Next Article in Journal
Mobile Colistin Resistance (mcr) Genes in Cats and Dogs and Their Zoonotic Transmission Risks
Next Article in Special Issue
First Expert Elicitation of Knowledge on Drivers of Emergence of Bovine Besnoitiosis in Europe
Previous Article in Journal
Efficacy of a Fungal Formulation with the Nematophagous Fungus Pochonia chlamydosporia in the Biological Control of Bovine Nematodiosis
Previous Article in Special Issue
Diagnosis of Coxiella burnetii Cattle Abortion: A One-Year Observational Study
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Orbivirus Screening from Imported Captive Oryx in the United Arab Emirates Stresses the Importance of Pre-Import and Transit Measures

1
CARE-FEPEX Experimental Station, Fundamental and Applied Research for Animals & Health (FARAH) Center, Faculty of Veterinary Medicine, University of Liege, 4000 Liege, Belgium
2
Sciensano, Infectious Diseases in Animals, Exotic and Particular Diseases, 1050 Brussels, Belgium
3
School of Animal and Veterinary Sciences, University of Adelaide, Adelaide, SA 5005, Australia
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(6), 697; https://doi.org/10.3390/pathogens11060697
Submission received: 24 May 2022 / Revised: 13 June 2022 / Accepted: 14 June 2022 / Published: 17 June 2022
(This article belongs to the Special Issue Emerging Vector-Borne and Zoonotic Diseases)

Abstract

From 1975 to 2021, the United Arab Emirates (UAE) imported more than 1300 live Arabian oryxes (AOs) and scimitar-horned oryxes (SHOs) for conservation programs. The objective of this study was to estimate the prevalence of orbiviruses Bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV) in AOs and SHOs from captive herds in the UAE. Between October 2014 and April 2015, 16 AOs and 13 SHOs originating from Texas (USA) and 195 out of about 4000 SHOs from two locations in the UAE were blood sampled to be tested by indirect enzyme-linked immunosorbent assay (ELISA) and real-time reverse transcriptase polymerase chain reaction (RT-qPCR) assays. Eight imported AOs (50% CI [24.7–75.4%]) and eight imported SHOs (61.5% CI [31.6–86.1%]) were found BTV seropositive, in contrast with three out of 195 SHOs (1.5% CI [0.3–4.4%]) from the Emirates. BTV-2 genome was detected in 6/16 of the Arabian Oryx, and amongst those, one out of six was seronegative. None of the tested samples was found positive for EHDV. Our results illustrate the wide local variation regarding BTV seroprevalence in domestic and wild ruminants in the Arabian Peninsula. These results stress the need for pre-import risk assessment when considering translocation of wild ruminant species susceptible to orbiviruses not only in the country of destination but also where transit happens.

1. Introduction

Bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV) are vector-borne RNA viruses belonging to the genus Orbivirus, family Reoviridae that are the causative agents of bluetongue disease (BT) and epizootic hemorrhagic disease (EHD), respectively [1]. Both viruses are transmitted to host species by the bite of hematophagous midges of the genus Culicoides (Diptera: Ceratopogonidae) [2]. All ruminants are susceptible to infection with BTV; clinical disease is most often observed in sheep, whereas cattle (and goats) are considered reservoir species. In wildlife, a serious disease develops in white-tailed deer (Odocoileus virginianus) and pronghorn antelope (Antilocapra americana) [3,4,5]. EHDV severe infections, by contrast, are mostly limited to white-tailed deer despite some sporadic serious cases in other ruminant species. In susceptible livestock and other wildlife, the disease is considered generally subclinical [6]. When present, clinical manifestations of both diseases are quite similar, from a mild non-specific clinical picture including hyperthermia, weakness, depression, and anorexia to a fulminant hemorrhagic disease syndrome [6,7], possibly leading to dramatic economic losses [8]. In addition to the affected host species, virulence depends on the virus strains, serotypes, and geographical origin [9]. So far, up to 36 BTV serotypes have been described, including historical serotypes (BTV-1 to BTV-24) and the more recent non-virulent BTV-25 to BTV-36 [10,11]. There are currently at least seven EHDV serotypes [12,13].
The Arabian oryx (AO, Oryx leucoryx) and the scimitar-horned oryx (SHO, Oryx dammah) are two of six surviving species within the subfamily Hippotraginae [14]. These antelopes were endemic to the Arabian Peninsula and North Africa, respectively. Massive poaching and destruction of the habitat of the AOs and SHOs led to the extinction of these species in the wild in the 1970s for the AO and in the late 1980s or early 1990s for the SHO [15,16]. Reintroduction and conservation programs of the AO and SHO in the Middle East significantly rely on the use of captive-bred animals to be released into their former ranges [14]. The import of semi-wild animals in the United Arab Emirates (UAE) from game ranches in the United States of America (USA) is not uncommon, and Texas is one of the states providing AOs and SHOs to the UAE for conservation purposes. Based on the CITES database (https://trade.cites.org/en/cites_trade/#, accessed on 14 October 2021) and prioritizing the numbers reported by the exporters, there were 5814 SHOs and AOs live-traded globally between 1975 and 2021. The UAE was the main importer (1325 oryx), preceding Qatar (1066 oryx), Oman (635 oryx), Saudi Arabia (621 oryx), and Jordan (226 oryx). The UAE was also the largest exporter (2758 oryx). The second largest exporter was the USA, and out of the 1469 oryx exported by this country, 1000 were addressed to the UAE. Oryx species, therefore, represent the majority of the 1898 CITES-listed live Bovidae that have been shipped from the USA to the UAE since 1975. Over the last ten years (2011–2021), 195 oryx (76 SHOs and 119 AOs) were officially shipped on five different occasions from the USA to the UAE.
In the aftermath of the unexpected 2006–2012 BTV-8 and 2007–2010 BTV-1 epizootics, by 2015, Western Europe was facing the re-emergence of BTV-8 in France [17]. BTV-8 is believed to have caused greater economic damage than any previous single serotype BTV outbreak [8]. Indeed, it showed an increased severity toward cattle [18] and displayed a noticeable ability to be vertically transmitted [19]. In addition, BTV-1, 2, 4, 9, and 16 have been continuously present in parts of the Mediterranean Basin, including several EU member states, since at least 1998 [20]. These BTV strains originated from the Near and Middle East, where they have been identified since the 1960s and have persisted since [21].
BTV-11, 13, and 17 were regularly reported in Texas [22]. BTV-2 has been considered enzootic in the southeastern US since the early 1980s and, more recently, was isolated in California [23,24]. Comparing BTV serotypes possibly found in Europe, southwestern USA, and the Middle East, BTV-2 happens to be potentially present in all three areas. Significant levels of EHDV antibodies were also recorded in wild ruminants both in the Arabian Peninsula [14] and Texas (serotypes 1 and 2 [25]).
In the current study, we investigated the prevalence of BTV and EHDV in AOs and SHOs imported from Texas to the UAE with a stopover in the European Union in 2013 and 2015 and compared them to the prevalence found in indigenous captive animals. Viruses that were detected were further characterized.

2. Results

All results are summarized in Table 1, sorted by species and origin. Test results are expressed as the number of positive animals/tested animals.

2.1. Serology

2.1.1. Indigenous Animals

Of the 176 SHOs tested with iELISA at the Abu Dhabi location (site A), three were found to be BTV seropositive (1.7%; 95% CI: 0.3–4.9) and none out of the 19 (0%; 95% CI: 0–17.7) from the Dubai collection (site B).

2.1.2. Imported Animals

Eight out of the sixteen AOs (50%; 95% CI: 24.7–75.4) and eight out of the thirteen SHOs (61.5%; 95% CI: 31.6–86.1) from the USA were found BTV seropositive.
None of the tested samples could be found positive for EHDV.

2.2. Pan-BTV RT-qPCR and Serotype-Specific RT-qPCR

No positive samples were detected in indigenous animals. The BTV genome was detected in 6/16 of the AOs from Texas (38%; 95% CI: 18–61), and amongst those, one out of six was seronegative. Overall, the Cp values were high (33–39). No viral genome could be detected in the SHO samples.
All six AO samples positive by RT-qPCR were found positive for BTV-2 by serotype-specific RT-qPCR. Among those, two samples were confirmed to be BTV-2 by sequencing, including the seronegative sample. As none of the animals could be found seropositive against EHDV, no further EHDV genome detection was carried out.

3. Discussion

The low seroprevalence and viral RNA detection for BTV, as well as the absence of EHDV detection, we observed in the animals from the two locations within the UAE somewhat contrasts the rather elevated seroprevalences reported by Frölich et al. (2005) in AOs (up to 48 and 50% for BTV and EHDV, respectively). These discrepancies might originate from the different natural habitats affecting the local Culicoides populations and dynamics. Indeed, Frölich et al. (2005) also reported negative sample collections from specific locations for both viruses. Our results suggest that the UAE’s local natural conditions where the two collections were realized are inadequate for the survival or transmission of orbiviruses.
On the other hand, 55% of the animals imported from Texas overall were BTV seropositive (respectively, 50% and 61.5% for AO and SHO). In the current study, BTV antibodies were detected using an indirect ELISA kit advised by the manufacturer to be used on milk [26,27]. The preliminary results suggested better correspondence with cELISA on serum when compared to homologous blood samples on dried blood spots tested with cELISA and sELISA [28].
Despite the quite high seroprevalence in both AO and SHO from Texas, the BTV genome was found in 6/16 AOs but 0/13 SHO. BTV RNA is known for being detectable for months following infection in ruminants, up to 213 days in cattle [29], and up to 89 days at the least in sheep [30], although the BTV-25 genome could be detected for 19–25 months in goats [31]. In addition, in red deer, it could be detected for up to 112 days [32], but the length of RNAemia in AO and SHO remains unknown. The positive low-level viral RNA detection in AO suggests a potential outbreak several weeks or months earlier. In the SHO, by contrast, the negative PCR results are likely related to an older infection.
A BTV-2 PCR-positive sample happened to be seronegative. The iELISA used in the current study detects circulating antibodies targeting VP7. The lack of anti-VP7 antibodies following BTV vaccination or infection was previously reported in cattle and was additionally only poorly correlated to clinical and virological protection [33,34]. A weak positive PCR result and the absence of detectable VP7 antibodies could also be related to a very early stage of infection; however, given the serological and virological status of the other AO, this hypothesis is unconvincing. BTV-2 is not considered the most prevalent serotype in Texas. Neutralizing antibodies to BTV-2 were observed nonetheless in Texas in 1991–1992 [35]. Previous exposures to other BTV serotypes cannot be excluded as BTV-13, BTV-11, and BTV-17 are considered enzootic in Texas [36]. Moreover, BTV-12 and BTV-3 were isolated in Texas in 2008 and 2014, respectively [37].
No positive EHDV samples could be found either from USA or UAE. Previous reports showed an EHDV seroprevalence in white-tailed deer widespread throughout Texas, with up to 100% of the tested animals being positive [35]. In 2014, EHDV-2 was successfully isolated in Eld’s deer (Panolia eldii) [38]. In Texas, EHDV-2 is the most prevalent serotype, followed by EHDV-1 and the more recent identification of EHDV-6 [39]. In the Middle East, outbreaks of EHDV-6 were reported in 2006, along with EHDV-7 outbreaks in Israel. In 2015, clinical EHDV-6 outbreaks were also reported in Israel [40]. As for BTV, EHDV seroprevalence demonstrated large local variations within a considered country [14].
Since BTV is prevalent in certain areas of the UAE, a transmission occurring between landing and testing cannot be totally ruled out. This case demonstrates that import health permits are not requested by countries where a stopover is carried out, possibly posing a risk of vector-borne disease transmission. Usually on long distance, flight between continents freight is routed to local hubs to be sorted to the final destination (P. Lignereux, personal communication). This implies to take the animals off and reload them in a second plane. Freight transfer only takes a couple of hours with limited contact of the animals with the environment. European Palearctic Culicoides species were proven to be competent orbivirus vectors with some species displaying a strong endophilic behavior [41]. Therefore, importation of ruminants infected with exotic BTV serotypes threatens not only the importing country but any European country where at risk animals would stopover [42].
Animal exportation screening is usually solely based upon the importer’s requirements. At the time of sampling, the requirements to import live ruminants into the UAE were brucellosis and Foot-and-Mouth Disease testing. The reason was mainly that most livestock would arrive by road from neighboring countries. This is of major concern, especially in cases where animals might transit in a third-party country. These results stress the need for pre-import risk assessment, precaution, and the implementation of biosecurity measures when considering the translocation of wild ruminant species susceptible to BTV and EHDV.
Therefore, we would suggest avoiding stopovers of live ruminant shipments in countries where competent orbiviruses vectors were reported or at minimum vector control in resting areas inside airports.
In addition, we recommend Culicoides biological surveys to be carried out in the different natural habitats and BTV and EHDV virus surveys in all susceptible species within the UAE.

4. Materials and Methods

4.1. Sample Origin

One hundred and ninety-five SHOs from two locations in the UAE (Figure 1) were sampled (“indigenous animals”). In addition, 16 AOs and 13 SHOs imported from the USA (“imported animals”) were blood sampled once they arrived in the UAE.

4.1.1. Indigenous Animals

For herd management and disease screening purposes, 176 SHOs were bled in January and May 2013 amongst approximately 4000 other SHOs in a high-density wildlife collection housing over 13,000 wild ungulates, located 45 km inland (24.22295, 54.76194, site A) and east of Abu Dhabi. The overall setup is approximately 5.4 km² and was already described in [43].
Another 19 SHOs were bled out of approximately 50 individuals in a remote and desert semi-wild location, 225 km², in Dubai emirate (24.89347, 55.66370, site B) in January 2015. Locations were about 120 km apart.

4.1.2. Imported Animals

To improve the genetic diversity of the local AO and SHO populations for conservation purposes, 39 adult AOs and 42 SHOs coming from different wildlife ranches and zoological parks in the USA were gathered by an animal broker located in Texas where they underwent brucellosis and bovine tuberculosis testing required by the importer. They were flown in individual crates and transited through the European Union without being subjected to any European health requirements prior to their transit. The AOs landed on 13 October 2013 and the SHOs on 15 April 2015. They were then quarantined in a wildlife facility remotely located in the desert (24.06453, 55.04956). Sixteen AOs and thirteen SHOs were physically restrained with a chute system 15 and 5 days post-arrival, respectively. At that time, they underwent clinical examination and were blood-sampled. None of the sampled animals displayed clinical signs evocative of an orbivirus infection.

4.2. Dry Blood Spots (DBS) for Virological and Serological Testing

Blood was drawn from the jugular vein of the animals and placed into 9 mL ethylenediamine tetraacetic acid (EDTA)-coated tubes. Blood samples were then stored at −20 °C and processed within 6 months. Blood was allowed to thaw at 6 °C overnight and then placed in a dry bath set at 56 °C for 30 min to deactivate any potential Foot-and-Mouth disease virus. With a pipettor, 80 µL of blood were dispensed on Whatman protein saver cards and left out to dry at room temperature (RT) according to an adapted protocol described elsewhere [44,45]. Dry blood spots were subsequently punched out in paper discs with a 6 mm diameter punch in the middle of the deposit and diluted in 250 µL PBS and Tween 20 0.05%. Samples were then gently vortexed and left overnight at 4 °C. The obtained eluates were reported to be equivalent to a 1/25 dilution of the corresponding serum [46]. Samples were slightly stirred before using the required amount of supernatant.

4.3. Serology

4.3.1. Epizootic Hemorrhagic Disease Virus Competitive Enzyme-Linked Immunosorbent Assay

Oryx dried blood paper discs were tested to detect antibodies against EHDV VP7 protein by competitive ELISA (LSIVet Ruminant EHDV Serum ELISA Kit, LSI, Lissieu, France) following manufacturer’s recommendations [47]. Percentage of inhibition (% inh) of each sample was interpreted as follows: % inh < 55 = negative, 55 < % inh < 60 = doubtful and % inh > 60 = positive.

4.3.2. Bluetongue Virus Indirect Enzyme-Linked Immunosorbent Assay

Antibodies against BTV VP7 protein were tested by indirect ELISA (iELISA, ID Screen® Bluetongue Milk Indirect, ID Vet, Grabels, France) according to the manufacturer’s instructions with minor modifications. Briefly, 50 mL of supernatant and 50 mL ‘wash solution’ were added to the wells of a BTV-VP7-coated microtiter plate. After incubation for 45 min at RT, plates were washed and incubated with 100 mL anti-ruminant peroxidase conjugate for 30 min at RT. After washing, wells were incubated for 15 min at RT with 100 mL TMB substrate. Color development was stopped by the addition of 100 mL 0.5 M H2SO4. S/P% (ODsample/ODpositive control × 100%) was calculated using optical density values measured at 450 nm. S/P% ≥ 50% was considered as positive [27]. In addition to positive and negative controls from the kit, highly positive BTV-8 cattle serum and negative cattle serum from previous experiments [48] were included on each plate.

4.4. RT-qPCR pan-BTV (S5)

Pan-BTV RT-qPCR was performed on all imported animals (AO n = 16, SHO n = 13), whereas only seropositive samples from animals already in the UAE were tested. The detection of the BTV genome in eluted oryx samples was carried out using a pan-BTV RT-qPCR consisting of a triplex RT-qPCR (RT-qPCR) targeting segment 5, internal control (IC), and external control (EC), as described by [49]. Prior to being used on oryx samples, the RT-qPCR protocol was validated on cattle dry blood spots of known infectious status from previous experiments [50]. The RT-qPCR was performed on a LightCycler- 480 (Roche Diagnostics, Mannheim, Germany). For this assay, crossing-point values (Cp values) < 40.0 were classified as positive, Cp values >40.0 and <45.0 were classified as doubtful, and Cp values > 45.0 were considered as negative (Neg) [49].

4.5. Serotype-Specific RT-qPCR

As BTV-2 was reported in all three areas of interest (Europe, southwestern USA, and the Middle East), we focused serotype-specific detection on that particular serotype. In-house serotype-specific real-time RT-qPCRs for BTV-2 targeting segment 2 of the viral genome were carried out (cycling profile and mix set-up) similarly to the BTV serotype real-time RT-qPCRs described by Vandenbussche et al., 2009 with the extra addition of 1U Taq Platinum (Invitrogen, Merelbeke, Belgium) to the enzyme mix [51]. The following primers/probe were used, with the final concentration between brackets and LNA nucleotide with “+”: BTV-2 (forward ATGATGTTTCCAAGATTCCTGAGATG (1 µM); Reverse CATTTCGTGTTGGCATATATTTGAGTG (0.75 µM); Probe 6’FAM-CT+CA+TC+TT+TGATATCG+TAAGC-BHQ1 (0.25 µM)).

4.6. Cloning/Plasmid/Preparation Sequencing

Each BTV sequence amplified by serotype-specific RT-qPCR was prepared for further sequencing. A total of 4 µL of purified serotype-specific real-time RT-qPCR fragment was ligated into the pCR2.1-Topo vector using TOPO TA Cloning (Invitrogen, Merelbeke, Belgium). Following blue/white screening on X-gal containing kanamycin (50 µg/mL) LB plates, plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions. Insert verification was carried out by Eco RI digestion and gel electrophoresis.
The purified plasmids were sequenced using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA). The sequence reactions were purified by precipitation with 80% ethanol and centrifugation at 12,000× g for 15 min at 4 °C. After washing with 70% ethanol, the pellet was air-dried and dissolved subsequently in a 25 µL template suppression reagent (Applied Biosystems Foster City, CA, USA). Next, the purified product was denatured by incubation for 2 min at 94 °C and was subsequently analyzed on the ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). The obtained sequences were identified and compared with publicly available sequences and with the obtained reference sequence using the “blast” engine at “http://www.ncbi.nlm.nih.gov/BLAST/ (accessed on 8 February 2017)” [52].

4.7. Statistical Analysis

The seroprevalences and their 95% confidence intervals (CI) were calculated using the binomial "exact" method in the online calculator Epitools [53].

Author Contributions

Conceptualization, L.M., C.S., L.L. and A.-L.C.; methodology, L.M., L.L., K.D.C., A.H., I.D.L., F.D.P. and C.S.; software, L.L. and C.S.; validation, K.D.C., A.H. and I.D.L.; formal analysis, L.M. and A.H.; investigation, L.L. and A.-L.C.; data curation, L.M., A.H. and L.L.; writ-ing—original draft preparation, L.M., A.H. and L.L.; writing—review and editing, L.M., L.L., K.D.C., A.H., I.D.L., F.D.P. and C.S; supervision, C.S. and K.D.C.; project administration, L.M. and C.S.; funding acquisition, C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Ethical review and approval were waived for this study due to animal sampling being part of everyday animal handling for population management purposes in an ex situ conservation project and local mandatory biosecurity regulations required following importation of wild ruminants.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would like to thank the Ministry of Climate Change and Environment of the United Arab Emirates for their support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ahmed, S.; Mahmoud, M.A.E.; Viarouge, C.; Sailleau, C.; Zientara, S.; Breard, E. Presence of bluetongue and epizootic hemorrhagic disease viruses in Egypt in 2016 and 2017. Infect. Genet. Evol. 2019, 73, 221–226. [Google Scholar] [CrossRef] [Scilit]
  2. Mellor, P.S.; Boorman, J.; Baylis, M. Culicoides biting midges: Their role as arbovirus vectors. Ann. Rev. Entomol. 2000, 45, 307–340. [Google Scholar] [CrossRef] [Scilit]
  3. Johnson, D.J.; Ostlund, E.N.; Stallknecht, D.E.; Goekjian, V.H.; Jenkins-Moore, M.; Harris, S.C. First report of bluetongue virus serotype 1 isolated from a white-tailed deer in the United States. J. Vet. Diagn. Investig. 2006, 18, 398–401. [Google Scholar] [CrossRef] [Scilit]
  4. Parsonson, I.M. Pathology and pathogenesis of bluetongue infections. Curr. Top. Microbiol. Immunol. 1990, 162, 119–141. [Google Scholar] [CrossRef] [Scilit]
  5. Drolet, B.S.; Reister-Hendricks, L.M.; Podell, B.K.; Breitenbach, J.E.; McVey, D.S.; van Rijn, P.A.; Bowen, R.A. European bluetongue serotype 8: Disease threat assessment for U.S. sheep. Vector Borne Zoonotic Dis. 2016, 16, 400–407. [Google Scholar] [CrossRef] [Scilit]
  6. Maclachlan, N.J.; Zientara, S.; Savini, G.; Daniels, P.W. Epizootic haemorrhagic disease. Rev. Sci. Tech. 2015, 34, 341–351. [Google Scholar] [CrossRef] [Scilit]
  7. Maclachlan, N.J.; Drew, C.P.; Darpel, K.E.; Worwa, G. The pathology and pathogenesis of bluetongue. J. Comp. Pathol. 2009, 141, 1–16. [Google Scholar] [CrossRef] [Scilit]
  8. Wilson, A.J.; Mellor, P.S. Bluetongue in Europe: Past, present and future. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 2669–2681. [Google Scholar] [CrossRef] [Scilit]
  9. Dahiya, S.; Prasad, G.; Kovi, R.C. VP2 gene based phylogenetic relationship of Indian isolates of Bluetongue virus serotype 1 and other serotypes from different parts of the world. DNA Seq. 2004, 15, 351–361. [Google Scholar] [CrossRef] [Scilit]
  10. Ries, C.; Beer, M.; Hoffmann, B. BlueTYPE—A low density TaqMan-RT-qPCR array for the identification of all 24 classical Bluetongue virus serotypes. J. Virol. Methods 2020, 282, 113881. [Google Scholar] [CrossRef] [Scilit]
  11. Ries, C.; Vogtlin, A.; Hussy, D.; Jandt, T.; Gobet, H.; Hilbe, M.; Burgener, C.; Schweizer, L.; Hafliger-Speiser, S.; Beer, M.; et al. Putative novel atypical BTV serotype ’36’ identified in small ruminants in Switzerland. Viruses 2021, 13, 721. [Google Scholar] [CrossRef] [Scilit]
  12. Anthony, S.J.; Maan, S.; Maan, N.; Kgosana, L.; Bachanek-Bankowska, K.; Batten, C.; Darpel, K.E.; Sutton, G.; Attoui, H.; Mertens, P.P. Genetic and phylogenetic analysis of the outer-coat proteins VP2 and VP5 of epizootic haemorrhagic disease virus (EHDV): Comparison of genetic and serological data to characterise the EHDV serogroup. Virus Res. 2009, 145, 200–210. [Google Scholar] [CrossRef] [Scilit]
  13. Mendiola, S.Y.; Mills, M.K.; Maki, E.; Drolet, B.S.; Wilson, W.C.; Berghaus, R.; Stallknecht, D.E.; Breitenbach, J.; McVey, D.S.; Ruder, M.G. EHDV-2 infection prevalence varies in Culicoides sonorensis after feeding on infected white-tailed deer over the course of viremia. Viruses 2019, 11, 371. [Google Scholar] [CrossRef] [Scilit]
  14. Frolich, K.; Hamblin, C.; Jung, S.; Ostrowski, S.; Mwanzia, J.; Streich, W.J.; Anderson, J.; Armstrong, R.M.; Anajariyah, S. Serologic surveillance for selected viral agents in captive and free-ranging populations of Arabian oryx (Oryx leucoryx) from Saudi Arabia and the United Arab Emirates. J. Wildl. Dis. 2005, 41, 67–79. [Google Scholar] [CrossRef] [Scilit]
  15. Henderson, D.S. Were they the last arabian oryx? Oryx 1974, 12, 347–350. [Google Scholar] [CrossRef] [Scilit]
  16. Woodfine, T.; Gilbert, T. The fall and rise of the scimitar-horned oryx: A case study of ex-situ conservation and reintroduction in practice. In Antelope Conservation: From Diagnosis to Action, 1st ed.; Bro-Jorgensen, J., Mallon, D.P., Eds.; Wiley-Blackwell: Hoboken, NJ, USA, 2016; p. 376. [Google Scholar] [CrossRef] [Scilit]
  17. Courtejoie, N.; Durand, B.; Bournez, L.; Gorlier, A.; Breard, E.; Sailleau, C.; Vitour, D.; Zientara, S.; Baurier, F.; Gourmelen, C.; et al. Circulation of bluetongue virus 8 in French cattle, before and after the re-emergence in 2015. Transbound. Emerg. Dis. 2018, 65, 281–284. [Google Scholar] [CrossRef] [Scilit]
  18. Caporale, M.; Di Gialleonorado, L.; Janowicz, A.; Wilkie, G.; Shaw, A.; Savini, G.; Van Rijn, P.A.; Mertens, P.; Di Ventura, M.; Palmarini, M. Virus and host factors affecting the clinical outcome of bluetongue virus infection. J. Virol. 2014, 88, 10399–10411. [Google Scholar] [CrossRef] [Scilit]
  19. Haegeman, A.; Vandaele, L.; De Leeuw, I.; Oliveira, A.P.; Nauwynck, H.; Van Soom, A.; De Clercq, K. Failure to remove bluetongue serotype 8 virus (BTV-8) from in vitro produced and in vivo derived bovine embryos and subsequent transmission of to recipient cows after embryo transfer. Front. Vet. Sci. 2019, 6, 432. [Google Scholar] [CrossRef] [Scilit]
  20. Saegerman, C.; Berkvens, D.; Mellor, P.S. Bluetongue epidemiology in the European Union. Emerg. Infect. Dis. 2008, 14, 539–544. [Google Scholar] [CrossRef] [Scilit]
  21. Shimshony, A. Bluetongue in Israel—A brief historical overview. Vet. Ital. 2004, 40, 116–118. [Google Scholar]
  22. United States Department of Agriculture. Bluetongue Standard Operating Procedures: Overview of Etiology and Ecology; US Department of Agriculture: Riverdale, MD, USA, 2016.
  23. Gaudreault, N.N.; Mayo, C.E.; Jasperson, D.C.; Crossley, B.M.; Breitmeyer, R.E.; Johnson, D.J.; Ostlund, E.N.; MacLachlan, N.J.; Wilson, W.C. Whole genome sequencing and phylogenetic analysis of Bluetongue virus serotype 2 strains isolated in the Americas including a novel strain from the western United States. J. Vet. Diagn. Investig 2014, 26, 553–557. [Google Scholar] [CrossRef] [Scilit]
  24. Maclachlan, N.J.; Wilson, W.C.; Crossley, B.M.; Mayo, C.E.; Jasperson, D.C.; Breitmeyer, R.E.; Whiteford, A.M. Novel serotype of bluetongue virus, western North America. Emerg. Infect. Dis. 2013, 19, 665–666. [Google Scholar] [CrossRef] [Scilit]
  25. Stevens, G.; McCluskey, B.; King, A.; O’Hearn, E.; Mayr, G. Review of the 2012 Epizootic hemorrhagic disease outbreak in domestic ruminants in the United States. PLoS ONE 2015, 10, e0133359. [Google Scholar] [CrossRef] [Scilit]
  26. Lignereux, L.; Chaber, A.L.; Saegerman, C.; Heath, L.; Knowles, N.J.; Wadsworth, J.; Mioulet, V.; King, D.P. Foot-and-mouth disease outbreaks in captive scimitar-horned oryx (Oryx dammah). Transbound. Emerg. Dis. 2020, 67, 1716–1724. [Google Scholar] [CrossRef] [Scilit]
  27. Sun, D.; Cho, Y.I.; Comyn, P.; Yoon, K.J. Use of blood collected onto and dried on filter paper for diagnosing pregnancy in cattle. Vet. J. 2013, 198, 494–497. [Google Scholar] [CrossRef] [Scilit]
  28. Yoon, K.J.; Cho, Y.I.; Kim, W.I.; Pittman, J.S.; Brinkman, M.; Winton, C. Experimental and field trial of TEGO™ Animal Blood Collection kit for PRRS testing. In Proceedings of the Annual Meeting of American Association of Swine Veterinarians, Omaha, NE, USA, 6–9 March 2010; pp. 211–214. [Google Scholar]
  29. Fenollar, F.; Raoult, D. Diagnosis of rickettsial diseases using samples dried on blotting paper. Clin. Diagn. Lab Immunol. 1999, 6, 483–488. [Google Scholar] [CrossRef] [Scilit]
  30. Mejri, S.; Dhaou, S.B.; Jemli, M.; Breard, E.; Sailleau, C.; Sghaier, S.; Zouari, M.; Lorusso, A.; Savini, G.; Zientara, S.; et al. Epizootic haemorrhagic disease virus circulation in Tunisia. Vet. Ital. 2018, 54, 87–90. [Google Scholar] [CrossRef] [Scilit]
  31. Kramps, J.A.; van Maanen, K.; Mars, M.H.; Popma, J.K.; van Rijn, P.A. Validation of a commercial ELISA for the detection of bluetongue virus (BTV)-specific antibodies in individual milk samples of Dutch dairy cows. Vet. Microbiol. 2008, 130, 80–87. [Google Scholar] [CrossRef] [Scilit]
  32. Martinelle, L.; Dal Pozzo, F.; Sarradin, P.; De Leeuw, I.; De Clercq, K.; Thys, C.; Ziant, D.; Thiry, E.; Saegerman, C. Two alternative inocula to reproduce bluetongue virus serotype 8 disease in calves. Vaccine 2011, 29, 3600–3609. [Google Scholar] [CrossRef] [Scilit]
  33. Vandenbussche, F.; Vandemeulebroucke, E.; De Clercq, K. Simultaneous detection of bluetongue virus RNA, internal control GAPDH mRNA, and external control synthetic RNA by multiplex real-time PCR. Methods Mol. Biol. 2010, 630, 97–108. [Google Scholar] [CrossRef] [Scilit]
  34. Martinelle, L.; Dal Pozzo, F.; Thys, C.; De Leeuw, I.; Van Campe, W.; De Clercq, K.; Thiry, E.; Saegerman, C. Assessment of cross-protection induced by a bluetongue virus (BTV) serotype 8 vaccine towards other BTV serotypes in experimental conditions. Vet. Res. 2018, 49, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Vandenbussche, F.; De Leeuw, I.; Vandemeulebroucke, E.; De Clercq, K. Emergence of bluetongue serotypes in Europe, part 1: Description and validation of four real-time RT-PCR assays for the serotyping of bluetongue viruses BTV-1, BTV-6, BTV-8 and BTV-11. Transbound. Emerg. Dis. 2009, 56, 346–354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Tatusova, T.A.; Madden, T.L. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 1999, 174, 247–250. [Google Scholar] [CrossRef]
  37. Sergeant, E.S.G. Epitools Epidemiological Calculators. Available online: https://epitools.ausvet.com.au/ (accessed on 22 June 2019).
  38. Chaignat, V.; Nitzsche, S.; Scharrer, S.; Feyer, D.; Schwermer, H.; Thur, B. Milk concentration improves Bluetongue antibody detection by use of an indirect ELISA. Vet. Microbiol. 2010, 143, 179–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Martinelle, L.; Chaber, A.L.; Dal Pozzo, F.; Lignereux, L.; Saegerman, C. Dried Blood Spots are Valuable to Perform Bluetongue Virus Diagnostic Tests; University of Liege: Liège, Belgium, 2021; manuscript in preparation. [Google Scholar]
  40. Zanella, G.; Martinelle, L.; Guyot, H.; Mauroy, A.; De Clercq, K.; Saegerman, C. Clinical pattern characterization of cattle naturally infected by BTV-8. Transbound. Emerg. Dis. 2013, 60, 231–237. [Google Scholar] [CrossRef] [Scilit]
  41. Katz, J.; Alstad, D.; Gustafson, G.; Evermann, J. Diagnostic analysis of the prolonged bluetongue virus RNA presence found in the blood of naturally infected cattle and experimentally infected sheep. J. Vet. Diagn. Investig. 1994, 6, 139–142. [Google Scholar] [CrossRef] [Scilit]
  42. Vogtlin, A.; Hofmann, M.A.; Nenniger, C.; Renzullo, S.; Steinrigl, A.; Loitsch, A.; Schwermer, H.; Kaufmann, C.; Thur, B. Long-term infection of goats with bluetongue virus serotype 25. Vet. Microbiol. 2013, 166, 165–173. [Google Scholar] [CrossRef] [Scilit]
  43. Falconi, C.; Lopez-Olvera, J.R.; Gortazar, C. BTV infection in wild ruminants, with emphasis on red deer: A review. Vet. Microbiol. 2011, 151, 209–219. [Google Scholar] [CrossRef] [Scilit]
  44. Oura, C.A.; Wood, J.L.; Sanders, A.J.; Bin-Tarif, A.; Henstock, M.; Edwards, L.; Floyd, T.; Simmons, H.; Batten, C.A. Seroconversion, neutralising antibodies and protection in bluetongue serotype 8 vaccinated sheep. Vaccine 2009, 27, 7326–7330. [Google Scholar] [CrossRef] [Scilit]
  45. De Clercq, K.; De Leeuw, I.; Verheyden, B.; Vandemeulebroucke, E.; Vanbinst, T.; Herr, C.; Meroc, E.; Bertels, G.; Steurbaut, N.; Miry, C.; et al. Transplacental infection and apparently immunotolerance induced by a wild-type bluetongue virus serotype 8 natural infection. Transbound. Emerg. Dis. 2008, 55, 352–359. [Google Scholar] [CrossRef] [Scilit]
  46. Stallknecht, D.E.; Luttrell, M.P.; Smith, K.E.; Nettles, V.F. Hemorrhagic disease in white-tailed deer in Texas: A case for enzootic stability. J. Wildl. Dis. 1996, 32, 695–700. [Google Scholar] [CrossRef] [Scilit]
  47. Mayo, C.; McDermott, E.; Kopanke, J.; Stenglein, M.; Lee, J.; Mathiason, C.; Carpenter, M.; Reed, K.; Perkins, T.A. Ecological dynamics impacting bluetongue virus transmission in North America. Front. Vet. Sci. 2020, 7, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Schirtzinger, E.E.; Jasperson, D.C.; Ostlund, E.N.; Johnson, D.J.; Wilson, W.C. Recent US Bluetongue virus serotype 3 isolates found outside of Florida indicate evidence of reassortment with co-circulating endemic serotypes. J. Gen. Virol. 2018, 99, 157–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Gibbs, P.; McVey, D.S. Report of the Committee on Bluetongue and Related Orbiviruses; United States Animal Health Association (USAHA): Providence, RI, USA, 2015. [Google Scholar]
  50. Allison, A.B.; Goekjian, V.H.; Potgieter, A.C.; Wilson, W.C.; Johnson, D.J.; Mertens, P.P.; Stallknecht, D.E. Detection of a novel reassortant epizootic hemorrhagic disease virus (EHDV) in the USA containing RNA segments derived from both exotic (EHDV-6) and endemic (EHDV-2) serotypes. J. Gen. Virol. 2010, 91, 430–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Golender, N.; Khinich, Y.; Gorohov, A.; Abramovitz, I.; Bumbarov, V. Epizootic hemorrhagic disease virus serotype 6 outbreak in Israeli cattle in 2015. J. Vet. Diagn. Investig. 2017, 29, 885–888. [Google Scholar] [CrossRef] [Scilit]
  52. Baldet, T.; Delecolle, J.C.; Cetre-Sossah, C.; Mathieu, B.; Meiswinkel, R.; Gerbier, G. Indoor activity of Culicoides associated with livestock in the bluetongue virus (BTV) affected region of northern France during autumn 2006. Prev. Vet. Med. 2008, 87, 84–97. [Google Scholar] [CrossRef] [Scilit]
  53. Walton, T.E. The history of bluetongue and a current global overview. Vet. Ital. 2004, 40, 31–38. [Google Scholar]
Figure 1. Indigenous animals sampling locations. A total of 176 out of 4000 SHOs were sampled in January and May at site A (high animal density, 5.4 km²). Nineteen out of about fifty SHOs were sampled in January 2015 at site B (semi-wild desert area, 225 km²).
Figure 1. Indigenous animals sampling locations. A total of 176 out of 4000 SHOs were sampled in January and May at site A (high animal density, 5.4 km²). Nineteen out of about fifty SHOs were sampled in January 2015 at site B (semi-wild desert area, 225 km²).
Pathogens 11 00697 g001
Table 1. Indirect ELISA (iELISA), competitive ELISA (cELISA), and RT-qPCR results according to the species and origin of the tested animals.
Table 1. Indirect ELISA (iELISA), competitive ELISA (cELISA), and RT-qPCR results according to the species and origin of the tested animals.
Positive Animals/Tested Animals (% of Positive Animals; 95% CI)
Origin of the AnimalsSpeciesNb of Sampled Animals/Total nb of AnimalsBTV iELISART-qPCR pan-BTV RT-qPCR BTV-2EHDV cELISA
Indigenous, site AScimitar Horned Oryx176/40003/176 (1.7%; 0.3–4.9)0/30/30/176
Indigenous, site BScimitar Horned Oryx19/500/19NANA0/19
Imported (Texas)Scimitar Horned Oryx13/428/13 (61.5%; 31.6–86.1)0/130/130/13
Imported (Texas)Arabian Oryx16/398/16 (50%; 24.7–75.4)6/16 (38%; 18–61)6/160/16
Only seropositive samples from indigenous animals were tested by RT-qPCR.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Martinelle, L.; Haegeman, A.; Lignereux, L.; Chaber, A.-L.; Dal Pozzo, F.; De Leeuw, I.; De Clercq, K.; Saegerman, C. Orbivirus Screening from Imported Captive Oryx in the United Arab Emirates Stresses the Importance of Pre-Import and Transit Measures. Pathogens 2022, 11, 697. https://doi.org/10.3390/pathogens11060697

AMA Style

Martinelle L, Haegeman A, Lignereux L, Chaber A-L, Dal Pozzo F, De Leeuw I, De Clercq K, Saegerman C. Orbivirus Screening from Imported Captive Oryx in the United Arab Emirates Stresses the Importance of Pre-Import and Transit Measures. Pathogens. 2022; 11(6):697. https://doi.org/10.3390/pathogens11060697

Chicago/Turabian Style

Martinelle, Ludovic, Andy Haegeman, Louis Lignereux, Anne-Lise Chaber, Fabiana Dal Pozzo, Ilse De Leeuw, Kris De Clercq, and Claude Saegerman. 2022. "Orbivirus Screening from Imported Captive Oryx in the United Arab Emirates Stresses the Importance of Pre-Import and Transit Measures" Pathogens 11, no. 6: 697. https://doi.org/10.3390/pathogens11060697

APA Style

Martinelle, L., Haegeman, A., Lignereux, L., Chaber, A.-L., Dal Pozzo, F., De Leeuw, I., De Clercq, K., & Saegerman, C. (2022). Orbivirus Screening from Imported Captive Oryx in the United Arab Emirates Stresses the Importance of Pre-Import and Transit Measures. Pathogens, 11(6), 697. https://doi.org/10.3390/pathogens11060697

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop