bartonella spp., or both [13]. These were mathematically calculated using the following formula:
Standard Error (SE) = p 1 p n , where p = the proportion of infected participants out of the total number of participants in that cohort (n). The margin of error (MOE) was calculated using a z-score of 1.96 multiplied by the SE. The 95% CI was then determined as the proportion +/− MOE.

3. Results

After retrospective questionnaire review, 50 individuals satisfied the entry criteria. There were 14 males and 36 females, ranging in age from 21 to 70 years, with a median age of 44 years. Of the 50 participants, 49 were white (one identified as Asian).
Infection with Babesia, Bartonella, or Babesia and Bartonella co-infection was identified by DNA amplification in 23 of the 50 study participants (46%, 95% CI: 32–60%) (Figure 2).
Babesia and Bartonella DNA were not amplified from blood, serum or enrichment blood cultures from the remaining 27 (54%, 95% CI: 40–68%) individuals.
Study participants lived in six countries (Figure 3).
Demographics, illness duration and specialty physician visits for the cohort are summarized in Table 2. Infection with Babesia and Bartonella was documented most often in individuals from the southeastern and midwestern United States. Infection with Babesia, Bartonella or both genera was documented in individuals reporting fatigue from six months to longer than 10 years. Regardless of Babesia or Bartonella status (PCR+ or PCR−), nearly all individuals in the cohort had been evaluated by multiple medical specialists.
Study participants reported a broad spectrum of neurological symptoms. Difficulty remembering, headaches, insomnia, anxiety and irritability were the most frequently reported neurological symptoms among participants who were infected with either Babesia, Bartonella, or both species, or tested PCR-negative for Babesia and Bartonella DNA (Table 3).
Environmental exposures are summarized in Table 4. Nearly all individuals reported bites or scratches from animals, most often cats and dogs. Exposure to insects and arthropods was substantial regardless of PCR status. In the context of outdoor exposures, hiking was reported most often by individuals infected with Babesia species.

Molecular Testing Results

Controls: Babesia gibsoni DNA, used as a positive Babesia amplification control, was not detected in any of the 586 blood or enrichment blood culture DNA extraction samples tested during the study. Similarly, Babesia and Bartonella DNA were not amplified from any DNA extraction or blood culture negative control sample processed concurrently with each participant’s blood and enrichment blood culture samples.
DNA Sequence/probe confirmation: Using Api18S rRNA-1690s and Api5.8S rRNA-20as (as forward and reverse primers), qPCR DNA amplification of the Babesia ITS1 region generated a single 450–650 bp band consistent with the expected DNA sizes (depending on species) for each of the three identified Babesia species. Similarly, using species-specific primers and probes, qPCR DNA amplification of the Babesia species-specific ITS1 region generated a single 150–225 bp band consistent with the expected DNA sizes (depending on species) for each of the three Babesia species (Table 5). Amplicon DNA sequence analysis of qPCR products or probe-based species-specific qPCR targeting the Babesia ITS1 region [8] confirmed infection with Babesia microti in four individuals (33%, 95% CI: 6–60%), Babesia divergens-like MO-1 in three individuals (25%, 95% CI: 0.5–49.5%), Babesia odocoilei in two individuals (17%, 95% CI: −4–38%), and co-infection with B. microti and B. odocoilei in two individuals (17%, 95% CI: −4–38%). The Babesia species (participant 40) could not be accurately determined due to a short, yet good-quality ITS1 DNA sequence that was a 70% match with B. odocoilei. (Table 5).
When targeting Piroplasma 18S rRNA (12 DNA extractions/participant), using the same primers and probes, 8 of the 50 individuals were positive by dPCR (16%, 95% CI: 6–26%) and 4 were positive by qPCR (8%, 95% CI: 0.5–15.5%). By targeting the Piroplasma ITS region, 18 of the 50 individuals were positive by qPCR (32%, 95% CI: 19–45%). The DNA sequence identity confirmed Babesia infection for 12 of the 18 individuals. For the six remaining ITS1-positive individuals, the sequences did not pass quality control for accurate species identification (even when the same samples were qPCR-positive during repeated testing). All eight of the 18S rRNA dPCR-positive individuals were ITS1 qPCR-positive, from which the infecting species was confirmed in five (63%, 95% CI: 30–96%) individuals by DNA sequencing.
Of the 13 individuals infected with a Bartonella sp., B. henselae DNA was amplified from blood or enrichment blood cultures from nine individuals, B. quintana, B. koehlerae and an undetermined Bartonella spp. in one individual each, and co-infection with B. henselae and B. quintana in one individual. DNA sequence similarities were generated by targeting the Bartonella 16S–23S intergenic spacer region (Table 6). Two participants were co-infected with a Bartonella and Babesia spp.; one participant was co-infected with B. quintana, B. henselae and B. odocoilei, while the other individual was co-infected with B. henselae, B. odocoilei, and B. microti.
For both genera, enrichment blood culture increased PCR detection sensitivity. Babesia microti and B. divergens detection occurred most often following enrichment blood culture, whereas B. odocoilei DNA was only amplified from blood (Table 7). Despite the use of species-specific primers, B. duncani DNA was not amplified from blood or enrichment blood cultures from any of the 50 individuals included in this study.
Bartonella henselae and Bartonella quintana DNA were variably amplified from blood or enrichment blood cultures incubated for 7, 14, and 21 days, while B. koehlerae and the uncharacterized Bartonella DNA were only amplified from blood (Table 8).

4. Discussion

4.1. Symptomatology and Pathogen Framework

The rationale for this cohort study was to determine the frequency of infection with Babesia spp., Bartonella spp. or both genera in sick individuals reporting fatigue for at least six months’ duration. The duration of illness in this cohort ranged from 6 months to longer than 10 years. Fatigue is a common symptom, which is associated with many illnesses, both infectious and noninfectious in etiology. When fatigue becomes chronic in nature and the disease etiology cannot be determined, diagnostic evaluations become extensive, medical management becomes challenging, and patients suffer from an inability to perform daily functions. Despite decades of research, an infectious cause of ME/CFS has not been definitively determined [10,11]. The authors are not aware of studies that address a potential role for chronic bloodborne bacteria (Bartonella spp.) or protozoa (Babesia spp.) species as a cause or cofactor in fatigue, consistent in duration with ME/CFS. It is likely that ME/CFS has numerous etiologies, perhaps including polymicrobial infections consisting of bacteria, protozoa, viruses and other pathogenic organisms.
Among participants, 23/50 (46%, 95% CI: 32–60%) individuals were infected. Using targeted qPCR amplification and DNA sequencing, infection with Babesia spp., Bartonella spp. or both genera was confirmed in 10, 11, and 2 individuals reporting chronic fatigue, respectively. This small cohort study suggests that persistent infection or co-infections with these genera may represent a cause of sustained fatigue and neurological abnormalities. As previously reported, anxiety and irritability were reported more often in this study by individuals infected with a Bartonella species [14].
Human babesiosis, a disease caused by a parasitic intraerythrocytic infection of red blood cells, is an emerging, zoonotic, tickborne disease of increased prevalence in the United States and throughout much of the world [15,16,17,18,19]. The infection is caused by members of the genus Babesia of the order Piroplasmida (Apicomplexa phylum), a genus comprising over 100 species, of which at least 8 species or sub-species have infected people on the basis of DNA sequence evidence [8]. Acute human babesiosis is predominantly characterized by fatigue, fever, sweating, chills, generalized myalgia, sleep disorders, and hepatosplenomegaly. Severe symptoms such as hemolytic anemia and neurological complications (including headache, syncope, neuropathy, confusion, vertigo, and coma) have been reported, most frequently in patients with comorbidities such as immunodeficiencies (splenectomy, infection with HIV/AIDS, or patients receiving immunosuppressive drugs), diabetes, cancer, chronic heart, lung, kidney, or liver diseases [20,21,22,23]. The tick-transmitted Babesia species documented by DNA sequencing in this study occurred in individuals from the United States and Mexico, known geographic regions for human infection with these organisms.
Neurobartonelloses represent a broad spectrum of neurological diseases caused by infection with a Bartonella species [24]. Historically, various neurological presentations have most often been reported as atypical manifestations of Cat Scratch Disease (CSD), caused by B. henselae. Fatigue and chronic neurological symptoms have been reported in people who lack a history of fever, lymphadenopathy, and cat contact (CSD) [25,26,27]. Seizures, encephalitis, transverse myelitis, peripheral neuropathy (Guillain–Barré syndrome), psychoses and schizophrenia have been associated with Bartonella infections. Like infection with Babesia species, healthy individuals and blood donors can be occultly infected, which complicates the medical assessment of the role or importance of these infections when confirmed in individual patients. Also, like babesiosis, bartonellosis, first recognized in North America among immunocompromised HIV-infected individuals with bacillary angiomatosis, has been diagnosed in patients in association with splenectomy, organ transplantation recipients and patients receiving immunosuppressive drugs [28]. Immunosuppression likely decreases the suppression of these intracellular organisms, resulting in enhanced PCR detection in blood. Based upon survey questionnaire responses, no individual infected with Babesia, Bartonella or both genera in this study reported infection with AIDS, having had a splenectomy, or a concurrent diagnosis of diabetes or active cancer. The Bartonella species sequenced from participants in this study are transmitted by several arthropod vectors [28]. Specifically, B. henselae and B. koehlerae are transmitted by fleas (Ctenocephalides felis), which have a worldwide distribution. Infection with B. quintana, transmitted primarily by the human body louse, has been reported from Central America, France and North America [28].

4.2. Diagnostic Considerations in Pathogen Detection

As previously reported, limitations in diagnostic sensitivity for the detection of Babesia and Bartonella DNA are a major consideration when assessing blood infection and enrichment blood culture testing [1,12,29]. While B. odocoilei was detected only following blood DNA extraction, infection with B. divergens-like MO-1 and B. microti were most often confirmed after blood enrichment culture for 7 to 21 days (Table 7). Presumably, these two Babesia species remained viable and multiplied during liquid enrichment culture incubation. Based upon a 10-fold dilution of blood into liquid culture medium, the original blood DNA extraction would have been 10× more concentrated when compared with DNA extractions from the liquid cultures. Although amplification of trace DNA in cultures cannot be ruled out, recent publications reporting in vitro culture of Babesia organisms support the possibility of intraerythrocytic proliferation, an area requiring additional study [30,31,32]. Based upon the blinded case selection and predetermined study design, 4 of the 12 Babesia-infected individuals in this study had been included from two prior publications [1,3]. Repeat blinded testing redocumented infection with B. odocoilei in two of three previously diagnosed individuals and B. divergens-like MO-1 in one individual. Co-infection with B. microti, not amplified from two previously reported B. odocoilei-infected individuals, provided additional evidence for co-infection with more than one Babesia species and further illustrates challenges with molecular detection of co-infections with these protozoal organisms [3].
Similarly, while B. koehlerae was detected in the blood of a single individual, most Bartonella infection was confirmed after enrichment blood culture for 7 to 21 days, as previously reported [33].
DNA amplification, using various molecular methods, has become the preferred methodology for the diagnosis of babesiosis and bartonellosis. In contrast to serology, PCR provides direct evidence of infection [3,8]. Previous studies have documented increased sensitivity for the diagnosis of bartonellosis when enrichment blood culture was combined with qPCR or dPCR testing and when three, rather than one, blood specimens were obtained within a 7-day period [1,12,33,34]. Three blood collections within a 7-day period were provided by individuals entering this research study. DNA extracted from blood, serum, and three 7-day, 14-day and 21-day enrichment blood cultures generated fifteen samples for qPCR and dPCR testing per study participant. Rarely were more than three or four of the fifteen DNA extractions from a patient PCR-positive. Due to enhanced sensitivity, dPCR positivity consistently exceeded qPCR positivity. The low parasitemia and bacteremia associated with these two genera impairs diagnostic sensitivity, thereby hindering acquisition of an accurate diagnosis. Among many others, two case reports illustrate the diagnostic complexity associated with these chronic intravascular infections. Infection with B. henselae, B. odocoilei, and B. divergens-like/MO-1 was documented in an 8-year-old boy from Canada by PCR amplification and sequencing of DNA extracted from blood and enrichment brain biopsy cultures [1]. Based upon molecular testing results, five family members (father, mother, two daughters and a son) and a pet dog were infected with B. divergens-like MO-1, both parents were infected with B. microti, and all family members, both pet dogs, and fleas from one pet rabbit were infected with Bartonella (B. quintana and/or B. henselae, or an undetermined Bartonella species) [2]. Although chronically ill, this cohort was heterogenous in the context of age, sex, geographic origin, symptomatology, overall duration of illness, prior medical evaluations, and therapeutic interventions. Testing in this study was limited to two genera. As Babesia species are transmitted to humans by ticks belonging to the Ixodes genus, future prospective studies of chronic fatigue syndrome patients should also consider infection with the Borrelia Lyme Group (generally not spirochetemic) and Borrelia miyamotoi, a spirochetemic member of the Hard Tick-Borne Relapsing Fever Group. Documentation of Babesia, Bartonella or DNA of both genera does not confirm causation for the fatigue or neurological symptoms that were self-reported. As the timing and mode of infection could not be determined, the duration of infection compared to the duration of illness is unknown.
In conclusion, despite its retrospective nature, this study documented infections with Babesia, Bartonella or both organisms in nearly half of a cohort reporting chronic fatigue and neurological abnormalities. Future case–control, multicenter studies are needed to determine whether Babesia and Bartonella species cause or are cofactors in patients diagnosed with ME/CFS. Ongoing improvements in molecular diagnostic documentation of individual or coinfections with these piroplasm and bacterial organisms will facilitate directed antimicrobial treatment, thereby potentially improving patient outcomes.

Author Contributions

E.B.B. drafted the manuscript. R.G.M. performed Bartonella and Babesia molecular testing, generated manuscript figures and tables, and confirmed results reported. J.C.B. generated manuscript tables, reviewed the manuscript, and helped finalize manuscript contents. E.K. selected participants based on inclusion and exclusion criteria, formatted tables and manuscript, and helped finalize manuscript contents. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the Steven & Alexandra Cohen Foundation (funding number 531459), 60 Degrees Pharmaceuticals (funding number 535955), and donations provided to the Intracellular Pathogens Research Laboratory via private donors (funding number 681856). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

This study was conducted in accordance with the Declaration of Helsinki and approved by the Institutional Review Board of North Carolina State University (protocol code IRB# 1960, approval on 19 September 2024, “Detection of Bartonella Species in the Blood of People with Extensive Animal Contact”).

Informed Consent Statement

Informed consent has been obtained from each of the participants to conduct this research and publish this paper.

Data Availability Statement

The data presented in this study is available on request from the corresponding author. This data is restricted due to human health data privacy concerns.

Acknowledgments

bioRENDER, Confirmation of Publication and Licensing Rights—Open Access 10 December 2025 Subscription Agreement numbers: PM293LU6XU and FA293RAA7M Pathogens, Figure 1 and Figure 3, respectively.

Conflicts of Interest

Edward Breitschwerdt is a co-founder, shareholder and Chief Scientific Officer for Galaxy Diagnostics. He received a one-time honorarium to participate in a Key Opinion Leader discussion of canine and human babesiosis. Ricardo Maggi is a co-founder and the Chief Technical Officer for Galaxy Diagnostics Inc. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Breitschwerdt, E.B.; Maggi, R.G.; Robveille, C.; Kingston, E. Bartonella henselae, Babesia odocoilei and Babesia divergens-like MO-1 infection in the brain of a child with seizures, mycotoxin exposure and suspected Rasmussen’s encephalitis. J. Cent. Nerv. Syst. Dis. 2025, 17, 11795735251322456. [Google Scholar] [CrossRef] [Scilit]
  2. Breitschwerdt, E.B.; Maggi, R.G.; Moore, C.O.; Robveille, C.; Greenberg, R.; Kingston, E. A One Health Zoonotic Vector Borne Infectious Disease Family Outbreak Investigation. Pathogens 2025, 14, 110. [Google Scholar] [CrossRef] [Scilit]
  3. Maggi, R.G.; Calchi, A.C.; Moore, C.O.; Kingston, E.; Breitschwerdt, E.B. Human Babesia odocoilei and Bartonella spp. co-infections in the Americas. Parasites Vectors 2024, 17, 302. [Google Scholar] [CrossRef] [Scilit]
  4. Moritz, E.D.; Winton, C.S.; Johnson, S.T.; Krysztof, D.E.; Townsend, R.L.; Foster, G.A.; Devine, P.; Molloy, P.; Brissette, E.; Berardi, V.P.; et al. Investigational screening for Babesia microti in a large repository of blood donor samples from nonendemic and endemic areas of the United States. Transfusion 2014, 54, 2226–2236. [Google Scholar] [CrossRef] [Scilit]
  5. Magalhaes, R.F.; Cintra, M.L.; Barjas-Castro, M.L.; Del Negro, G.M.; Okay, T.S.; Velho, P.E. Blood donor infected with Bartonella henselae. Transfus. Med. 2010, 20, 280–282. [Google Scholar] [CrossRef] [Scilit]
  6. Johnson, S.T.; Van Tassell, E.R.; Tonnetti, L.; Cable, R.G.; Berardi, V.P.; Leiby, D.A. Babesia microti real-time polymerase chain reaction testing of Connecticut blood donors: Potential implications for screening algorithms. Transfusion 2013, 53, 2644–2649. [Google Scholar] [CrossRef] [Scilit]
  7. Pitassi, L.H.; de Paiva Diniz, P.P.; Scorpio, D.G.; Drummond, M.R.; Lania, B.G.; Barjas-Castro, M.L.; Gilioli, R.; Colombo, S.; Sowy, S.; Breitschwerdt, E.B.; et al. Bartonella spp. bacteremia in blood donors from Campinas, Brazil. PLoS Neglected Trop. Dis. 2015, 9, e0003467. [Google Scholar] [CrossRef] [Scilit]
  8. Calchi, A.C.; Moore, C.O.; Bartone, L.; Kingston, E.; André, M.R.; Breitschwerdt, E.B.; Maggi, R.G. Development of Multiplex Assays for the Identification of Zoonotic Babesia Species. Pathogens 2024, 13, 1094. [Google Scholar] [CrossRef] [Scilit]
  9. Scott, J.D.; Sajid, M.S.; Pascoe, E.L.; Foley, J.E. Detection of Babesia odocoilei in Humans with Babesiosis Symptoms. Diagnostics 2021, 11, 947. [Google Scholar] [CrossRef] [Scilit]
  10. Todhunter-Brown, A.; Campbell, P.; Broderick, C.; Cowie, J.; Davis, B.; Fenton, C.; Markham, S.; Sellers, C.; Thomson, K. Recent research in myalgic encephalomyelitis/chronic fatigue syndrome: An evidence map. Health Technol. Assess. 2025, 1–78. [Google Scholar] [CrossRef] [Scilit]
  11. Sapra, A.; Bhandari, P. Chronic Fatigue Syndrome. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2025. [Google Scholar]
  12. Portillo, A.; Maggi, R.; Oteo, J.A.; Bradley, J.; Garcia-Alvarez, L.; San-Martin, M.; Roura, X.; Breitschwerdt, E. Bartonella spp. Prevalence (Serology, Culture, and PCR) in Sanitary Workers in La Rioja Spain. Pathogens 2020, 9, 189. [Google Scholar] [CrossRef] [Scilit]
  13. Hazra, A. Using the confidence interval confidently. J. Thorac. Dis. 2017, 9, 4125–4130. [Google Scholar] [CrossRef] [Scilit]
  14. Lantos, P.M.; Maggi, R.G.; Ferguson, B.; Varkey, J.; Park, L.P.; Breitschwerdt, E.B.; Woods, C.W. Detection of Bartonella species in the blood of veterinarians and veterinary technicians: A newly recognized occupational hazard? Vector Borne Zoonotic Dis. 2014, 14, 563–570. [Google Scholar] [CrossRef] [Scilit]
  15. Schnittger, L.; Rodriguez, A.E.; Florin-Christensen, M.; Morrison, D.A. Babesia: A world emerging. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2012, 12, 1788–1809. [Google Scholar] [CrossRef] [Scilit]
  16. Jia, N.; Zheng, Y.C.; Jiang, J.F.; Jiang, R.R.; Jiang, B.G.; Wei, R.; Liu, H.B.; Huo, Q.B.; Sun, Y.; Chu, Y.L.; et al. Human Babesiosis Caused by a Babesia crassa-Like Pathogen: A Case Series. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 2018, 67, 1110–1119. [Google Scholar] [CrossRef] [Scilit]
  17. Doderer-Lang, C.; Filisetti, D.; Badin, J.; Delale, C.; Clavier, V.; Brunet, J.; Gommenginger, C.; Abou-Bacar, A.; Pfaff, A.W. Babesia crassa-Like Human Infection Indicating Need for Adapted PCR Diagnosis of Babesiosis, France. Emerg. Infect. Dis. 2022, 28, 449–452. [Google Scholar] [CrossRef] [Scilit]
  18. Jahfari, S.; Hofhuis, A.; Fonville, M.; van der Giessen, J.; van Pelt, W.; Sprong, H. Molecular Detection of Tick-Borne Pathogens in Humans with Tick Bites and Erythema Migrans, in the Netherlands. PLoS Neglected Trop. Dis. 2016, 10, e0005042. [Google Scholar] [CrossRef] [Scilit]
  19. Ssentongo, P.; Venugopal, N.; Zhang, Y.; Chinchilli, V.M.; Ba, D.M. Beyond Human Babesiosis: Prevalence and Association of Babesia Coinfection with Mortality in the United States, 2015–2022: A Retrospective Cohort Study. Open Forum Infect. Dis. 2024, 11, ofae504. [Google Scholar] [CrossRef] [Scilit]
  20. Locke, S.; O’Bryan, J.; Zubair, A.S.; Rethana, M.; Moffarah, A.S.; Krause, P.J.; Farhadian, S.F. Neurologic Complications of Babesiosis, United States, 2011–2021. Emerg. Infect. Dis. 2023, 29, 1127–1135. [Google Scholar] [CrossRef] [Scilit]
  21. Garcia, H.H.; Tanowitz, H.B.; Brutto, O.H.d. Neuroparasitology and Tropical Neurology; Elsevier: Edinburgh, UK; Philadelphia, PA, USA, 2013. [Google Scholar]
  22. Aikawa, M.; Pongponratn, E.; Tegoshi, T.; Nakamura, K.; Nagatake, T.; Cochrane, A.; Ozaki, L.S. A study on the pathogenesis of human cerebral malaria and cerebral babesiosis. Mem. Inst. Oswaldo Cruz 1992, 87, 297–301. [Google Scholar] [CrossRef] [Scilit]
  23. Usmani-Brown, S.; Halperin, J.J.; Krause, P.J. Neurological manifestations of human babesiosis. Handb. Clin. Neurol. 2013, 114, 199–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Bush, J.C.; Robveille, C.; Maggi, R.G.; Breitschwerdt, E.B. Neurobartonelloses: Emerging from obscurity! Parasites Vectors 2024, 17, 416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Guirguis, V.; Pupillo, F.; Rodrigues, S.; Walker, N.; Roth, H.; Liedig, C.E.; Maggi, R.G.; Breitschwerdt, E.B.; Frohlich, F. Bartonella spp. infection in people with Mild Cognitive Impairment: A pilot study. PLoS ONE 2024, 19, e0307060. [Google Scholar] [CrossRef] [Scilit]
  26. Delaney, S.; Robveille, C.; Maggi, R.G.; Lashnits, E.; Kingston, E.; Liedig, C.; Murray, L.; Fallon, B.A.; Breitschwerdt, E.B. Bartonella species bacteremia in association with adult psychosis. Front. Psychiatry 2024, 15, 1388442. [Google Scholar] [CrossRef] [Scilit]
  27. Lashnits, E.; Maggi, R.; Jarskog, F.; Bradley, J.; Breitschwerdt, E.; Frohlich, F. Schizophrenia and Bartonella spp. Infection: A Pilot Case-Control Study. Vector Borne Zoonotic Dis. 2021, 21, 413–421. [Google Scholar] [CrossRef] [Scilit]
  28. Cheslock, M.A.; Embers, M.E. Human Bartonellosis: An Underappreciated Public Health Problem? Trop. Med. Infect. Dis. 2019, 4, 69. [Google Scholar] [CrossRef] [Scilit]
  29. Liedig, C.; Neupane, P.; Lashnits, E.; Breitschwerdt, E.B.; Maggi, R.G. Blood Supplementation Enhances Bartonella henselae Growth and Molecular Detection of Bacterial DNA in Liquid Culture. Microbiol. Spectr. 2023, 11, e0512622. [Google Scholar] [CrossRef] [Scilit]
  30. Kukina, I.V.; Zelya, O.P. Extraordinary high level of propagation of Babesia divergens in severe human babesiosis. Parasitology 2022, 149, 1160–1163. [Google Scholar] [CrossRef] [Scilit]
  31. Kumari, V.; Pal, A.C.; Singh, P.; Mamoun, C.B. Babesia duncani in Culture and in Mouse (ICIM) Model for the Advancement of Babesia Biology, Pathogenesis and Therapy. Bio Protoc. 2022, 12, e4549. [Google Scholar] [CrossRef] [Scilit]
  32. Fuller, L. Continuous in vitro propagation of Babesia microti. Infect. Immun. 2024, 92, e0048123. [Google Scholar] [CrossRef] [Scilit]
  33. Maggi, R.G.; Mozayeni, B.R.; Pultorak, E.L.; Hegarty, B.C.; Bradley, J.M.; Correa, M.; Breitschwerdt, E.B. Bartonella spp. bacteremia and rheumatic symptoms in patients from Lyme disease-endemic region. Emerg. Infect. Dis. 2012, 18, 783–791. [Google Scholar] [CrossRef] [Scilit]
  34. Maggi, R.G.; Richardson, T.; Breitschwerdt, E.B.; Miller, J.C. Development and validation of a droplet digital PCR assay for the detection and quantification of Bartonella species within human clinical samples. J. Microbiol. Methods 2020, 176, 106022. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Sample processing for Babesia and Bartonella species detection in blood and enrichment blood cultures. Study participants were subjected to three blood draws, typically on a Monday, Wednesday and Friday, within a one-week period. Blood from each draw was both directly sampled for DNA extraction and placed into enrichment culture, which was then subject to DNA extraction for Babesia and Bartonella qPCR and dPCR amplification after 7, 14, and 21 days in incubation at 35 °C with 5% CO2.
Figure 1. Sample processing for Babesia and Bartonella species detection in blood and enrichment blood cultures. Study participants were subjected to three blood draws, typically on a Monday, Wednesday and Friday, within a one-week period. Blood from each draw was both directly sampled for DNA extraction and placed into enrichment culture, which was then subject to DNA extraction for Babesia and Bartonella qPCR and dPCR amplification after 7, 14, and 21 days in incubation at 35 °C with 5% CO2.
Pathogens 15 00002 g001
Figure 2. Overview of Babesia and Bartonella infections by species. Panel (a) depicts the number of individuals infected with only a Babesia sp., a Bartonella sp., or coinfected with a combination of both pathogens. Panel (b) indicates the number of participants infected with different Babesia spp., including coinfections with two Babesia spp. One individual coinfected with Babesia microti and odocoilei was also infected with Bartonella henselae, and one individual with a single Babesia species infection, B. microti, was coinfected with two species of Bartonella, B. henselae and B. quintana (c). Panel (d) displays the breakdown of individuals infected with various Bartonella species, including the two individuals infected with multi-pathogen coinfections indicated in panel (c). The number of individuals in each group (n) is indicated beside each panel.
Figure 2. Overview of Babesia and Bartonella infections by species. Panel (a) depicts the number of individuals infected with only a Babesia sp., a Bartonella sp., or coinfected with a combination of both pathogens. Panel (b) indicates the number of participants infected with different Babesia spp., including coinfections with two Babesia spp. One individual coinfected with Babesia microti and odocoilei was also infected with Bartonella henselae, and one individual with a single Babesia species infection, B. microti, was coinfected with two species of Bartonella, B. henselae and B. quintana (c). Panel (d) displays the breakdown of individuals infected with various Bartonella species, including the two individuals infected with multi-pathogen coinfections indicated in panel (c). The number of individuals in each group (n) is indicated beside each panel.
Pathogens 15 00002 g002
Figure 3. Map depicting the residency location and Babesia or Bartonella species detected in 23 study participants reporting chronic fatigue and neurological symptoms. Colors of states and/or countries signify the number of participants per area: purple = 9, orange = 4, yellow = 2, and blue = 1.
Figure 3. Map depicting the residency location and Babesia or Bartonella species detected in 23 study participants reporting chronic fatigue and neurological symptoms. Colors of states and/or countries signify the number of participants per area: purple = 9, orange = 4, yellow = 2, and blue = 1.
Pathogens 15 00002 g003
Table 1. Primers and probes used for the amplification and identification of B. divergens, B. duncani, B. microti, and B. odocoilei 18SrRNA-5.8SrRNA intergenic spacer region in this study.
Table 1. Primers and probes used for the amplification and identification of B. divergens, B. duncani, B. microti, and B. odocoilei 18SrRNA-5.8SrRNA intergenic spacer region in this study.
Babesia ITS1 Target Primers/Probe
Designation
DNA Sequences
Babesia genus ITS1 region (550–650 bp)Api18S rRNA-1690s 5′ CTCCTACCGATCGAGTGATCCGGT 3′
Api5.8S rRNA-20as 5′ GCTGCGTCCTTCATCGTTGTGTGAG 3′
B. divergens ITS1 region (225 bp)Bdivergens ITS1-25s5′ CTCGGCTTCGACATTTACGTTGTGTAAGCT 3′
Bdivergens ITS1-150as5′ CAACTACAGTAGTTACACCGYAGTAARCATAC 3′
Probe Bdivergens ITS1-705′ HEX CTTTTKGTGGTTTCGTATTTGYCGTTG BHQ2 3′
B. duncani ITS1 region (170 bp)Bduncani ITS1-1s5′ GTGTTTAAACCGCGCTTATGCGCAGGTC 3′
Bduncani ITS1-130as5′ CTGCACTGGCGGGGTGAAAAGTAAC 3′
Probe Bduncani ITS1-805′ Cy5-TGGCTTTGCGGTTCGCCGTACGGCCCC-BHQ3 3′
B. microti TS1 region (185 bp)Bmicroti ITS1-25s5′ TATCAGAGTTCTTTGTATCCCATTTGGGTTA 3′
Bmicroti ITS1-160as5′ GAAAATACCTTGGGAGTGAGAACGCCCCGT 3′
Probe Bmicroti ITS1-705′ CalFluoRed590-AGAAGAGTGGCCTTGGACGTAG-BHQ2 3′
B. odocoilei ITS1 region (150 bp)Bodoco ITS1-100s5′ CTGTTGCACTTTTGTGCTTGACGTTGT 3′
Bodoco ITS1-255as5′ CAAGCGCAGGGATGGAAACGGA 3′
Probe Bodoco ITS1-2005′ FAM-GGCCTCGTCATGGCGACGTGGT-BHQ1 3′
bp = expected base pair amplicon size.
Table 2. Demographic, illness duration, and physician information reported by participants (n = 50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR-negative for Babesia and Bartonella DNA.
Table 2. Demographic, illness duration, and physician information reported by participants (n = 50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR-negative for Babesia and Bartonella DNA.
CharacteristicOverall Study Population No. (%) Babesia ONLY PCR Positive No. (%) Bartonella PCR ONLY Positive No. (%) Co-Infection No. (%) Negative PCR No. (%)
Total50 (100)10 (20)11 (22)2 (4)27 (54)
SexF36 (72)8 (80)7 (64)2 (100)19 (70)
M14 (28)2 (20)4 (36)0 (0)8 (30)
Region of ResidenceNE USA7 (14)0 (0)0 (0)0 (0)7 (26)
SE USA15 (30)3 (30)4 (36)1 (50)7 (26)
MW USA11 (22)6 (60)1 (9)0 (0)4 (15)
SW USA3 (6)0 (0)1 (9)0 (0)2 (7)
W USA8 (16)1 (10)2 (18)0 (0)5 (19)
Other countries6 (12)0 (0)3 (27)1 (50)2 (7)
Duration of Illness≥6 months20 (40)4 (40)5 (45)0 (0)11 (41)
≥5 Years13 (26)2 (20)3 (27)1 (50)7 (26)
≥10 Years17 (34)4 (40)3 (27)1 (50)9 (33)
Specialty Physician VisitsY42 (84)5 (50)10 (91)2 (100)25 (93)
N8 (16)5 (50)1 (9)0 (0)2 (7)
TypeID22 (44)2 (20)5 (45)0 (0)15 (56)
GI25 (50)3 (30)7 (64)0 (0)15 (56)
RH22 (44)1 (10)6 (54)0 (0)15 (56)
NE33 (66)4 (40)9 (82)2 (100)18 (67)
HE6 (12)1 (10)1 (9)0 (0)4 (15)
ID = infectious disease; GI = gastroenterologist; RH = rheumatologist; NE = neurologist; HE = hematologist.
Table 3. The five most frequent neurological symptoms reported by participants (n = 50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR-negative for Babesia and Bartonella DNA.
Table 3. The five most frequent neurological symptoms reported by participants (n = 50) who were infected with either Babesia, Bartonella, Babesia and Bartonella, or tested PCR-negative for Babesia and Bartonella DNA.
Total DNA Positive and Negative ParticipantsDifficulty Remembering HeadacheInsomniaAnxietyIrritability
Babesia (n = 10)85633
Bartonella (n = 11)1010899
Babesia and Bartonella (n = 2)22111
Test Negative (n = 27)1719181415
Table 4. Environmental exposure information reported by participants (n = 50) who were infected with either Babesia, Bartonella, or both, or tested PCR-negative for Babesia and Bartonella DNA.
Table 4. Environmental exposure information reported by participants (n = 50) who were infected with either Babesia, Bartonella, or both, or tested PCR-negative for Babesia and Bartonella DNA.
CharacteristicOverall Study Population No. (%) Babesia ONLY PCR Positive No. (%) Bartonella PCR ONLY Positive No. (%) Co-Infection No. (%) Negative PCR No. (%)
Animal ContactY47 (94)10 (100)11 (100)2 (100)24 (89)
N3 (6)0 (0)0 (0)0 (0)3 (11)
Animal bites/scratchesY39 (78) 9 (90)8 (73)2 (100)20 (74)
N11 (22)1 (10)3 (27)0 (0)7 (26)
TypeDog31 (62)8 (80)5 (45)2 (100)16 (59)
Cat34 (68)8 (80)7 (64)2 (100)17 (63)
Bird12 (24)4 (40)2 (18)2 (100)4 (15)
Horse6 (12)2 (20)0 (0)1 (50)3 (11)
Rodent17 (34)5 (50)2 (18)1 (50)9 (33)
Insect exposureMosquitos47 (94)10 (100)10 (91)2 (100)26 (96)
Tick41 (82)9 (90)9 (82)1 (50)22 (81)
Flea39 (78)10 (100)7 (64)2 (100)20 (74)
Biting Fly32 (64)7 (70)7 (64)1 (50)17 (63)
Lice23 (46)4 (40)4 (36)1 (50)14 (52)
Spiders36 (72)8 (80)7 (64)2 (100)19 (70)
Scabies6 (12)1 (10)1 (9)0 (0)5 (19)
Bedbugs6 (12)0 (0)2 (18)0 (0)4 (15)
Outdoor exposureHiking38 (76)9 (90)8 (73)1 (50)20 (74)
Wildlife Rescue6 (12)3 (30)2 (18)1 (50) 0 (0)
Hunting5 (10)1 (10)0 (0)1 (50)3 (11)
Other39 (78)9 (90)8 (73)1 (50)21 (78)
Table 5. Babesia species and respective sequence homologies for 12 participants reporting fatigue of at least six months’ duration and neurological symptoms. Note: ^ species-specific probe signal detected but a sequence was not obtained; * partially readable Babesia sequence, but inadequate for species determination.
Table 5. Babesia species and respective sequence homologies for 12 participants reporting fatigue of at least six months’ duration and neurological symptoms. Note: ^ species-specific probe signal detected but a sequence was not obtained; * partially readable Babesia sequence, but inadequate for species determination.
ParticipantSpeciesHomology and Reference Sequence
4B. odocoilei376/385 bp (97.7%) B. odocoilei AY339756
5B. odocoilei101/105 bp (96.2%) B. odocoilei AY339756
B. microti103/103 bp (100%) B. microti GU230755
8B. microti520/524 bp (99.2%) B. microti GU230755
11B. microti453/455 bp (99.6%) B. microti GU230755
19B. divergens MO-1475/477 bp (99.6%) B. divergens PQ184854
22B. odocoilei123/124 bp (99.2%) B. odocoilei AY158711
24B. microti473/476 bp (99.4%) B. microti GU230755
25B. divergens MO-1564/567 bp (99.5%) B. divergens PQ184854
27B. divergens MO-1564/567 bp (99.5%) B. divergens PQ184854
30B. odocoileiProbe based ^
B. microtiProbe based ^
40Babesia sp. *50/50 bp * (100%) B. odocoilei AY339756
41B. microti119/121 bp (98.4%) B. microti GU230755
Table 6. Bartonella species and respective sequence homologies for 13 participants reporting fatigue of at least six months duration and neurological symptoms. Note: ^ species-specific probe signal detected but a sequence was not obtained; * partially readable Bartonella sequence, but inadequate for species determination.
Table 6. Bartonella species and respective sequence homologies for 13 participants reporting fatigue of at least six months duration and neurological symptoms. Note: ^ species-specific probe signal detected but a sequence was not obtained; * partially readable Bartonella sequence, but inadequate for species determination.
ParticipantSpeciesHomology and Reference Sequence
1B. henselae126/127 bp (99.2%) B. henselae SA2 AF369529
4B. henselae138/138 bp (100%) B. henselae SA2 AF369529
B. quintana128/128 (100%) B. quintana Oklahoma AF368391
5B. henselae140/140 bp (100%) B. henselae SA2 AF369529
6B. henselae135/135 bp (100%) B. henselae SA2 AF369529
14B. quintana129/129 bp (100%) B quintana Oklahoma AF368391
15B. henselaeProbe based ^
17B. henselae128/128 bp (100%) B. henselae SA2 AF369529
18B. koehlerae110/110 bp (100%) B. koehlerae AF312490
31B. henselae122/123 bp (99.2%) B. henselae SA2 AF369529
43B. henselaeProbe-based ^
44B. henselaeProbe-based ^
45B. henselae135/135 bp (100%) B. henselae SA2 AF369529
46B. spp. *87/87 (100%) Bartonella spp.
Table 7. Number of Babesia-positive individuals per DNA sample source. Note: for some individuals Babesia DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment cultures at 7, 14, or 21 days).
Table 7. Number of Babesia-positive individuals per DNA sample source. Note: for some individuals Babesia DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment cultures at 7, 14, or 21 days).
Sample Source
BloodBlood Cult 7 DaysBlood Cult 14 DaysBlood Cult 21 Days
B. odocoilei4---
B. microti15-1
B. divergens1-21
Babesia spp.--1-
Table 8. Number of Bartonella-positive individuals per DNA sample source. Note: for some individuals Bartonella DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment cultures at 7, 14, or 21 days).
Table 8. Number of Bartonella-positive individuals per DNA sample source. Note: for some individuals Bartonella DNA was detected in more than one sample type from the same individual (i.e., DNA amplified from blood and from one or more blood enrichment cultures at 7, 14, or 21 days).
Sample Source
BloodBlood Cult 7 DaysBlood Cult 14 DaysBlood Cult 21 Days
B. henselae8224
B. quintana-111
B. koehlerae1---
Bartonella new spp.1---
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Breitschwerdt, E.B.; Maggi, R.G.; Bush, J.C.; Kingston, E. Babesia and Bartonella Species DNA in Blood and Enrichment Blood Cultures from People with Chronic Fatigue and Concurrent Neurological Symptoms. Pathogens 2026, 15, 2. https://doi.org/10.3390/pathogens15010002

AMA Style

Breitschwerdt EB, Maggi RG, Bush JC, Kingston E. Babesia and Bartonella Species DNA in Blood and Enrichment Blood Cultures from People with Chronic Fatigue and Concurrent Neurological Symptoms. Pathogens. 2026; 15(1):2. https://doi.org/10.3390/pathogens15010002

Chicago/Turabian Style

Breitschwerdt, Edward B., Ricardo G. Maggi, Janice C. Bush, and Emily Kingston. 2026. "Babesia and Bartonella Species DNA in Blood and Enrichment Blood Cultures from People with Chronic Fatigue and Concurrent Neurological Symptoms" Pathogens 15, no. 1: 2. https://doi.org/10.3390/pathogens15010002

APA Style

Breitschwerdt, E. B., Maggi, R. G., Bush, J. C., & Kingston, E. (2026). Babesia and Bartonella Species DNA in Blood and Enrichment Blood Cultures from People with Chronic Fatigue and Concurrent Neurological Symptoms. Pathogens, 15(1), 2. https://doi.org/10.3390/pathogens15010002

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop